General Information of the m6A Target Gene (ID: M6ATAR00278)
Target Name Hepatocyte nuclear factor 1-alpha (HNF1A/TCF1)
Synonyms
HNF-1-alpha; HNF-1A; Liver-specific transcription factor LF-B1; LFB1; Transcription factor 1; TCF-1; TCF1
    Click to Show/Hide
Gene Name HNF1A
Chromosomal Location 12q24.31
Family HNF1 homeobox family
Function
Transcriptional activator that regulates the tissue specific expression of multiple genes, especially in pancreatic islet cells and in liver (By similarity). Binds to the inverted palindrome 5'-GTTAATNATTAAC-3'. Activates the transcription of CYP1A2, CYP2E1 and CYP3A11 (By similarity).
    Click to Show/Hide
Gene ID 6927
Uniprot ID
HNF1A_HUMAN
HGNC ID
HGNC:11621
KEGG ID
hsa:6927
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
HNF1A can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line mouse embryonic stem cells Mus musculus
Treatment: METTL3-/- ESCs
Control: Wild type ESCs
GSE145309
Regulation
logFC: -1.64E+00
p-value: 4.47E-50
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between HNF1A and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 6.55E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Silence of METTL3 inhibited migratory ability and Wnt activity in TPC-1 cells. METTL3 positively regulated the enrichment abundance of Hepatocyte nuclear factor 1-alpha (HNF1A/TCF1) in anti-IGF2BP2. TCF1 was responsible for METTL3-regulated thyroid carcinoma progression via the m6A methylation.
Target Regulation Up regulation
Responsed Disease Thyroid Cancer ICD-11: 2D10
Pathway Response Wnt signaling pathway hsa04310
Cell Process Cell migratory
In-vitro Model B-CPAP Thyroid gland carcinoma Homo sapiens CVCL_0153
Nthy-ori 3-1 Normal Homo sapiens CVCL_2659
TPC-1 Thyroid gland papillary carcinoma Homo sapiens CVCL_6298
Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Silence of METTL3 inhibited migratory ability and Wnt activity in TPC-1 cells. METTL3 positively regulated the enrichment abundance of Hepatocyte nuclear factor 1-alpha (HNF1A/TCF1) in anti-IGF2BP2. TCF1 was responsible for METTL3-regulated thyroid carcinoma progression via the m6A methylation.
Target Regulation Up regulation
Responsed Disease Thyroid Cancer ICD-11: 2D10
Pathway Response Wnt signaling pathway hsa04310
Cell Process Cell migratory
In-vitro Model B-CPAP Thyroid gland carcinoma Homo sapiens CVCL_0153
Nthy-ori 3-1 Normal Homo sapiens CVCL_2659
TPC-1 Thyroid gland papillary carcinoma Homo sapiens CVCL_6298
Thyroid Cancer [ICD-11: 2D10]
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Silence of METTL3 inhibited migratory ability and Wnt activity in TPC-1 cells. METTL3 positively regulated the enrichment abundance of Hepatocyte nuclear factor 1-alpha (HNF1A/TCF1) in anti-IGF2BP2. TCF1 was responsible for METTL3-regulated thyroid carcinoma progression via the m6A methylation.
Responsed Disease Thyroid Cancer [ICD-11: 2D10]
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) READER
Target Regulation Up regulation
Pathway Response Wnt signaling pathway hsa04310
Cell Process Cell migratory
In-vitro Model B-CPAP Thyroid gland carcinoma Homo sapiens CVCL_0153
Nthy-ori 3-1 Normal Homo sapiens CVCL_2659
TPC-1 Thyroid gland papillary carcinoma Homo sapiens CVCL_6298
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary Silence of METTL3 inhibited migratory ability and Wnt activity in TPC-1 cells. METTL3 positively regulated the enrichment abundance of Hepatocyte nuclear factor 1-alpha (HNF1A/TCF1) in anti-IGF2BP2. TCF1 was responsible for METTL3-regulated thyroid carcinoma progression via the m6A methylation.
Responsed Disease Thyroid Cancer [ICD-11: 2D10]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Pathway Response Wnt signaling pathway hsa04310
Cell Process Cell migratory
In-vitro Model B-CPAP Thyroid gland carcinoma Homo sapiens CVCL_0153
Nthy-ori 3-1 Normal Homo sapiens CVCL_2659
TPC-1 Thyroid gland papillary carcinoma Homo sapiens CVCL_6298
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 14 (METTL14)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05149
Epigenetic Regulator hsa-miR-103-3p
Regulated Target Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship ncRNA → m6A
Disease Osteoporosis
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00278)
Hepatocyte nuclear factor 1-alpha (HNF1A/TCF1)
N6-methyladenosine (m6A)
In total 35 m6A sequence/site(s) in this target gene
mod ID: M6ASITE015549 Click to Show/Hide the Full List
mod site chr12:120978735-120978736:+ [3]
Sequence GGAGGCGGCTAGCGTGGTGGACCCGGGCCGCGTGGCCCTGT
Motif Score 3.622404762
Cell/Tissue List HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000402929.5; ENST00000257555.10; ENST00000615446.4; ENST00000538626.2; ENST00000538646.5; ENST00000535955.5; ENST00000544574.5; ENST00000617366.4; ENST00000541924.5; ENST00000400024.6; ENST00000560968.5; ENST00000543427.5
External Link RMBase: m6A_site_213364
mod ID: M6ASITE015550 Click to Show/Hide the Full List
mod site chr12:120978779-120978780:+ [4]
Sequence AGCCGAGCCATGGTTTCTAAACTGAGCCAGCTGCAGACGGA
Motif Score 2.627720238
Cell/Tissue List HepG2; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000538646.5; ENST00000535955.5; ENST00000402929.5; ENST00000544574.5; ENST00000540108.1; ENST00000541924.5; ENST00000615446.4; ENST00000257555.10; ENST00000560968.5; ENST00000541395.5; ENST00000400024.6; ENST00000544413.2; ENST00000538626.2; ENST00000617366.4; ENST00000543427.5
External Link RMBase: m6A_site_213365
mod ID: M6ASITE015551 Click to Show/Hide the Full List
mod site chr12:120978901-120978902:+ [4]
Sequence GGCTGGAGAAGGCCCCCTGGACAAGGGGGAGTCCTGCGGCG
Motif Score 3.643047619
Cell/Tissue List HepG2; Huh7; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000541924.5; ENST00000560968.5; ENST00000538646.5; ENST00000544574.5; ENST00000543427.5; ENST00000617366.4; ENST00000544413.2; ENST00000402929.5; ENST00000535955.5; ENST00000400024.6; ENST00000538626.2; ENST00000541395.5; ENST00000615446.4; ENST00000257555.10; ENST00000540108.1
External Link RMBase: m6A_site_213366
mod ID: M6ASITE015552 Click to Show/Hide the Full List
mod site chr12:120978966-120978967:+ [4]
Sequence TGCCCAATGGGCTGGGGGAGACTCGGGGCTCCGAGGACGAG
Motif Score 3.319380952
Cell/Tissue List HepG2; Huh7; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000560968.5; ENST00000400024.6; ENST00000540108.1; ENST00000541395.5; ENST00000541924.5; ENST00000544413.2; ENST00000535955.5; ENST00000538646.5; ENST00000402929.5; ENST00000544574.5; ENST00000257555.10; ENST00000615446.4; ENST00000617366.4; ENST00000543427.5; ENST00000538626.2
External Link RMBase: m6A_site_213367
mod ID: M6ASITE015553 Click to Show/Hide the Full List
mod site chr12:120979006-120979007:+ [4]
Sequence GACGGACGACGATGGGGAAGACTTCACGCCACCCATCCTCA
Motif Score 3.319380952
Cell/Tissue List HepG2; Huh7; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000544413.2; ENST00000544574.5; ENST00000402929.5; ENST00000617366.4; ENST00000540108.1; ENST00000257555.10; ENST00000535955.5; ENST00000538626.2; ENST00000615446.4; ENST00000538646.5; ENST00000543427.5; ENST00000400024.6; ENST00000541395.5; ENST00000560968.5; ENST00000541924.5
External Link RMBase: m6A_site_213368
mod ID: M6ASITE015554 Click to Show/Hide the Full List
mod site chr12:120979039-120979040:+ [4]
Sequence CATCCTCAAAGAGCTGGAGAACCTCAGCCCTGAGGAGGCGG
Motif Score 2.930744048
Cell/Tissue List HepG2; Huh7; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000617366.4; ENST00000540108.1; ENST00000257555.10; ENST00000541395.5; ENST00000538646.5; ENST00000543427.5; ENST00000535955.5; ENST00000615446.4; ENST00000402929.5; ENST00000560968.5; ENST00000544413.2; ENST00000544574.5; ENST00000538626.2; ENST00000400024.6; ENST00000541924.5
External Link RMBase: m6A_site_213369
mod ID: M6ASITE015556 Click to Show/Hide the Full List
mod site chr12:120979083-120979084:+ [4]
Sequence ACCAGAAAGCCGTGGTGGAGACCCTTCTGCAGTAAGGAGCC
Motif Score 2.876744048
Cell/Tissue List HepG2; Huh7; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000541395.5; ENST00000615446.4; ENST00000617366.4; ENST00000543427.5; ENST00000535955.5; ENST00000402929.5; ENST00000560968.5; ENST00000538646.5; ENST00000544574.5; ENST00000538626.2; ENST00000400024.6; ENST00000541924.5; ENST00000257555.10; ENST00000544413.2; ENST00000540108.1
External Link RMBase: m6A_site_213370
mod ID: M6ASITE015557 Click to Show/Hide the Full List
mod site chr12:120988837-120988838:+ [4]
Sequence CTTGCCCTCTCCCAGGGAGGACCCGTGGCGTGTGGCGAAGA
Motif Score 3.622404762
Cell/Tissue List HepG2; Huh7; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000541924.5; ENST00000538626.2; ENST00000560968.5; ENST00000544413.2; ENST00000615446.4; ENST00000540108.1; ENST00000538646.5; ENST00000257555.10; ENST00000543427.5; ENST00000402929.5; ENST00000400024.6; ENST00000535955.5; ENST00000541395.5; ENST00000617366.4; ENST00000544574.5
External Link RMBase: m6A_site_213371
mod ID: M6ASITE015558 Click to Show/Hide the Full List
mod site chr12:120993597-120993598:+ [4]
Sequence AACCAAGAAGGGGCGGAGGAACCGTTTCAAGTGGGGCCCAG
Motif Score 2.930744048
Cell/Tissue List HepG2; Huh7; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000538646.5; ENST00000541395.5; ENST00000541924.5; ENST00000257555.10; ENST00000538626.2; ENST00000617366.4; ENST00000544413.2; ENST00000560968.5; ENST00000402929.5; ENST00000615446.4; ENST00000543427.5; ENST00000544574.5; ENST00000540108.1; ENST00000400024.6; ENST00000535955.5
External Link RMBase: m6A_site_213372
mod ID: M6ASITE015559 Click to Show/Hide the Full List
mod site chr12:120993660-120993661:+ [4]
Sequence GGCCTATGAGAGGCAGAAGAACCCTAGCAAGGAGGAGCGAG
Motif Score 2.930744048
Cell/Tissue List HepG2; Huh7; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000535955.5; ENST00000541395.5; ENST00000560968.5; ENST00000544413.2; ENST00000543427.5; ENST00000538626.2; ENST00000400024.6; ENST00000402929.5; ENST00000541924.5; ENST00000544574.5; ENST00000617366.4; ENST00000615446.4; ENST00000538646.5; ENST00000257555.10; ENST00000540108.1
External Link RMBase: m6A_site_213373
mod ID: M6ASITE015560 Click to Show/Hide the Full List
mod site chr12:120994300-120994301:+ [3]
Sequence CCGGCACAAGCTGGCCATGGACACGTACAGCGGGCCCCCCC
Motif Score 3.643047619
Cell/Tissue List HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000538646.5; ENST00000541924.5; ENST00000543427.5; ENST00000538626.2; ENST00000257555.10; ENST00000615446.4; ENST00000544413.2; ENST00000400024.6; ENST00000617366.4; ENST00000560968.5; ENST00000541395.5; ENST00000535955.5; ENST00000402929.5; ENST00000544574.5; ENST00000540108.1
External Link RMBase: m6A_site_213374
mod ID: M6ASITE015561 Click to Show/Hide the Full List
mod site chr12:120994337-120994338:+ [3]
Sequence CCCCCAGGGCCAGGCCCGGGACCTGCGCTGCCCGCTCACAG
Motif Score 3.622404762
Cell/Tissue List HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000538626.2; ENST00000257555.10; ENST00000544413.2; ENST00000538646.5; ENST00000400024.6; ENST00000535955.5; ENST00000543427.5; ENST00000541395.5; ENST00000560968.5; ENST00000402929.5; ENST00000544574.5; ENST00000615446.4; ENST00000541924.5; ENST00000617366.4; ENST00000540108.1
External Link RMBase: m6A_site_213375
mod ID: M6ASITE015562 Click to Show/Hide the Full List
mod site chr12:120996274-120996275:+ [3]
Sequence TCTCCAGGTGTGCGCTATGGACAGCCTGCGACCAGTGAGAC
Motif Score 3.643047619
Cell/Tissue List HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000543427.5; ENST00000544574.5; ENST00000535955.5; ENST00000400024.6; ENST00000540108.1; ENST00000541395.5; ENST00000541924.5; ENST00000544413.2; ENST00000257555.10; ENST00000402929.5; ENST00000617366.4; ENST00000538646.5; ENST00000538626.2; ENST00000560968.5; ENST00000615446.4
External Link RMBase: m6A_site_213376
mod ID: M6ASITE015563 Click to Show/Hide the Full List
mod site chr12:120996293-120996294:+ [3]
Sequence GACAGCCTGCGACCAGTGAGACTGCAGAAGTACCCTCAAGC
Motif Score 3.319380952
Cell/Tissue List HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000560968.5; ENST00000400024.6; ENST00000538626.2; ENST00000541924.5; ENST00000543427.5; ENST00000538646.5; ENST00000535955.5; ENST00000615446.4; ENST00000402929.5; ENST00000541395.5; ENST00000540108.1; ENST00000257555.10; ENST00000544574.5; ENST00000544413.2; ENST00000617366.4
External Link RMBase: m6A_site_213377
mod ID: M6ASITE015564 Click to Show/Hide the Full List
mod site chr12:120996606-120996607:+ [3]
Sequence CACTGCACAGCTTGGAGCAGACATCCCCAGGCCTCAACCAG
Motif Score 2.897386905
Cell/Tissue List HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000543427.5; ENST00000257555.10; ENST00000544574.5; ENST00000543255.1; ENST00000541395.5; ENST00000535955.5; ENST00000541924.5; ENST00000400024.6; ENST00000538626.2; ENST00000402929.5; ENST00000538646.5; ENST00000544413.2; ENST00000615446.4; ENST00000540108.1; ENST00000560968.5; ENST00000617366.4
External Link RMBase: m6A_site_213378
mod ID: M6ASITE015565 Click to Show/Hide the Full List
mod site chr12:120996637-120996638:+ [3]
Sequence CCTCAACCAGCAGCCCCAGAACCTCATCATGGCCTCACTTC
Motif Score 2.930744048
Cell/Tissue List HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000541395.5; ENST00000538646.5; ENST00000257555.10; ENST00000402929.5; ENST00000535955.5; ENST00000615446.4; ENST00000544413.2; ENST00000543255.1; ENST00000400024.6; ENST00000560968.5; ENST00000544574.5; ENST00000617366.4; ENST00000543427.5; ENST00000538626.2; ENST00000540108.1; ENST00000541924.5
External Link RMBase: m6A_site_213379
mod ID: M6ASITE015567 Click to Show/Hide the Full List
mod site chr12:120999495-120999496:+ [4]
Sequence CCCCCAGGTCTTCACCTCAGACACTGAGGCCTCCAGTGAGT
Motif Score 2.897386905
Cell/Tissue List HepG2; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000541395.5; ENST00000540108.1; ENST00000543427.5; ENST00000560968.5; ENST00000257555.10; ENST00000615446.4; ENST00000544413.2; ENST00000617366.4
External Link RMBase: m6A_site_213380
mod ID: M6ASITE015568 Click to Show/Hide the Full List
mod site chr12:120999570-120999571:+ [4]
Sequence CCTCCACGTCCCCAGCCAGGACCCTGCCAGCATCCAGCACC
Motif Score 3.622404762
Cell/Tissue List HepG2; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000541395.5; ENST00000257555.10; rmsk_3928444; ENST00000543427.5; ENST00000544413.2; ENST00000617366.4; ENST00000560968.5; ENST00000615446.4; ENST00000540108.1
External Link RMBase: m6A_site_213381
mod ID: M6ASITE015569 Click to Show/Hide the Full List
mod site chr12:121001100-121001101:+ [4]
Sequence GGTGCTGTACCAGAGCTCAGACTCCAGCAATGGCCAGAGCC
Motif Score 3.319380952
Cell/Tissue List HepG2; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000540108.1; ENST00000257555.10; ENST00000544413.2; ENST00000615446.4; ENST00000543427.5; ENST00000541395.5; ENST00000560968.5; ENST00000617366.4
External Link RMBase: m6A_site_213385
mod ID: M6ASITE015570 Click to Show/Hide the Full List
mod site chr12:121001153-121001154:+ [4]
Sequence CCAACCACAGCGTCATCGAGACCTTCATCTCCACCCAGATG
Motif Score 2.876744048
Cell/Tissue List HepG2; Huh7; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000543427.5; ENST00000544413.2; ENST00000560968.5; ENST00000540108.1; ENST00000257555.10; ENST00000617366.4; ENST00000541395.5; ENST00000615446.4
External Link RMBase: m6A_site_213386
mod ID: M6ASITE015571 Click to Show/Hide the Full List
mod site chr12:121001268-121001269:+ [5]
Sequence CAGCCAGCCCTGCCTGGAGGACCTGAGCCTGCCGAGCAACC
Motif Score 3.622404762
Cell/Tissue List HepG2; A549; Huh7; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000541395.5; ENST00000543427.5; ENST00000257555.10; ENST00000540108.1; ENST00000560968.5; ENST00000615446.4; ENST00000544413.2; ENST00000617366.4
External Link RMBase: m6A_site_213387
mod ID: M6ASITE015572 Click to Show/Hide the Full List
mod site chr12:121001303-121001304:+ [6]
Sequence GCAACCGTGGCCCTTCCTGGACAGCTGTGCCTCGCTCCCCA
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; A549; Huh7; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000543427.5; ENST00000615446.4; ENST00000257555.10; ENST00000560968.5; ENST00000540108.1; ENST00000617366.4; ENST00000541395.5
External Link RMBase: m6A_site_213388
mod ID: M6ASITE015574 Click to Show/Hide the Full List
mod site chr12:121001450-121001451:+ [5]
Sequence TCATGGCAGATGTAGGAGGGACTGTCGCTGCTTCGTGGGAT
Motif Score 4.065041667
Cell/Tissue List HepG2; A549; Huh7; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000615446.4; ENST00000540108.1; ENST00000541395.5; ENST00000560968.5; ENST00000543427.5; ENST00000257555.10; ENST00000617366.4
External Link RMBase: m6A_site_213390
mod ID: M6ASITE015575 Click to Show/Hide the Full List
mod site chr12:121001489-121001490:+ [5]
Sequence ATACAGTCTTCTTACTTGGAACTGAAGGGGGCGGCCTATGA
Motif Score 3.373380952
Cell/Tissue List HepG2; A549; Huh7; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000543427.5; ENST00000540108.1; ENST00000541395.5; ENST00000615446.4; ENST00000257555.10; ENST00000560968.5; ENST00000617366.4
External Link RMBase: m6A_site_213392
mod ID: M6ASITE015576 Click to Show/Hide the Full List
mod site chr12:121001549-121001550:+ [5]
Sequence GGCCTATGGAGAGCCCTGGGACCGCTACACCACTCTGGCAG
Motif Score 3.622404762
Cell/Tissue List HepG2; A549; Huh7; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000541395.5; ENST00000617366.4; ENST00000543427.5; ENST00000615446.4; ENST00000540108.1; ENST00000560968.5; ENST00000257555.10
External Link RMBase: m6A_site_213393
mod ID: M6ASITE015577 Click to Show/Hide the Full List
mod site chr12:121001584-121001585:+ [5]
Sequence TGGCAGCCACACTTCTCAGGACACAGGCCTGTGTAGCTGTG
Motif Score 3.643047619
Cell/Tissue List HepG2; A549; Huh7; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000560968.5; ENST00000617366.4; ENST00000615446.4; ENST00000543427.5; ENST00000257555.10; ENST00000541395.5; ENST00000540108.1
External Link RMBase: m6A_site_213394
mod ID: M6ASITE015578 Click to Show/Hide the Full List
mod site chr12:121001710-121001711:+ [7]
Sequence CTCCTTCCAGCTAGTGACCCACATGCCATTTGTACTGACCC
Motif Score 2.053113095
Cell/Tissue List liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000540108.1; ENST00000543427.5; ENST00000257555.10; ENST00000560968.5; ENST00000617366.4; ENST00000541395.5; ENST00000615446.4
External Link RMBase: m6A_site_213396
mod ID: M6ASITE015580 Click to Show/Hide the Full List
mod site chr12:121002069-121002070:+ [6]
Sequence CTGTCTCGAGCGCCCTGCAGACCCTGCCCTTGTTTGGGGCA
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; HEK293T; HEK293A-TOA; endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000543427.5; ENST00000617366.4; ENST00000615446.4; ENST00000560968.5; ENST00000541395.5; ENST00000540108.1; ENST00000257555.10
External Link RMBase: m6A_site_213401
mod ID: M6ASITE015581 Click to Show/Hide the Full List
mod site chr12:121002145-121002146:+ [6]
Sequence CAGCTGAGCAGGGCCGGGGAACTGGCCAAGCTGAGGTGCCC
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; A549; Huh7; HEK293A-TOA; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000257555.10; ENST00000540108.1; ENST00000615446.4; ENST00000617366.4; ENST00000543427.5; ENST00000541395.5; ENST00000560968.5
External Link RMBase: m6A_site_213403
mod ID: M6ASITE015582 Click to Show/Hide the Full List
mod site chr12:121002212-121002213:+ [6]
Sequence CACAGGAGCTACCTGTGTGGACAGGACTAACACTCAGAAGC
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; A549; Huh7; HEK293A-TOA; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000560968.5; ENST00000615446.4; ENST00000540108.1; ENST00000617366.4; ENST00000257555.10; ENST00000543427.5; ENST00000541395.5
External Link RMBase: m6A_site_213404
mod ID: M6ASITE015583 Click to Show/Hide the Full List
mod site chr12:121002217-121002218:+ [6]
Sequence GAGCTACCTGTGTGGACAGGACTAACACTCAGAAGCCTGGG
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; A549; Huh7; HEK293A-TOA; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000615446.4; ENST00000617366.4; ENST00000543427.5; ENST00000257555.10; ENST00000541395.5; ENST00000560968.5; ENST00000540108.1
External Link RMBase: m6A_site_213405
mod ID: M6ASITE015584 Click to Show/Hide the Full List
mod site chr12:121002307-121002308:+ [6]
Sequence CCTGAGCACTGCCAGGAGGGACAAAGGAGCCTGTGAACCCA
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; A549; hESC-HEK293T; Huh7; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000257555.10; ENST00000617366.4; ENST00000540108.1; ENST00000541395.5; ENST00000543427.5; ENST00000560968.5; ENST00000615446.4
External Link RMBase: m6A_site_213409
mod ID: M6ASITE015586 Click to Show/Hide the Full List
mod site chr12:121002323-121002324:+ [6]
Sequence AGGGACAAAGGAGCCTGTGAACCCAGGACAAGCATGGTCCC
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; A549; Huh7; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000540108.1; ENST00000615446.4; ENST00000543427.5; ENST00000617366.4; ENST00000257555.10; ENST00000541395.5; ENST00000560968.5
External Link RMBase: m6A_site_213410
mod ID: M6ASITE015587 Click to Show/Hide the Full List
mod site chr12:121002330-121002331:+ [6]
Sequence AAGGAGCCTGTGAACCCAGGACAAGCATGGTCCCACATCCC
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; A549; Huh7; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000540108.1; ENST00000617366.4; ENST00000543427.5; ENST00000541395.5; ENST00000257555.10; ENST00000560968.5; ENST00000615446.4
External Link RMBase: m6A_site_213411
mod ID: M6ASITE015588 Click to Show/Hide the Full List
mod site chr12:121002368-121002369:+ [6]
Sequence CCCTGGGCCTGCTGCTGAGAACCTGGCCTTCAGTGTACCGC
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; A549; Huh7; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000617366.4; ENST00000543427.5; ENST00000560968.5; ENST00000541395.5; ENST00000257555.10; ENST00000615446.4; ENST00000540108.1
External Link RMBase: m6A_site_213413