m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00278)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
HNF1A
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | mouse embryonic stem cells | Mus musculus |
|
Treatment: METTL3-/- ESCs
Control: Wild type ESCs
|
GSE145309 | |
| Regulation |
![]() ![]() |
logFC: -1.64E+00 p-value: 4.47E-50 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between HNF1A and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 6.55E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Silence of METTL3 inhibited migratory ability and Wnt activity in TPC-1 cells. METTL3 positively regulated the enrichment abundance of Hepatocyte nuclear factor 1-alpha (HNF1A/TCF1) in anti-IGF2BP2. TCF1 was responsible for METTL3-regulated thyroid carcinoma progression via the m6A methylation. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Thyroid Cancer | ICD-11: 2D10 | ||
| Pathway Response | Wnt signaling pathway | hsa04310 | ||
| Cell Process | Cell migratory | |||
| In-vitro Model | B-CPAP | Thyroid gland carcinoma | Homo sapiens | CVCL_0153 |
| Nthy-ori 3-1 | Normal | Homo sapiens | CVCL_2659 | |
| TPC-1 | Thyroid gland papillary carcinoma | Homo sapiens | CVCL_6298 | |
Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Silence of METTL3 inhibited migratory ability and Wnt activity in TPC-1 cells. METTL3 positively regulated the enrichment abundance of Hepatocyte nuclear factor 1-alpha (HNF1A/TCF1) in anti-IGF2BP2. TCF1 was responsible for METTL3-regulated thyroid carcinoma progression via the m6A methylation. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Thyroid Cancer | ICD-11: 2D10 | ||
| Pathway Response | Wnt signaling pathway | hsa04310 | ||
| Cell Process | Cell migratory | |||
| In-vitro Model | B-CPAP | Thyroid gland carcinoma | Homo sapiens | CVCL_0153 |
| Nthy-ori 3-1 | Normal | Homo sapiens | CVCL_2659 | |
| TPC-1 | Thyroid gland papillary carcinoma | Homo sapiens | CVCL_6298 | |
Thyroid Cancer [ICD-11: 2D10]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | Silence of METTL3 inhibited migratory ability and Wnt activity in TPC-1 cells. METTL3 positively regulated the enrichment abundance of Hepatocyte nuclear factor 1-alpha (HNF1A/TCF1) in anti-IGF2BP2. TCF1 was responsible for METTL3-regulated thyroid carcinoma progression via the m6A methylation. | |||
| Responsed Disease | Thyroid Cancer [ICD-11: 2D10] | |||
| Target Regulator | Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) | READER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | Wnt signaling pathway | hsa04310 | ||
| Cell Process | Cell migratory | |||
| In-vitro Model | B-CPAP | Thyroid gland carcinoma | Homo sapiens | CVCL_0153 |
| Nthy-ori 3-1 | Normal | Homo sapiens | CVCL_2659 | |
| TPC-1 | Thyroid gland papillary carcinoma | Homo sapiens | CVCL_6298 | |
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | Silence of METTL3 inhibited migratory ability and Wnt activity in TPC-1 cells. METTL3 positively regulated the enrichment abundance of Hepatocyte nuclear factor 1-alpha (HNF1A/TCF1) in anti-IGF2BP2. TCF1 was responsible for METTL3-regulated thyroid carcinoma progression via the m6A methylation. | |||
| Responsed Disease | Thyroid Cancer [ICD-11: 2D10] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | Wnt signaling pathway | hsa04310 | ||
| Cell Process | Cell migratory | |||
| In-vitro Model | B-CPAP | Thyroid gland carcinoma | Homo sapiens | CVCL_0153 |
| Nthy-ori 3-1 | Normal | Homo sapiens | CVCL_2659 | |
| TPC-1 | Thyroid gland papillary carcinoma | Homo sapiens | CVCL_6298 | |
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 14 (METTL14)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05149 | ||
| Epigenetic Regulator | hsa-miR-103-3p | |
| Regulated Target | Methyltransferase-like protein 14 (METTL14) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Osteoporosis | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00278)
| In total 35 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE015549 | Click to Show/Hide the Full List | ||
| mod site | chr12:120978735-120978736:+ | [3] | |
| Sequence | GGAGGCGGCTAGCGTGGTGGACCCGGGCCGCGTGGCCCTGT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000402929.5; ENST00000257555.10; ENST00000615446.4; ENST00000538626.2; ENST00000538646.5; ENST00000535955.5; ENST00000544574.5; ENST00000617366.4; ENST00000541924.5; ENST00000400024.6; ENST00000560968.5; ENST00000543427.5 | ||
| External Link | RMBase: m6A_site_213364 | ||
| mod ID: M6ASITE015550 | Click to Show/Hide the Full List | ||
| mod site | chr12:120978779-120978780:+ | [4] | |
| Sequence | AGCCGAGCCATGGTTTCTAAACTGAGCCAGCTGCAGACGGA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HepG2; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000538646.5; ENST00000535955.5; ENST00000402929.5; ENST00000544574.5; ENST00000540108.1; ENST00000541924.5; ENST00000615446.4; ENST00000257555.10; ENST00000560968.5; ENST00000541395.5; ENST00000400024.6; ENST00000544413.2; ENST00000538626.2; ENST00000617366.4; ENST00000543427.5 | ||
| External Link | RMBase: m6A_site_213365 | ||
| mod ID: M6ASITE015551 | Click to Show/Hide the Full List | ||
| mod site | chr12:120978901-120978902:+ | [4] | |
| Sequence | GGCTGGAGAAGGCCCCCTGGACAAGGGGGAGTCCTGCGGCG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HepG2; Huh7; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000541924.5; ENST00000560968.5; ENST00000538646.5; ENST00000544574.5; ENST00000543427.5; ENST00000617366.4; ENST00000544413.2; ENST00000402929.5; ENST00000535955.5; ENST00000400024.6; ENST00000538626.2; ENST00000541395.5; ENST00000615446.4; ENST00000257555.10; ENST00000540108.1 | ||
| External Link | RMBase: m6A_site_213366 | ||
| mod ID: M6ASITE015552 | Click to Show/Hide the Full List | ||
| mod site | chr12:120978966-120978967:+ | [4] | |
| Sequence | TGCCCAATGGGCTGGGGGAGACTCGGGGCTCCGAGGACGAG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HepG2; Huh7; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000560968.5; ENST00000400024.6; ENST00000540108.1; ENST00000541395.5; ENST00000541924.5; ENST00000544413.2; ENST00000535955.5; ENST00000538646.5; ENST00000402929.5; ENST00000544574.5; ENST00000257555.10; ENST00000615446.4; ENST00000617366.4; ENST00000543427.5; ENST00000538626.2 | ||
| External Link | RMBase: m6A_site_213367 | ||
| mod ID: M6ASITE015553 | Click to Show/Hide the Full List | ||
| mod site | chr12:120979006-120979007:+ | [4] | |
| Sequence | GACGGACGACGATGGGGAAGACTTCACGCCACCCATCCTCA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HepG2; Huh7; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000544413.2; ENST00000544574.5; ENST00000402929.5; ENST00000617366.4; ENST00000540108.1; ENST00000257555.10; ENST00000535955.5; ENST00000538626.2; ENST00000615446.4; ENST00000538646.5; ENST00000543427.5; ENST00000400024.6; ENST00000541395.5; ENST00000560968.5; ENST00000541924.5 | ||
| External Link | RMBase: m6A_site_213368 | ||
| mod ID: M6ASITE015554 | Click to Show/Hide the Full List | ||
| mod site | chr12:120979039-120979040:+ | [4] | |
| Sequence | CATCCTCAAAGAGCTGGAGAACCTCAGCCCTGAGGAGGCGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HepG2; Huh7; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000617366.4; ENST00000540108.1; ENST00000257555.10; ENST00000541395.5; ENST00000538646.5; ENST00000543427.5; ENST00000535955.5; ENST00000615446.4; ENST00000402929.5; ENST00000560968.5; ENST00000544413.2; ENST00000544574.5; ENST00000538626.2; ENST00000400024.6; ENST00000541924.5 | ||
| External Link | RMBase: m6A_site_213369 | ||
| mod ID: M6ASITE015556 | Click to Show/Hide the Full List | ||
| mod site | chr12:120979083-120979084:+ | [4] | |
| Sequence | ACCAGAAAGCCGTGGTGGAGACCCTTCTGCAGTAAGGAGCC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HepG2; Huh7; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000541395.5; ENST00000615446.4; ENST00000617366.4; ENST00000543427.5; ENST00000535955.5; ENST00000402929.5; ENST00000560968.5; ENST00000538646.5; ENST00000544574.5; ENST00000538626.2; ENST00000400024.6; ENST00000541924.5; ENST00000257555.10; ENST00000544413.2; ENST00000540108.1 | ||
| External Link | RMBase: m6A_site_213370 | ||
| mod ID: M6ASITE015557 | Click to Show/Hide the Full List | ||
| mod site | chr12:120988837-120988838:+ | [4] | |
| Sequence | CTTGCCCTCTCCCAGGGAGGACCCGTGGCGTGTGGCGAAGA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HepG2; Huh7; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000541924.5; ENST00000538626.2; ENST00000560968.5; ENST00000544413.2; ENST00000615446.4; ENST00000540108.1; ENST00000538646.5; ENST00000257555.10; ENST00000543427.5; ENST00000402929.5; ENST00000400024.6; ENST00000535955.5; ENST00000541395.5; ENST00000617366.4; ENST00000544574.5 | ||
| External Link | RMBase: m6A_site_213371 | ||
| mod ID: M6ASITE015558 | Click to Show/Hide the Full List | ||
| mod site | chr12:120993597-120993598:+ | [4] | |
| Sequence | AACCAAGAAGGGGCGGAGGAACCGTTTCAAGTGGGGCCCAG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HepG2; Huh7; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000538646.5; ENST00000541395.5; ENST00000541924.5; ENST00000257555.10; ENST00000538626.2; ENST00000617366.4; ENST00000544413.2; ENST00000560968.5; ENST00000402929.5; ENST00000615446.4; ENST00000543427.5; ENST00000544574.5; ENST00000540108.1; ENST00000400024.6; ENST00000535955.5 | ||
| External Link | RMBase: m6A_site_213372 | ||
| mod ID: M6ASITE015559 | Click to Show/Hide the Full List | ||
| mod site | chr12:120993660-120993661:+ | [4] | |
| Sequence | GGCCTATGAGAGGCAGAAGAACCCTAGCAAGGAGGAGCGAG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HepG2; Huh7; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000535955.5; ENST00000541395.5; ENST00000560968.5; ENST00000544413.2; ENST00000543427.5; ENST00000538626.2; ENST00000400024.6; ENST00000402929.5; ENST00000541924.5; ENST00000544574.5; ENST00000617366.4; ENST00000615446.4; ENST00000538646.5; ENST00000257555.10; ENST00000540108.1 | ||
| External Link | RMBase: m6A_site_213373 | ||
| mod ID: M6ASITE015560 | Click to Show/Hide the Full List | ||
| mod site | chr12:120994300-120994301:+ | [3] | |
| Sequence | CCGGCACAAGCTGGCCATGGACACGTACAGCGGGCCCCCCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000538646.5; ENST00000541924.5; ENST00000543427.5; ENST00000538626.2; ENST00000257555.10; ENST00000615446.4; ENST00000544413.2; ENST00000400024.6; ENST00000617366.4; ENST00000560968.5; ENST00000541395.5; ENST00000535955.5; ENST00000402929.5; ENST00000544574.5; ENST00000540108.1 | ||
| External Link | RMBase: m6A_site_213374 | ||
| mod ID: M6ASITE015561 | Click to Show/Hide the Full List | ||
| mod site | chr12:120994337-120994338:+ | [3] | |
| Sequence | CCCCCAGGGCCAGGCCCGGGACCTGCGCTGCCCGCTCACAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000538626.2; ENST00000257555.10; ENST00000544413.2; ENST00000538646.5; ENST00000400024.6; ENST00000535955.5; ENST00000543427.5; ENST00000541395.5; ENST00000560968.5; ENST00000402929.5; ENST00000544574.5; ENST00000615446.4; ENST00000541924.5; ENST00000617366.4; ENST00000540108.1 | ||
| External Link | RMBase: m6A_site_213375 | ||
| mod ID: M6ASITE015562 | Click to Show/Hide the Full List | ||
| mod site | chr12:120996274-120996275:+ | [3] | |
| Sequence | TCTCCAGGTGTGCGCTATGGACAGCCTGCGACCAGTGAGAC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000543427.5; ENST00000544574.5; ENST00000535955.5; ENST00000400024.6; ENST00000540108.1; ENST00000541395.5; ENST00000541924.5; ENST00000544413.2; ENST00000257555.10; ENST00000402929.5; ENST00000617366.4; ENST00000538646.5; ENST00000538626.2; ENST00000560968.5; ENST00000615446.4 | ||
| External Link | RMBase: m6A_site_213376 | ||
| mod ID: M6ASITE015563 | Click to Show/Hide the Full List | ||
| mod site | chr12:120996293-120996294:+ | [3] | |
| Sequence | GACAGCCTGCGACCAGTGAGACTGCAGAAGTACCCTCAAGC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000560968.5; ENST00000400024.6; ENST00000538626.2; ENST00000541924.5; ENST00000543427.5; ENST00000538646.5; ENST00000535955.5; ENST00000615446.4; ENST00000402929.5; ENST00000541395.5; ENST00000540108.1; ENST00000257555.10; ENST00000544574.5; ENST00000544413.2; ENST00000617366.4 | ||
| External Link | RMBase: m6A_site_213377 | ||
| mod ID: M6ASITE015564 | Click to Show/Hide the Full List | ||
| mod site | chr12:120996606-120996607:+ | [3] | |
| Sequence | CACTGCACAGCTTGGAGCAGACATCCCCAGGCCTCAACCAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000543427.5; ENST00000257555.10; ENST00000544574.5; ENST00000543255.1; ENST00000541395.5; ENST00000535955.5; ENST00000541924.5; ENST00000400024.6; ENST00000538626.2; ENST00000402929.5; ENST00000538646.5; ENST00000544413.2; ENST00000615446.4; ENST00000540108.1; ENST00000560968.5; ENST00000617366.4 | ||
| External Link | RMBase: m6A_site_213378 | ||
| mod ID: M6ASITE015565 | Click to Show/Hide the Full List | ||
| mod site | chr12:120996637-120996638:+ | [3] | |
| Sequence | CCTCAACCAGCAGCCCCAGAACCTCATCATGGCCTCACTTC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000541395.5; ENST00000538646.5; ENST00000257555.10; ENST00000402929.5; ENST00000535955.5; ENST00000615446.4; ENST00000544413.2; ENST00000543255.1; ENST00000400024.6; ENST00000560968.5; ENST00000544574.5; ENST00000617366.4; ENST00000543427.5; ENST00000538626.2; ENST00000540108.1; ENST00000541924.5 | ||
| External Link | RMBase: m6A_site_213379 | ||
| mod ID: M6ASITE015567 | Click to Show/Hide the Full List | ||
| mod site | chr12:120999495-120999496:+ | [4] | |
| Sequence | CCCCCAGGTCTTCACCTCAGACACTGAGGCCTCCAGTGAGT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HepG2; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000541395.5; ENST00000540108.1; ENST00000543427.5; ENST00000560968.5; ENST00000257555.10; ENST00000615446.4; ENST00000544413.2; ENST00000617366.4 | ||
| External Link | RMBase: m6A_site_213380 | ||
| mod ID: M6ASITE015568 | Click to Show/Hide the Full List | ||
| mod site | chr12:120999570-120999571:+ | [4] | |
| Sequence | CCTCCACGTCCCCAGCCAGGACCCTGCCAGCATCCAGCACC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HepG2; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000541395.5; ENST00000257555.10; rmsk_3928444; ENST00000543427.5; ENST00000544413.2; ENST00000617366.4; ENST00000560968.5; ENST00000615446.4; ENST00000540108.1 | ||
| External Link | RMBase: m6A_site_213381 | ||
| mod ID: M6ASITE015569 | Click to Show/Hide the Full List | ||
| mod site | chr12:121001100-121001101:+ | [4] | |
| Sequence | GGTGCTGTACCAGAGCTCAGACTCCAGCAATGGCCAGAGCC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HepG2; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000540108.1; ENST00000257555.10; ENST00000544413.2; ENST00000615446.4; ENST00000543427.5; ENST00000541395.5; ENST00000560968.5; ENST00000617366.4 | ||
| External Link | RMBase: m6A_site_213385 | ||
| mod ID: M6ASITE015570 | Click to Show/Hide the Full List | ||
| mod site | chr12:121001153-121001154:+ | [4] | |
| Sequence | CCAACCACAGCGTCATCGAGACCTTCATCTCCACCCAGATG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HepG2; Huh7; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000543427.5; ENST00000544413.2; ENST00000560968.5; ENST00000540108.1; ENST00000257555.10; ENST00000617366.4; ENST00000541395.5; ENST00000615446.4 | ||
| External Link | RMBase: m6A_site_213386 | ||
| mod ID: M6ASITE015571 | Click to Show/Hide the Full List | ||
| mod site | chr12:121001268-121001269:+ | [5] | |
| Sequence | CAGCCAGCCCTGCCTGGAGGACCTGAGCCTGCCGAGCAACC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HepG2; A549; Huh7; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000541395.5; ENST00000543427.5; ENST00000257555.10; ENST00000540108.1; ENST00000560968.5; ENST00000615446.4; ENST00000544413.2; ENST00000617366.4 | ||
| External Link | RMBase: m6A_site_213387 | ||
| mod ID: M6ASITE015572 | Click to Show/Hide the Full List | ||
| mod site | chr12:121001303-121001304:+ | [6] | |
| Sequence | GCAACCGTGGCCCTTCCTGGACAGCTGTGCCTCGCTCCCCA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; A549; Huh7; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000543427.5; ENST00000615446.4; ENST00000257555.10; ENST00000560968.5; ENST00000540108.1; ENST00000617366.4; ENST00000541395.5 | ||
| External Link | RMBase: m6A_site_213388 | ||
| mod ID: M6ASITE015574 | Click to Show/Hide the Full List | ||
| mod site | chr12:121001450-121001451:+ | [5] | |
| Sequence | TCATGGCAGATGTAGGAGGGACTGTCGCTGCTTCGTGGGAT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HepG2; A549; Huh7; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000615446.4; ENST00000540108.1; ENST00000541395.5; ENST00000560968.5; ENST00000543427.5; ENST00000257555.10; ENST00000617366.4 | ||
| External Link | RMBase: m6A_site_213390 | ||
| mod ID: M6ASITE015575 | Click to Show/Hide the Full List | ||
| mod site | chr12:121001489-121001490:+ | [5] | |
| Sequence | ATACAGTCTTCTTACTTGGAACTGAAGGGGGCGGCCTATGA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HepG2; A549; Huh7; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000543427.5; ENST00000540108.1; ENST00000541395.5; ENST00000615446.4; ENST00000257555.10; ENST00000560968.5; ENST00000617366.4 | ||
| External Link | RMBase: m6A_site_213392 | ||
| mod ID: M6ASITE015576 | Click to Show/Hide the Full List | ||
| mod site | chr12:121001549-121001550:+ | [5] | |
| Sequence | GGCCTATGGAGAGCCCTGGGACCGCTACACCACTCTGGCAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HepG2; A549; Huh7; iSLK; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000541395.5; ENST00000617366.4; ENST00000543427.5; ENST00000615446.4; ENST00000540108.1; ENST00000560968.5; ENST00000257555.10 | ||
| External Link | RMBase: m6A_site_213393 | ||
| mod ID: M6ASITE015577 | Click to Show/Hide the Full List | ||
| mod site | chr12:121001584-121001585:+ | [5] | |
| Sequence | TGGCAGCCACACTTCTCAGGACACAGGCCTGTGTAGCTGTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HepG2; A549; Huh7; iSLK; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000560968.5; ENST00000617366.4; ENST00000615446.4; ENST00000543427.5; ENST00000257555.10; ENST00000541395.5; ENST00000540108.1 | ||
| External Link | RMBase: m6A_site_213394 | ||
| mod ID: M6ASITE015578 | Click to Show/Hide the Full List | ||
| mod site | chr12:121001710-121001711:+ | [7] | |
| Sequence | CTCCTTCCAGCTAGTGACCCACATGCCATTTGTACTGACCC | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000540108.1; ENST00000543427.5; ENST00000257555.10; ENST00000560968.5; ENST00000617366.4; ENST00000541395.5; ENST00000615446.4 | ||
| External Link | RMBase: m6A_site_213396 | ||
| mod ID: M6ASITE015580 | Click to Show/Hide the Full List | ||
| mod site | chr12:121002069-121002070:+ | [6] | |
| Sequence | CTGTCTCGAGCGCCCTGCAGACCCTGCCCTTGTTTGGGGCA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000543427.5; ENST00000617366.4; ENST00000615446.4; ENST00000560968.5; ENST00000541395.5; ENST00000540108.1; ENST00000257555.10 | ||
| External Link | RMBase: m6A_site_213401 | ||
| mod ID: M6ASITE015581 | Click to Show/Hide the Full List | ||
| mod site | chr12:121002145-121002146:+ | [6] | |
| Sequence | CAGCTGAGCAGGGCCGGGGAACTGGCCAAGCTGAGGTGCCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2; A549; Huh7; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000257555.10; ENST00000540108.1; ENST00000615446.4; ENST00000617366.4; ENST00000543427.5; ENST00000541395.5; ENST00000560968.5 | ||
| External Link | RMBase: m6A_site_213403 | ||
| mod ID: M6ASITE015582 | Click to Show/Hide the Full List | ||
| mod site | chr12:121002212-121002213:+ | [6] | |
| Sequence | CACAGGAGCTACCTGTGTGGACAGGACTAACACTCAGAAGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; A549; Huh7; HEK293A-TOA; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000560968.5; ENST00000615446.4; ENST00000540108.1; ENST00000617366.4; ENST00000257555.10; ENST00000543427.5; ENST00000541395.5 | ||
| External Link | RMBase: m6A_site_213404 | ||
| mod ID: M6ASITE015583 | Click to Show/Hide the Full List | ||
| mod site | chr12:121002217-121002218:+ | [6] | |
| Sequence | GAGCTACCTGTGTGGACAGGACTAACACTCAGAAGCCTGGG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; A549; Huh7; HEK293A-TOA; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000615446.4; ENST00000617366.4; ENST00000543427.5; ENST00000257555.10; ENST00000541395.5; ENST00000560968.5; ENST00000540108.1 | ||
| External Link | RMBase: m6A_site_213405 | ||
| mod ID: M6ASITE015584 | Click to Show/Hide the Full List | ||
| mod site | chr12:121002307-121002308:+ | [6] | |
| Sequence | CCTGAGCACTGCCAGGAGGGACAAAGGAGCCTGTGAACCCA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; A549; hESC-HEK293T; Huh7; HEK293A-TOA; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000257555.10; ENST00000617366.4; ENST00000540108.1; ENST00000541395.5; ENST00000543427.5; ENST00000560968.5; ENST00000615446.4 | ||
| External Link | RMBase: m6A_site_213409 | ||
| mod ID: M6ASITE015586 | Click to Show/Hide the Full List | ||
| mod site | chr12:121002323-121002324:+ | [6] | |
| Sequence | AGGGACAAAGGAGCCTGTGAACCCAGGACAAGCATGGTCCC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; A549; Huh7; HEK293A-TOA; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000540108.1; ENST00000615446.4; ENST00000543427.5; ENST00000617366.4; ENST00000257555.10; ENST00000541395.5; ENST00000560968.5 | ||
| External Link | RMBase: m6A_site_213410 | ||
| mod ID: M6ASITE015587 | Click to Show/Hide the Full List | ||
| mod site | chr12:121002330-121002331:+ | [6] | |
| Sequence | AAGGAGCCTGTGAACCCAGGACAAGCATGGTCCCACATCCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; A549; Huh7; HEK293A-TOA; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000540108.1; ENST00000617366.4; ENST00000543427.5; ENST00000541395.5; ENST00000257555.10; ENST00000560968.5; ENST00000615446.4 | ||
| External Link | RMBase: m6A_site_213411 | ||
| mod ID: M6ASITE015588 | Click to Show/Hide the Full List | ||
| mod site | chr12:121002368-121002369:+ | [6] | |
| Sequence | CCCTGGGCCTGCTGCTGAGAACCTGGCCTTCAGTGTACCGC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; A549; Huh7; HEK293A-TOA; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000617366.4; ENST00000543427.5; ENST00000560968.5; ENST00000541395.5; ENST00000257555.10; ENST00000615446.4; ENST00000540108.1 | ||
| External Link | RMBase: m6A_site_213413 | ||
References

