m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00276)

Target Name	High mobility group protein HMGI-C (HMGA2)
Synonyms	High mobility group AT-hook protein 2; HMGIC Click to Show/Hide
Gene Name	HMGA2
Chromosomal Location	12q14.3
Family	HMGA family
Function	Functions as a transcriptional regulator. Functions in cell cycle regulation through CCNA2. Plays an important role in chromosome condensation during the meiotic G2/M transition of spermatocytes. Plays a role in postnatal myogenesis, is involved in satellite cell activation (By similarity). Positively regulates IGF2 expression through PLAG1 and in a PLAG1-independent manner. Click to Show/Hide
Gene ID	8091
Uniprot ID	HMGA2_HUMAN
HGNC ID	HGNC:5009
KEGG ID	hsa:8091

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

HMGA2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: 4.44E+00 p-value: 5.85E-138
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between HMGA2 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 1.68E+00	GSE60213

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In hepatocellular carcinoma, METTL3 could direct the formation of circHPS5, and specific m6A controlled the accumulation of circHPS5. YTHDC1 facilitated the cytoplasmic output of circHPS5 under m6A modification. CircHPS5 can act as a miR-370 sponge to regulate the expression of High mobility group protein HMGI-C (HMGA2) and further accelerate hepatocellular carcinoma cell tumorigenesis.
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Pathway Response	Transcriptional misregulation in cancer			hsa05202
Cell Process	Epithelial-mesenchymal transition
Cell Process	Cell autophagy
In-vitro Model	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
In-vitro Model	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
In-vivo Model	To create the xenograft neoplasm system, 40 male BALB/c nude mice aged 5 weeks were randomly separated into sh-NC, sh-circHPS5, sh-circHPS5+CTRL, and sh-circHPS5+SAH groups (n = 5 for each group). HCC cells were subcutaneously injected into the axilla of the nude mice.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Silencing METTL3 down-regulate MALAT1 and High mobility group protein HMGI-C (HMGA2) by sponging miR-26b, and finally inhibit EMT, migration and invasion in BC, providing a theoretical basis for clinical treatment of BC.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
In-vivo Model	Eighteen BALB/C female nude mice aged 4-5 weeks and weighing 15-18 g were randomly assigned into three groups of six mice. The MCF-7 cell lines stably transfected with sh-NC + oe-NC, sh-METTL3 + oe-NC and sh-METTL3 + oe-HMGA2 were selected for subcutaneous establishment of the BC cell line MCF-7 as xenografts in the nude mice. For this purpose, MCF-7 cell lines in the logarithmic growth stage were prepared into a suspension with a concentration of about 1 × 10⁷ cells/ml. The prepared cell suspension was injected into the left armpit of the mice, and the subsequent tumor growth was recorded.

YTH domain-containing protein 1 (YTHDC1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In hepatocellular carcinoma, METTL3 could direct the formation of circHPS5, and specific m6A controlled the accumulation of circHPS5. YTHDC1 facilitated the cytoplasmic output of circHPS5 under m6A modification. CircHPS5 can act as a miR-370 sponge to regulate the expression of High mobility group protein HMGI-C (HMGA2) and further accelerate hepatocellular carcinoma cell tumorigenesis.
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Pathway Response	Transcriptional misregulation in cancer			hsa05202
Cell Process	Epithelial-mesenchymal transition
	Cell autophagy
In-vitro Model	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
In-vivo Model	To create the xenograft neoplasm system, 40 male BALB/c nude mice aged 5 weeks were randomly separated into sh-NC, sh-circHPS5, sh-circHPS5+CTRL, and sh-circHPS5+SAH groups (n = 5 for each group). HCC cells were subcutaneously injected into the axilla of the nude mice.

Liver cancer [ICD-11: 2C12]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	In hepatocellular carcinoma, METTL3 could direct the formation of circHPS5, and specific m6A controlled the accumulation of circHPS5. YTHDC1 facilitated the cytoplasmic output of circHPS5 under m6A modification. CircHPS5 can act as a miR-370 sponge to regulate the expression of High mobility group protein HMGI-C (HMGA2) and further accelerate hepatocellular carcinoma cell tumorigenesis.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Transcriptional misregulation in cancer			hsa05202
Cell Process	Epithelial-mesenchymal transition
	Cell autophagy
In-vitro Model	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
In-vivo Model	To create the xenograft neoplasm system, 40 male BALB/c nude mice aged 5 weeks were randomly separated into sh-NC, sh-circHPS5, sh-circHPS5+CTRL, and sh-circHPS5+SAH groups (n = 5 for each group). HCC cells were subcutaneously injected into the axilla of the nude mice.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	In hepatocellular carcinoma, METTL3 could direct the formation of circHPS5, and specific m6A controlled the accumulation of circHPS5. YTHDC1 facilitated the cytoplasmic output of circHPS5 under m6A modification. CircHPS5 can act as a miR-370 sponge to regulate the expression of High mobility group protein HMGI-C (HMGA2) and further accelerate hepatocellular carcinoma cell tumorigenesis.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	YTH domain-containing protein 1 (YTHDC1)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Transcriptional misregulation in cancer			hsa05202
Cell Process	Epithelial-mesenchymal transition
	Cell autophagy
In-vitro Model	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
In-vivo Model	To create the xenograft neoplasm system, 40 male BALB/c nude mice aged 5 weeks were randomly separated into sh-NC, sh-circHPS5, sh-circHPS5+CTRL, and sh-circHPS5+SAH groups (n = 5 for each group). HCC cells were subcutaneously injected into the axilla of the nude mice.

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	Silencing METTL3 down-regulate MALAT1 and High mobility group protein HMGI-C (HMGA2) by sponging miR-26b, and finally inhibit EMT, migration and invasion in BC, providing a theoretical basis for clinical treatment of BC.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MCF-10A	Normal	Homo sapiens	CVCL_0598
In-vivo Model	Eighteen BALB/C female nude mice aged 4-5 weeks and weighing 15-18 g were randomly assigned into three groups of six mice. The MCF-7 cell lines stably transfected with sh-NC + oe-NC, sh-METTL3 + oe-NC and sh-METTL3 + oe-HMGA2 were selected for subcutaneous establishment of the BC cell line MCF-7 as xenografts in the nude mice. For this purpose, MCF-7 cell lines in the logarithmic growth stage were prepared into a suspension with a concentration of about 1 × 10⁷ cells/ml. The prepared cell suspension was injected into the left armpit of the mice, and the subsequent tumor growth was recorded.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

RNA modification

m6A Regulator: ELAV-like protein 1 (ELAVL1)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00465		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 149 (MIR149)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00466		Crosstalk Info
Epigenetic Regulator	Methyltransferase-like protein 1 (METTL1)
Regulated Target	MicroRNA 149 (MIR149)
Crosstalk relationship	m7G → m6A

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00467		Crosstalk Info
Epigenetic Regulator	Interferon-inducible protein 4 (ADAR1)
Regulated Target	MicroRNA 149 (MIR149)
Crosstalk relationship	A-to-I → m6A
Crosstalk ID: M6ACROT00468		Crosstalk Info
Epigenetic Regulator	Methyltransferase-like protein 1 (METTL1)
Regulated Target	MicroRNA 149 (MIR149)
Crosstalk relationship	m7G → m6A

Histone modification

m6A Regulator: YTH domain-containing protein 1 (YTHDC1)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03485		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Liver cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00276)

High mobility group protein HMGI-C (HMGA2)

5-methylcytidine (m5C)

In total 5 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000072		Click to Show/Hide the Full List
mod site	chr12:65840305-65840306:+
Sequence	GGCAGGGTAGAGCAGAAAGTCTTGTCTCTGCTCCATGATGT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000393578.7; ENST00000537429.5; ENST00000403681.6; ENST00000539662.1; ENST00000541363.5; ENST00000425208.6; ENST00000536545.5; ENST00000354636.7; ENST00000393577.7; ENST00000537275.5
External Link	RMBase: m5C_site_10596
mod ID: M5CSITE000073		Click to Show/Hide the Full List
mod site	chr12:65881887-65881888:+
Sequence	AGAGGTGGCCCGAGAGAGCCCCGGTAGGTCCCGGAGTATGT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000425208.6; ENST00000393577.7; ENST00000536545.5; ENST00000354636.7; ENST00000541363.5; ENST00000537429.5; ENST00000539662.1; ENST00000403681.6
External Link	RMBase: m5C_site_10597
mod ID: M5CSITE000074		Click to Show/Hide the Full List
mod site	chr12:65882120-65882121:+
Sequence	GGCTGTACTGACAAAAGCAACCTTAGTCAATGACAGAGCTG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000393577.7; ENST00000541363.5; ENST00000403681.6; ENST00000536545.5; ENST00000354636.7; ENST00000425208.6; ENST00000539662.1
External Link	RMBase: m5C_site_10598
mod ID: M5CSITE000075		Click to Show/Hide the Full List
mod site	chr12:65964524-65964525:+
Sequence	TGCACTTTTAGCCAGAGATGCAATATATCCCCACTACTCAA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m5C_site_10599
mod ID: M5CSITE000076		Click to Show/Hide the Full List
mod site	chr12:65965837-65965838:+
Sequence	TCTTAAGTCCCAGTATACCTCATTTTTCATACTGAAAAAAA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m5C_site_10600

N6-methyladenosine (m6A)

In total 63 m6A sequence/site(s) in this target gene
mod ID: M6ASITE013755		Click to Show/Hide the Full List
mod site	chr12:65824478-65824479:+		[6]
Sequence	ACTTGAATCTTGGGGCAGGAACTCAGAAAACTTCCAGCCCG
Motif Score	3.373380952
Cell/Tissue List	HepG2; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; A549; H1299; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000537275.5; ENST00000403681.6; ENST00000537429.5; ENST00000393578.7; ENST00000536545.5; ENST00000354636.7; ENST00000425208.6
External Link	RMBase: m6A_site_197400
mod ID: M6ASITE013756		Click to Show/Hide the Full List
mod site	chr12:65824487-65824488:+		[6]
Sequence	TTGGGGCAGGAACTCAGAAAACTTCCAGCCCGGGCAGCGCG
Motif Score	2.627720238
Cell/Tissue List	HepG2; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; A549; H1299; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000536545.5; ENST00000403681.6; ENST00000537275.5; ENST00000393578.7; ENST00000537429.5; ENST00000354636.7; ENST00000425208.6
External Link	RMBase: m6A_site_197401
mod ID: M6ASITE013757		Click to Show/Hide the Full List
mod site	chr12:65824521-65824522:+		[7]
Sequence	CAGCGCGCGCTTGGTGCAAGACTCAGGAGCTAGCAGCCCGT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; U2OS; H1B; hESCs; fibroblasts; A549; H1299; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000536545.5; ENST00000537275.5; ENST00000425208.6; ENST00000403681.6; ENST00000354636.7; ENST00000537429.5; ENST00000393578.7
External Link	RMBase: m6A_site_197402
mod ID: M6ASITE013758		Click to Show/Hide the Full List
mod site	chr12:65824823-65824824:+		[7]
Sequence	CCCGCCTAACATTTCAAGGGACACAATTCACTCCAAGTCTC
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; U2OS; H1A; fibroblasts; Huh7; GSC-11; iSLK; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000403681.6; ENST00000354636.7; ENST00000545998.1; ENST00000536545.5; ENST00000537275.5; ENST00000393578.7; ENST00000425208.6; ENST00000537429.5
External Link	RMBase: m6A_site_197403
mod ID: M6ASITE013759		Click to Show/Hide the Full List
mod site	chr12:65825320-65825321:+		[7]
Sequence	CCGTCCACTTCAGCCCAGGGACAACCTGCCGCCCCAGCGCC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; hESC-HEK293T; U2OS; H1299; GSC-11; iSLK; MSC; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000545998.1; ENST00000537429.5; ENST00000393577.7; ENST00000537275.5; ENST00000425208.6; ENST00000393578.7; ENST00000541363.5; ENST00000536545.5; ENST00000354636.7; ENST00000403681.6
External Link	RMBase: m6A_site_197404
mod ID: M6ASITE013760		Click to Show/Hide the Full List
mod site	chr12:65828002-65828003:+		[7]
Sequence	TTTTTCCCTCACAATTAGGAACCAACCGGTGAGCCCTCTCC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; U2OS; hNPCs; fibroblasts; H1299; GSC-11; HEK293T; iSLK; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000425208.6; ENST00000354636.7; ENST00000545998.1; ENST00000541363.5; ENST00000403681.6; ENST00000537275.5; ENST00000539662.1; ENST00000537429.5; ENST00000536545.5; ENST00000393577.7; ENST00000393578.7
External Link	RMBase: m6A_site_197406
mod ID: M6ASITE013761		Click to Show/Hide the Full List
mod site	chr12:65828029-65828030:+		[7]
Sequence	GGTGAGCCCTCTCCTAAGAGACCCAGGGGAAGACCCAAAGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; U2OS; hNPCs; fibroblasts; H1299; Huh7; GSC-11; HEK293T; iSLK; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000536545.5; ENST00000537275.5; ENST00000545998.1; ENST00000541363.5; ENST00000403681.6; ENST00000393577.7; ENST00000539662.1; ENST00000393578.7; ENST00000537429.5; ENST00000354636.7; ENST00000425208.6
External Link	RMBase: m6A_site_197407
mod ID: M6ASITE013762		Click to Show/Hide the Full List
mod site	chr12:65828041-65828042:+		[7]
Sequence	CCTAAGAGACCCAGGGGAAGACCCAAAGGCAGCAAAAACAA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; U2OS; hNPCs; fibroblasts; H1299; Huh7; GSC-11; HEK293T; iSLK; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000403681.6; ENST00000541363.5; ENST00000536545.5; ENST00000425208.6; ENST00000537429.5; ENST00000539662.1; ENST00000354636.7; ENST00000537275.5; ENST00000393578.7; ENST00000393577.7; ENST00000545998.1
External Link	RMBase: m6A_site_197408
mod ID: M6ASITE013763		Click to Show/Hide the Full List
mod site	chr12:65828058-65828059:+		[7]
Sequence	AAGACCCAAAGGCAGCAAAAACAAGAGTCCCTCTAAAGCAG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; hESC-HEK293T; U2OS; hNPCs; fibroblasts; H1299; Huh7; GSC-11; iSLK; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000541363.5; ENST00000536545.5; ENST00000393578.7; ENST00000537429.5; ENST00000425208.6; ENST00000354636.7; ENST00000403681.6; ENST00000539662.1; ENST00000537275.5; ENST00000545998.1; ENST00000393577.7
External Link	RMBase: m6A_site_197409
mod ID: M6ASITE013764		Click to Show/Hide the Full List
mod site	chr12:65828205-65828206:+		[7]
Sequence	TCCCAACTGGGTAACACAAGACTCATTTCTTACATTTAACA
Motif Score	3.319380952
Cell/Tissue List	HeLa; U2OS; H1299
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000537429.5; ENST00000545998.1; ENST00000536545.5; ENST00000537275.5; ENST00000393577.7; ENST00000541363.5; ENST00000403681.6; ENST00000354636.7; ENST00000539662.1; ENST00000393578.7; ENST00000425208.6
External Link	RMBase: m6A_site_197410
mod ID: M6ASITE013765		Click to Show/Hide the Full List
mod site	chr12:65830919-65830920:+		[8]
Sequence	CTACTTAATATTCCATTAAAACTAATTACTATGCATGACCA
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000615897.1; ENST00000537275.5; ENST00000393577.7; ENST00000537429.5; ENST00000536545.5; ENST00000425208.6; ENST00000354636.7; ENST00000393578.7; ENST00000403681.6; ENST00000539662.1; ENST00000541363.5
External Link	RMBase: m6A_site_197411
mod ID: M6ASITE013766		Click to Show/Hide the Full List
mod site	chr12:65830969-65830970:+		[8]
Sequence	GATTCTAGTCATTCCTCAGAACTCCAATCTGAGTGCTCAAA
Motif Score	3.373380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000393577.7; ENST00000537429.5; ENST00000393578.7; ENST00000539662.1; ENST00000354636.7; ENST00000403681.6; ENST00000425208.6; ENST00000536545.5; ENST00000541363.5; ENST00000615897.1; ENST00000537275.5
External Link	RMBase: m6A_site_197412
mod ID: M6ASITE013767		Click to Show/Hide the Full List
mod site	chr12:65838556-65838557:+		[9]
Sequence	GAAAAACGGCCAAGAGGCAGACCTAGGAAATGGGTGAGTAA
Motif Score	2.876744048
Cell/Tissue List	H1A; hNPCs; H1299; Huh7; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000354636.7; ENST00000403681.6; ENST00000393578.7; ENST00000541363.5; ENST00000537429.5; ENST00000536545.5; ENST00000537275.5; ENST00000539662.1; ENST00000425208.6; ENST00000393577.7
External Link	RMBase: m6A_site_197413
mod ID: M6ASITE013768		Click to Show/Hide the Full List
mod site	chr12:65867784-65867785:+		[10]
Sequence	ACATAAAGCTTGTCATCTGAACAGGACTATAAGCATCTCGA
Motif Score	2.951386905
Cell/Tissue List	iSLK
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000403681.6; ENST00000393577.7; ENST00000537429.5; ENST00000541363.5; ENST00000354636.7; ENST00000536545.5; ENST00000425208.6; ENST00000539662.1
External Link	RMBase: m6A_site_197439
mod ID: M6ASITE013769		Click to Show/Hide the Full List
mod site	chr12:65867789-65867790:+		[10]
Sequence	AAGCTTGTCATCTGAACAGGACTATAAGCATCTCGAGGGTA
Motif Score	4.065041667
Cell/Tissue List	iSLK
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000403681.6; ENST00000541363.5; ENST00000393577.7; ENST00000354636.7; ENST00000425208.6; ENST00000536545.5; ENST00000537429.5; ENST00000539662.1
External Link	RMBase: m6A_site_197440
mod ID: M6ASITE013770		Click to Show/Hide the Full List
mod site	chr12:65881793-65881794:+		[11]
Sequence	GGAAGCCTGCTGATCCCGGAACTGGCCTTGCGCGCAAGTGG
Motif Score	3.373380952
Cell/Tissue List	fibroblasts; iSLK; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000425208.6; ENST00000393577.7; ENST00000537429.5; ENST00000354636.7; ENST00000539662.1; ENST00000536545.5; ENST00000403681.6; ENST00000541363.5
External Link	RMBase: m6A_site_197446
mod ID: M6ASITE013771		Click to Show/Hide the Full List
mod site	chr12:65881825-65881826:+		[11]
Sequence	CGCAAGTGGTGGGATGACAGACACATTCCCTTCCTTGAACT
Motif Score	2.897386905
Cell/Tissue List	fibroblasts; GSC-11; iSLK; TIME; TREX; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000539662.1; ENST00000541363.5; ENST00000393577.7; ENST00000536545.5; ENST00000537429.5; ENST00000354636.7; ENST00000425208.6; ENST00000403681.6
External Link	RMBase: m6A_site_197447
mod ID: M6ASITE013772		Click to Show/Hide the Full List
mod site	chr12:65881843-65881844:+		[11]
Sequence	AGACACATTCCCTTCCTTGAACTGCACTCTTTTCCCTTGCA
Motif Score	3.373380952
Cell/Tissue List	fibroblasts; peripheral-blood; GSC-11; iSLK; TIME; TREX; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000537429.5; ENST00000354636.7; ENST00000393577.7; ENST00000403681.6; ENST00000536545.5; ENST00000425208.6; ENST00000541363.5; ENST00000539662.1
External Link	RMBase: m6A_site_197448
mod ID: M6ASITE013773		Click to Show/Hide the Full List
mod site	chr12:65951384-65951385:+		[12]
Sequence	TTTTCTTTTCCTCCTTAGCCACAACAAGTTGTTCAGAAGAA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000393577.7; ENST00000541363.5; ENST00000403681.6; ENST00000539662.1
External Link	RMBase: m6A_site_197459
mod ID: M6ASITE013774		Click to Show/Hide the Full List
mod site	chr12:65951387-65951388:+		[12]
Sequence	TCTTTTCCTCCTTAGCCACAACAAGTTGTTCAGAAGAAGCC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000541363.5; ENST00000539662.1; ENST00000393577.7; ENST00000403681.6
External Link	RMBase: m6A_site_197460
mod ID: M6ASITE013775		Click to Show/Hide the Full List
mod site	chr12:65963250-65963251:+		[13]
Sequence	TTTGTGTGTTCCAGGAGGAAACTGAAGAGACATCCTCACAA
Motif Score	2.627720238
Cell/Tissue List	HEK293T; HEC-1-A; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000539662.1; ENST00000403681.6
External Link	RMBase: m6A_site_197461
mod ID: M6ASITE013776		Click to Show/Hide the Full List
mod site	chr12:65963259-65963260:+		[12]
Sequence	TCCAGGAGGAAACTGAAGAGACATCCTCACAAGAGTCTGCC
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T; HEC-1-A; NB4
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000539662.1; ENST00000403681.6
External Link	RMBase: m6A_site_197462
mod ID: M6ASITE013777		Click to Show/Hide the Full List
mod site	chr12:65963267-65963268:+		[12]
Sequence	GAAACTGAAGAGACATCCTCACAAGAGTCTGCCGAAGAGGA
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6; ENST00000539662.1
External Link	RMBase: m6A_site_197463
mod ID: M6ASITE013778		Click to Show/Hide the Full List
mod site	chr12:65963287-65963288:+		[13]
Sequence	ACAAGAGTCTGCCGAAGAGGACTAGGGGGCGCCAACGTTCG
Motif Score	4.065041667
Cell/Tissue List	HEK293T; HEC-1-A; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000403681.6; ENST00000539662.1
External Link	RMBase: m6A_site_197464
mod ID: M6ASITE013779		Click to Show/Hide the Full List
mod site	chr12:65963349-65963350:+		[12]
Sequence	GGATCTTTTGAAGGGAGAAGACACTGCAGTGACCACTTATT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T; Huh7; HEC-1-A; NB4
Seq Type List	MAZTER-seq; MeRIP-seq; m6A-seq
Transcript ID List	ENST00000539662.1; ENST00000403681.6
External Link	RMBase: m6A_site_197465
mod ID: M6ASITE013780		Click to Show/Hide the Full List
mod site	chr12:65963452-65963453:+		[12]
Sequence	GGGTGGGGTGGGGAGAAATCACATAACCTTAAAAAGGACTA
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197466
mod ID: M6ASITE013781		Click to Show/Hide the Full List
mod site	chr12:65963469-65963470:+		[8]
Sequence	ATCACATAACCTTAAAAAGGACTATATTAATCACCTTCTTT
Motif Score	4.065041667
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197467
mod ID: M6ASITE013782		Click to Show/Hide the Full List
mod site	chr12:65963523-65963524:+		[8]
Sequence	AGTCCCAGGTTTAGTGAAAAACTGCTGTAAACACAGGGGAC
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197468
mod ID: M6ASITE013783		Click to Show/Hide the Full List
mod site	chr12:65963533-65963534:+		[8]
Sequence	TTAGTGAAAAACTGCTGTAAACACAGGGGACACAGCTTAAC
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197469
mod ID: M6ASITE013784		Click to Show/Hide the Full List
mod site	chr12:65963552-65963553:+		[12]
Sequence	AACACAGGGGACACAGCTTAACAATGCAACTTTTAATTACT
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197470
mod ID: M6ASITE013785		Click to Show/Hide the Full List
mod site	chr12:65963678-65963679:+		[12]
Sequence	AATCACTGCACTGCATGCAAACAAGAAACGTGTCACACTTG
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197471
mod ID: M6ASITE013786		Click to Show/Hide the Full List
mod site	chr12:65963692-65963693:+		[12]
Sequence	ATGCAAACAAGAAACGTGTCACACTTGTGACGTCGGGCATT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197472
mod ID: M6ASITE013787		Click to Show/Hide the Full List
mod site	chr12:65963737-65963738:+		[12]
Sequence	TAGGAAGAACGCGGTGTGTAACACTGTGTACACCTCAAATA
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197473
mod ID: M6ASITE013788		Click to Show/Hide the Full List
mod site	chr12:65963746-65963747:+		[12]
Sequence	CGCGGTGTGTAACACTGTGTACACCTCAAATACCACCCCAA
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197474
mod ID: M6ASITE013789		Click to Show/Hide the Full List
mod site	chr12:65963798-65963799:+		[12]
Sequence	TAGTGAATCCTCTGTTTAGAACACCAAAGATAAGGACTAGA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197475
mod ID: M6ASITE013790		Click to Show/Hide the Full List
mod site	chr12:65963813-65963814:+		[14]
Sequence	TTAGAACACCAAAGATAAGGACTAGATACTACTTTCTCTTT
Motif Score	4.065041667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197476
mod ID: M6ASITE013791		Click to Show/Hide the Full List
mod site	chr12:65963851-65963852:+		[12]
Sequence	TTTTTCGTATAATCTTGTAGACACTTACTTGATGATTTTTA
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197477
mod ID: M6ASITE013792		Click to Show/Hide the Full List
mod site	chr12:65963857-65963858:+		[14]
Sequence	GTATAATCTTGTAGACACTTACTTGATGATTTTTAACTTTT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197478
mod ID: M6ASITE013793		Click to Show/Hide the Full List
mod site	chr12:65963924-65963925:+		[12]
Sequence	TGTATCCTTTCATTCAGCTAACAAACTAGAAAAGGTTATGT
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197479
mod ID: M6ASITE013794		Click to Show/Hide the Full List
mod site	chr12:65963972-65963973:+		[12]
Sequence	TCAAAAAGGGAAGTAAGCAAACAAATATTGCCAACTCTTCT
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197480
mod ID: M6ASITE013795		Click to Show/Hide the Full List
mod site	chr12:65964271-65964272:+		[12]
Sequence	ATTTCTTTTGCTATAGTTATACATCAATTTAAAAAGCAAAA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197481
mod ID: M6ASITE013796		Click to Show/Hide the Full List
mod site	chr12:65964442-65964443:+		[12]
Sequence	ACTTCAAGTAATACGTTTTGACATAAGATGGTTGACCAAGG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197482
mod ID: M6ASITE013797		Click to Show/Hide the Full List
mod site	chr12:65964562-65964563:+		[12]
Sequence	CAATACTACCTCTGAATGTTACAACGAATTTACAGTCTAGT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197483
mod ID: M6ASITE013798		Click to Show/Hide the Full List
mod site	chr12:65964667-65964668:+		[12]
Sequence	TCATCTGCAGTTCTTTTTGTACACTTAATTACAGTTAAAGA
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197484
mod ID: M6ASITE013799		Click to Show/Hide the Full List
mod site	chr12:65964716-65964717:+		[14]
Sequence	CCTTACTGTGTTTCAGCATGACTATGTATTTTTCTATGTTT
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197485
mod ID: M6ASITE013800		Click to Show/Hide the Full List
mod site	chr12:65964789-65964790:+		[12]
Sequence	AGCTTCTCTGCTAGATTTCTACATTAACTTGAAAATTTTTT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197486
mod ID: M6ASITE013801		Click to Show/Hide the Full List
mod site	chr12:65964853-65964854:+		[12]
Sequence	AAGGATAATTTTCCTCAATCACACTACACATCACACAAGAT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197487
mod ID: M6ASITE013802		Click to Show/Hide the Full List
mod site	chr12:65964985-65964986:+		[14]
Sequence	CCAGACTTCAAAAGGAATGAACTTGTTACTTGCAGCATTCA
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197488
mod ID: M6ASITE013803		Click to Show/Hide the Full List
mod site	chr12:65965058-65965059:+		[14]
Sequence	TGCAGCTAACCCTAGTCAAAACTATTTTTGTAAAAGACATT
Motif Score	2.627720238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197489
mod ID: M6ASITE013804		Click to Show/Hide the Full List
mod site	chr12:65965074-65965075:+		[14]
Sequence	CAAAACTATTTTTGTAAAAGACATTTGATAGAAAGGAACAC
Motif Score	2.897386905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197490
mod ID: M6ASITE013805		Click to Show/Hide the Full List
mod site	chr12:65965158-65965159:+		[14]
Sequence	AAAAGCCAACCTTCAAAGAAACTTGAAGCTTTGTAGGTGAG
Motif Score	2.627720238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197491
mod ID: M6ASITE013806		Click to Show/Hide the Full List
mod site	chr12:65965184-65965185:+		[12]
Sequence	AGCTTTGTAGGTGAGATGCAACAAGCCCTGCTTTTGCATAA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197492
mod ID: M6ASITE013807		Click to Show/Hide the Full List
mod site	chr12:65965257-65965258:+		[14]
Sequence	TGAATATAAGAAAATGCTTGACAAATATTTTCATGTATTTT
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197493
mod ID: M6ASITE013808		Click to Show/Hide the Full List
mod site	chr12:65965374-65965375:+		[14]
Sequence	CTCTCCTAGTGAGTGTGCTGACTTTTTAACATGGTATTATC
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197494
mod ID: M6ASITE013809		Click to Show/Hide the Full List
mod site	chr12:65965382-65965383:+		[12]
Sequence	GTGAGTGTGCTGACTTTTTAACATGGTATTATCAACTGGGC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197495
mod ID: M6ASITE013810		Click to Show/Hide the Full List
mod site	chr12:65965516-65965517:+		[12]
Sequence	GGGAGGTAGTTTCAAAGGCCACATACCTCTCTGAGACTGGC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197496
mod ID: M6ASITE013811		Click to Show/Hide the Full List
mod site	chr12:65965591-65965592:+		[12]
Sequence	ATGGAGAGAATTAAAACTCAACATTACTGTTAACTGTGCGT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197497
mod ID: M6ASITE013812		Click to Show/Hide the Full List
mod site	chr12:65965733-65965734:+		[12]
Sequence	CAATTGCTCATGTTGGCCAAACATGGTGCACCGAGTGATTT
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197498
mod ID: M6ASITE013813		Click to Show/Hide the Full List
mod site	chr12:65965795-65965796:+		[14]
Sequence	TTTTATTTCCTGTATGTTGTACAATCAAAACACACTACTAC
Motif Score	2.856142857
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197499
mod ID: M6ASITE013814		Click to Show/Hide the Full List
mod site	chr12:65965885-65965886:+		[12]
Sequence	TGGCCAATGGAACAGTAAGAACATCATAAAATTTTTATATA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197500
mod ID: M6ASITE013815		Click to Show/Hide the Full List
mod site	chr12:65965970-65965971:+		[12]
Sequence	TGCTGTTGTTGGTCGCAGCTACATAAGACTGGACATTTAAC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197501
mod ID: M6ASITE013816		Click to Show/Hide the Full List
mod site	chr12:65966134-65966135:+		[14]
Sequence	GAATTGCTGTCTATGATTGTACTTTGAATCGCTTGCTTGTT
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197502
mod ID: M6ASITE013817		Click to Show/Hide the Full List
mod site	chr12:65966194-65966195:+		[14]
Sequence	ATTATCACTGTCTGTTCTGCACAATAAACATAACAGCCTCT
Motif Score	2.830589286
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000403681.6
External Link	RMBase: m6A_site_197503

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000022		Click to Show/Hide the Full List
mod site	chr12:65964467-65964468:+		[15]
Sequence	AGATGGTTGACCAAGGTGCTTTTCTTCGGCTTGAGTTCACC
Transcript ID List	ENST00000403681.6
External Link	RMBase: Pseudo_site_1170

Ref 1	m6A modification of circHPS5 and hepatocellular carcinoma progression through HMGA2 expression. Mol Ther Nucleic Acids. 2021 Sep 14;26:637-648. doi: 10.1016/j.omtn.2021.09.001. eCollection 2021 Dec 3.
Ref 2	The m6A methyltransferase METTL3 controls epithelial-mesenchymal transition, migration and invasion of breast cancer through the MALAT1/miR-26b/HMGA2 axis. Cancer Cell Int. 2021 Aug 21;21(1):441. doi: 10.1186/s12935-021-02113-5.
Ref 3	LINC00460/DHX9/IGF2BP2 complex promotes colorectal cancer proliferation and metastasis by mediating HMGA1 mRNA stability depending on m6A modification. J Exp Clin Cancer Res. 2021 Feb 1;40(1):52. doi: 10.1186/s13046-021-01857-2.
Ref 4	Metabolism of melatonin by human cytochromes p450. Drug Metab Dispos. 2005 Apr;33(4):489-94. doi: 10.1124/dmd.104.002410. Epub 2004 Dec 22.
Ref 5	Identification of 4-(2-(4-amino-1,2,5-oxadiazol-3-yl)-1-ethyl-7-{[(3S)-3-piperidinylmethyl]oxy}-1H-imidazo[4,5-c]pyridin-4-yl)-2-methyl-3-butyn-2-ol (GSK690693), a novel inhibitor of AKT kinase. J Med Chem. 2008 Sep 25;51(18):5663-79. doi: 10.1021/jm8004527.
Ref 6	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.
Ref 7	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 8	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 9	m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell. 2014 Dec 4;15(6):707-19. doi: 10.1016/j.stem.2014.09.019. Epub 2014 Oct 16.
Ref 10	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 11	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 12	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 13	Dynamics of Human and Viral RNA Methylation during Zika Virus Infection. Cell Host Microbe. 2016 Nov 9;20(5):666-673. doi: 10.1016/j.chom.2016.10.002. Epub 2016 Oct 20.
Ref 14	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 15	Chemical pulldown reveals dynamic pseudouridylation of the mammalian transcriptome. Nat Chem Biol. 2015 Aug;11(8):592-7. doi: 10.1038/nchembio.1836. Epub 2015 Jun 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map