m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00259)

Target Name	Forkhead box protein O1 (FOXO1)
Synonyms	Forkhead box protein O1A; Forkhead in rhabdomyosarcoma; FKHR; FOXO1A Click to Show/Hide
Gene Name	FOXO1
Chromosomal Location	13q14.11
Function	Transcription factor that is the main target of insulin signaling and regulates metabolic homeostasis in response to oxidative stress. Binds to the insulin response element (IRE) with consensus sequence 5'-TT[G/A]TTTTG-3' and the related Daf-16 family binding element (DBE) with consensus sequence 5'-TT[G/A]TTTAC-3' . Activity suppressed by insulin. Main regulator of redox balance and osteoblast numbers and controls bone mass (By similarity). Orchestrates the endocrine function of the skeleton in regulating glucose metabolism (By similarity). Also acts as a key regulator of chondrogenic commitment of skeletal progenitor cells in response to lipid availability: when lipids levels are low, translocates to the nucleus and promotes expression of SOX9, which induces chondrogenic commitment and suppresses fatty acid oxidation (By similarity). Acts synergistically with ATF4 to suppress osteocalcin/BGLAP activity, increasing glucose levels and triggering glucose intolerance and insulin insensitivity (By similarity). Also suppresses the transcriptional activity of RUNX2, an upstream activator of osteocalcin/BGLAP (By similarity). In hepatocytes, promotes gluconeogenesis by acting together with PPARGC1A and CEBPA to activate the expression of genes such as IGFBP1, G6PC1 and PCK1 (By similarity). Important regulator of cell death acting downstream of CDK1, PKB/AKT1 and STK4/MST1. Promotes neural cell death. Mediates insulin action on adipose tissue (By similarity). Regulates the expression of adipogenic genes such as PPARG during preadipocyte differentiation and, adipocyte size and adipose tissue-specific gene expression in response to excessive calorie intake (By similarity). Regulates the transcriptional activity of GADD45A and repair of nitric oxide-damaged DNA in beta-cells (By similarity). Required for the autophagic cell death induction in response to starvation or oxidative stress in a transcription-independent manner. Mediates the function of MLIP in cardiomyocytes hypertrophy and cardiac remodeling (By similarity). Regulates endothelial cell (EC) viability and apoptosis in a PPIA/CYPA-dependent manner via transcription of CCL2 and BCL2L11 which are involved in EC chemotaxis and apoptosis. Click to Show/Hide
Gene ID	2308
Uniprot ID	FOXO1_HUMAN
HGNC ID	HGNC:3819
KEGG ID	hsa:2308

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

FOXO1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	MDA-MB-231	Homo sapiens
Treatment: siMETTL14 MDA-MB-231 cells Control: MDA-MB-231 cells		GSE81164
Regulation		logFC: -7.56E-01 p-value: 2.27E-07
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL14 promotes Forkhead box protein O1 (FOXO1) expression by enhancing its m6A modification and inducing endothelial cell inflammatory response as well as atherosclerotic plaque formation.
Target Regulation	Up regulation
Responsed Disease	Herpes infection		ICD-11: 1F00	Disease Info
Pathway Response	FoxO signaling pathway			hsa04068
In-vitro Model	HUVEC-C	Normal	Homo sapiens	CVCL_2959
In-vivo Model	METTL14^+/- mice are generated by mating wild-type mice (C57/BL6 background) with METTL14^+/- mice. METTL14^+/-/APOE^-/- healthy offspring mice are produced by heterozygous METTL14^+/- mice and heterozygous APOE^-/- mice by Mendelian ratios. APOE^-/- mice and C57/BL6 mice were purchased from Model Animal Research Center of Nanjing (Nanjing, Jiangsu, China). All mice were housed in the Laboratory Animals Center of the Henan Provincial People's Hospital, with controlled temperature and humidity and a 12:12-hour dark-light cycle, and were provided water and mouse chow ad libitum.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL14 promotes Forkhead box protein O1 (FOXO1) expression by enhancing its m6A modification and inducing endothelial cell inflammatory response as well as atherosclerotic plaque formation.
Target Regulation	Up regulation
Responsed Disease	Atherosclerosis		ICD-11: BD40.Z	Disease Info
Pathway Response	FoxO signaling pathway			hsa04068
In-vitro Model	HUVEC-C	Normal	Homo sapiens	CVCL_2959
In-vivo Model	Mettl14^-/+ mice are generated by mating wild-type mice (C57/BL6 background) with Mettl14^-/+ mice. Mettl14^-/+/APOE^-/- healthy offspring mice are produced by heterozygous Mettl14^-/+ mice and heterozygous APOE^-/- mice by Mendelian ratios. APOE^-/- mice and C57/BL6 mice were purchased from Model Animal Research Center of Nanjing (Nanjing, Jiangsu, China). All mice were housed in the Laboratory Animals Center of the Henan Provincial People's Hospital, with controlled temperature and humidity and a 12:12-hour dark-light cycle, and were provided water and mouse chow ad libitum.

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	mouse embryonic stem cells	Mus musculus
Treatment: METTL3-/- ESCs Control: Wild type ESCs		GSE145309
Regulation		logFC: 9.70E-01 p-value: 7.07E-55
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Type 2 diabetes (T2D) is characterized by lack of insulin, insulin resistance and high blood sugar. METTL3 silence decreased the m6A methylated and total mRNA level of Fatty acid synthase (Fasn), subsequently inhibited fatty acid metabolism. The expression of Acc1, Acly, Dgat2, Ehhadh, Fasn, Forkhead box protein O1 (FOXO1), Pgc1a and Sirt1, which are critical to the regulation of fatty acid synthesis and oxidation were dramatically decreased in livers of hepatocyte-specific METTL3 knockout mice.
Target Regulation	Up regulation
Responsed Disease	Type 2 diabetes mellitus		ICD-11: 5A11	Disease Info
Pathway Response	Insulin resistance			hsa04931
Cell Process	Lipid metabolism
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
In-vivo Model	Hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3^fl/fl) were generated by crossing mice with TBG-Cre Tg mice. METTL3 flox (METTL3^fl/fl) and hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3^fl/fl) were used for experiments.

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	Glucose Is Involved in the Dynamic Regulation of m6A in Patients with Type 2 Diabetes. High-glucose stimulation enhances FTO expression, which leads to decreased m6A, and the lower m6A induces methyltransferase upregulation; FTO then triggers the mRNA expression of Forkhead box protein O1 (FOXO1), FASN, G6PC, and DGAT2, and these four genes were correlated with glucose and lipid metabolism.
Responsed Disease	Diabetes		ICD-11: 5A10-5A14	Disease Info
Cell Process	Lipid metabolism
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027

Herpes infection [ICD-11: 1F00]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL14 promotes Forkhead box protein O1 (FOXO1) expression by enhancing its m6A modification and inducing endothelial cell inflammatory response as well as atherosclerotic plaque formation.
Responsed Disease	Herpes infection [ICD-11: 1F00]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	FoxO signaling pathway			hsa04068
In-vitro Model	HUVEC-C	Normal	Homo sapiens	CVCL_2959
In-vivo Model	METTL14^+/- mice are generated by mating wild-type mice (C57/BL6 background) with METTL14^+/- mice. METTL14^+/-/APOE^-/- healthy offspring mice are produced by heterozygous METTL14^+/- mice and heterozygous APOE^-/- mice by Mendelian ratios. APOE^-/- mice and C57/BL6 mice were purchased from Model Animal Research Center of Nanjing (Nanjing, Jiangsu, China). All mice were housed in the Laboratory Animals Center of the Henan Provincial People's Hospital, with controlled temperature and humidity and a 12:12-hour dark-light cycle, and were provided water and mouse chow ad libitum.

Diabetes [ICD-11: 5A10-5A14]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	Glucose Is Involved in the Dynamic Regulation of m6A in Patients with Type 2 Diabetes. High-glucose stimulation enhances FTO expression, which leads to decreased m6A, and the lower m6A induces methyltransferase upregulation; FTO then triggers the mRNA expression of Forkhead box protein O1 (FOXO1), FASN, G6PC, and DGAT2, and these four genes were correlated with glucose and lipid metabolism.
Responsed Disease	Diabetes [ICD-11: 5A10-5A14]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Cell Process	Lipid metabolism
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027

Type 2 diabetes mellitus [ICD-11: 5A11]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	Type 2 diabetes (T2D) is characterized by lack of insulin, insulin resistance and high blood sugar. METTL3 silence decreased the m6A methylated and total mRNA level of Fatty acid synthase (Fasn), subsequently inhibited fatty acid metabolism. The expression of Acc1, Acly, Dgat2, Ehhadh, Fasn, Forkhead box protein O1 (FOXO1), Pgc1a and Sirt1, which are critical to the regulation of fatty acid synthesis and oxidation were dramatically decreased in livers of hepatocyte-specific METTL3 knockout mice.
Responsed Disease	Type 2 diabetes mellitus [ICD-11: 5A11]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Insulin resistance			hsa04931
Cell Process	Lipid metabolism
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
In-vivo Model	Hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3^fl/fl) were generated by crossing mice with TBG-Cre Tg mice. METTL3 flox (METTL3^fl/fl) and hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3^fl/fl) were used for experiments.

Atherosclerosis [ICD-11: BD40]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL14 promotes Forkhead box protein O1 (FOXO1) expression by enhancing its m6A modification and inducing endothelial cell inflammatory response as well as atherosclerotic plaque formation.
Responsed Disease	Atherosclerosis [ICD-11: BD40.Z]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	FoxO signaling pathway			hsa04068
In-vitro Model	HUVEC-C	Normal	Homo sapiens	CVCL_2959
In-vivo Model	Mettl14^-/+ mice are generated by mating wild-type mice (C57/BL6 background) with Mettl14^-/+ mice. Mettl14^-/+/APOE^-/- healthy offspring mice are produced by heterozygous Mettl14^-/+ mice and heterozygous APOE^-/- mice by Mendelian ratios. APOE^-/- mice and C57/BL6 mice were purchased from Model Animal Research Center of Nanjing (Nanjing, Jiangsu, China). All mice were housed in the Laboratory Animals Center of the Henan Provincial People's Hospital, with controlled temperature and humidity and a 12:12-hour dark-light cycle, and were provided water and mouse chow ad libitum.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03370		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase SETDB1 (SETDB1)
Regulated Target	Polo like kinase 3 (PLK3)
Crosstalk relationship	Histone modification → m6A
Disease	Triple-negative breast cancer	Disease Info
Drug	Doxil	Drug Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00259)

Forkhead box protein O1 (FOXO1)

Adenosine-to-Inosine editing (A-to-I)

In total 9 m6A sequence/site(s) in this target gene
mod ID: A2ISITE006072		Click to Show/Hide the Full List
mod site	chr13:40511221-40511222:-		[7]
Sequence	CTCAGAAACCTAGAACCAGAAATATCATTTGACCCAGCAAT
Transcript ID List	ENST00000636651.1; rmsk_3995433; ENST00000615137.1
External Link	RMBase: RNA-editing_site_34887
mod ID: A2ISITE006073		Click to Show/Hide the Full List
mod site	chr13:40535091-40535092:-		[7]
Sequence	CCTCCTGAGTAGCTGGGATTACAGGCATGTGCCACCACGCC
Transcript ID List	ENST00000615137.1; ENST00000636651.1
External Link	RMBase: RNA-editing_site_34888
mod ID: A2ISITE006074		Click to Show/Hide the Full List
mod site	chr13:40536508-40536509:-		[7]
Sequence	ATCACTTGAGGTCAGGAATTAGAGACCAGCCTGGGAAACAT
Transcript ID List	rmsk_3995493; ENST00000636651.1
External Link	RMBase: RNA-editing_site_34889
mod ID: A2ISITE006075		Click to Show/Hide the Full List
mod site	chr13:40546413-40546414:-		[7]
Sequence	GAGGGTCTGTTTTCCATTGGAAATGGGCCTCTCTTTTCTTA
Transcript ID List	ENST00000636651.1
External Link	RMBase: RNA-editing_site_34890
mod ID: A2ISITE006076		Click to Show/Hide the Full List
mod site	chr13:40566678-40566679:-		[7]
Sequence	TGAGATAAAAAATTTAAAGTAGGCCAGGCGCAGTGGCTCAC
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: RNA-editing_site_34891
mod ID: A2ISITE006077		Click to Show/Hide the Full List
mod site	chr13:40646501-40646502:-		[7]
Sequence	TTTTATAATATTCACCTTTTAGAAGTCACAGTAGTTGGCTG
Transcript ID List	ENST00000379561.6
External Link	RMBase: RNA-editing_site_34892
mod ID: A2ISITE006078		Click to Show/Hide the Full List
mod site	chr13:40646730-40646731:-		[8]
Sequence	CGTGGTGGCACATGTCTGTAATCCCGGCTACTTGGGAGGCT
Transcript ID List	ENST00000379561.6; rmsk_3995670
External Link	RMBase: RNA-editing_site_34893
mod ID: A2ISITE006079		Click to Show/Hide the Full List
mod site	chr13:40653172-40653173:-		[7]
Sequence	AGTTCGAGACAAGCCTGGCAACATGGTGAAACCCTGCCTCT
Transcript ID List	rmsk_3995681; ENST00000379561.6
External Link	RMBase: RNA-editing_site_34894
mod ID: A2ISITE006080		Click to Show/Hide the Full List
mod site	chr13:40655072-40655073:-		[7]
Sequence	AAAGTGCTGGGATCACTGGCATGAGCCCCCACGCCCTGCCG
Transcript ID List	ENST00000379561.6
External Link	RMBase: RNA-editing_site_34895

5-methylcytidine (m5C)

In total 15 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000156		Click to Show/Hide the Full List
mod site	chr13:40665903-40665904:-		[9]
Sequence	GCGGCCGCCGCGGCCGCCACCGGGGGGCTGTGCGGGGACTT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m5C_site_11797
mod ID: M5CSITE000157		Click to Show/Hide the Full List
mod site	chr13:40665904-40665905:-		[9]
Sequence	GGCGGCCGCCGCGGCCGCCACCGGGGGGCTGTGCGGGGACT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m5C_site_11798
mod ID: M5CSITE000158		Click to Show/Hide the Full List
mod site	chr13:40665906-40665907:-		[9]
Sequence	GCGGCGGCCGCCGCGGCCGCCACCGGGGGGCTGTGCGGGGA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m5C_site_11799
mod ID: M5CSITE000160		Click to Show/Hide the Full List
mod site	chr13:40665907-40665908:-		[9]
Sequence	GGCGGCGGCCGCCGCGGCCGCCACCGGGGGGCTGTGCGGGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m5C_site_11800
mod ID: M5CSITE000161		Click to Show/Hide the Full List
mod site	chr13:40665909-40665910:-		[9]
Sequence	GCGGCGGCGGCCGCCGCGGCCGCCACCGGGGGGCTGTGCGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m5C_site_11801
mod ID: M5CSITE000162		Click to Show/Hide the Full List
mod site	chr13:40665910-40665911:-		[9]
Sequence	GGCGGCGGCGGCCGCCGCGGCCGCCACCGGGGGGCTGTGCG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m5C_site_11802
mod ID: M5CSITE000163		Click to Show/Hide the Full List
mod site	chr13:40665913-40665914:-		[9]
Sequence	GGTGGCGGCGGCGGCCGCCGCGGCCGCCACCGGGGGGCTGT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m5C_site_11803
mod ID: M5CSITE000164		Click to Show/Hide the Full List
mod site	chr13:40665915-40665916:-		[9]
Sequence	GCGGTGGCGGCGGCGGCCGCCGCGGCCGCCACCGGGGGGCT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m5C_site_11804
mod ID: M5CSITE000165		Click to Show/Hide the Full List
mod site	chr13:40665916-40665917:-		[9]
Sequence	GGCGGTGGCGGCGGCGGCCGCCGCGGCCGCCACCGGGGGGC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m5C_site_11805
mod ID: M5CSITE000166		Click to Show/Hide the Full List
mod site	chr13:40665918-40665919:-		[9]
Sequence	GCGGCGGTGGCGGCGGCGGCCGCCGCGGCCGCCACCGGGGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m5C_site_11806
mod ID: M5CSITE000167		Click to Show/Hide the Full List
mod site	chr13:40665919-40665920:-		[9]
Sequence	GGCGGCGGTGGCGGCGGCGGCCGCCGCGGCCGCCACCGGGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m5C_site_11807
mod ID: M5CSITE000168		Click to Show/Hide the Full List
mod site	chr13:40665922-40665923:-
Sequence	GGCGGCGGCGGTGGCGGCGGCGGCCGCCGCGGCCGCCACCG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m5C_site_11808
mod ID: M5CSITE000169		Click to Show/Hide the Full List
mod site	chr13:40665925-40665926:-		[9]
Sequence	CGTGGCGGCGGCGGTGGCGGCGGCGGCCGCCGCGGCCGCCA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m5C_site_11809
mod ID: M5CSITE000171		Click to Show/Hide the Full List
mod site	chr13:40665928-40665929:-
Sequence	CTCCGTGGCGGCGGCGGTGGCGGCGGCGGCCGCCGCGGCCG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m5C_site_11810
mod ID: M5CSITE000172		Click to Show/Hide the Full List
mod site	chr13:40665934-40665935:-
Sequence	GCCCGGCTCCGTGGCGGCGGCGGTGGCGGCGGCGGCCGCCG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m5C_site_11811

N6-methyladenosine (m6A)

In total 66 m6A sequence/site(s) in this target gene
mod ID: M6ASITE017005		Click to Show/Hide the Full List
mod site	chr13:40556020-40556021:-		[10]
Sequence	ATGTATTGTGGTTTATGCGAACAGACCAACCTGGCATTACA
Motif Score	2.951386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225778
mod ID: M6ASITE017006		Click to Show/Hide the Full List
mod site	chr13:40556194-40556195:-		[11]
Sequence	TCCAACGATATACAAATTGGACTTGTTCAACTGCTGGATAT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; H1A; H1B; hESCs; fibroblasts; GM12878; CD8T; A549; Huh7; HEK293A-TOA; TREX
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225779
mod ID: M6ASITE017007		Click to Show/Hide the Full List
mod site	chr13:40556203-40556204:-		[12]
Sequence	AAATCATTCTCCAACGATATACAAATTGGACTTGTTCAACT
Motif Score	2.110482143
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225780
mod ID: M6ASITE017008		Click to Show/Hide the Full List
mod site	chr13:40556258-40556259:-		[11]
Sequence	GTGAGCAGTAAATCAATGGAACATCCCAAGAAGAGGATAAG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; H1A; H1B; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; TREX
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225781
mod ID: M6ASITE017009		Click to Show/Hide the Full List
mod site	chr13:40556311-40556312:-		[11]
Sequence	GGAAAGTTCTGCTTTGACAAACTGACAAAGTCTAAATGAGC
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; hESCs; fibroblasts; Huh7; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225782
mod ID: M6ASITE017010		Click to Show/Hide the Full List
mod site	chr13:40556597-40556598:-		[11]
Sequence	CTGGTCTGTCTGGAAAGCAAACATTATGTGGCCTCTGGTAG
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225783
mod ID: M6ASITE017011		Click to Show/Hide the Full List
mod site	chr13:40556641-40556642:-		[11]
Sequence	TCCTTGGTAGCTCTCTGAGAACAGTGAAGTCCAGGGAAAGG
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225784
mod ID: M6ASITE017012		Click to Show/Hide the Full List
mod site	chr13:40556826-40556827:-		[13]
Sequence	ACTGCATCATAATACAAGGAACCTCAGAGCCCCCATTTGTT
Motif Score	2.930744048
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225785
mod ID: M6ASITE017013		Click to Show/Hide the Full List
mod site	chr13:40556833-40556834:-		[14]
Sequence	TGCCATTACTGCATCATAATACAAGGAACCTCAGAGCCCCC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225786
mod ID: M6ASITE017014		Click to Show/Hide the Full List
mod site	chr13:40556914-40556915:-		[13]
Sequence	CCTCCCGGGTATGTAACTGAACTTGGTGCCAAAGTACTTGT
Motif Score	3.373380952
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225787
mod ID: M6ASITE017015		Click to Show/Hide the Full List
mod site	chr13:40557015-40557016:-		[13]
Sequence	TTTTTTTGAAGATTCATTGAACAGCCACCACTCTATCATCC
Motif Score	2.951386905
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225788
mod ID: M6ASITE017016		Click to Show/Hide the Full List
mod site	chr13:40557178-40557179:-		[14]
Sequence	AATTTTTCTGTATATAGCCCACATCACACTTGCTTTGTCTT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225789
mod ID: M6ASITE017017		Click to Show/Hide the Full List
mod site	chr13:40557331-40557332:-		[15]
Sequence	TTTCCAATTACCTGTAACTGACAGACCAAATTAATTGGCTT
Motif Score	2.859755952
Cell/Tissue List	HEK293
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225790
mod ID: M6ASITE017018		Click to Show/Hide the Full List
mod site	chr13:40557556-40557557:-		[13]
Sequence	GGAGGGAATTTAAAAATGGGACTTGAGTGGTTTGTAGAATT
Motif Score	4.065041667
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225791
mod ID: M6ASITE017019		Click to Show/Hide the Full List
mod site	chr13:40558116-40558117:-		[14]
Sequence	TGGATTAGTACTAATTTTATACATGCTTAACTGGTTTGTAC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225792
mod ID: M6ASITE017020		Click to Show/Hide the Full List
mod site	chr13:40558185-40558186:-		[11]
Sequence	CAGCTTGTAAATTTTGTGGAACCACAGGTATTTGGGGCAGC
Motif Score	2.930744048
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225793
mod ID: M6ASITE017021		Click to Show/Hide the Full List
mod site	chr13:40558230-40558231:-		[10]
Sequence	TGTAATAATGTTTTCTTAAAACTAGAGTCTACTTTGTTACA
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225794
mod ID: M6ASITE017022		Click to Show/Hide the Full List
mod site	chr13:40558252-40558253:-		[10]
Sequence	ATTTTTGGAATAGATATTGAACTGTAATAATGTTTTCTTAA
Motif Score	3.373380952
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225795
mod ID: M6ASITE017023		Click to Show/Hide the Full List
mod site	chr13:40558274-40558275:-		[10]
Sequence	GTTATTGTTGGGACTTAAGAACATTTTTGGAATAGATATTG
Motif Score	2.951386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225796
mod ID: M6ASITE017024		Click to Show/Hide the Full List
mod site	chr13:40558335-40558336:-		[10]
Sequence	TTATTTGCAAATTTGTACAAACATTTAAATGGTTCTAATTT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225797
mod ID: M6ASITE017025		Click to Show/Hide the Full List
mod site	chr13:40558424-40558425:-		[11]
Sequence	TAAATTAATGGACTTGTTAAACTTTTGGAAAAAAAAAGATT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; HEK293T; H1A; H1B; hESCs; fibroblasts; GM12878; CD8T; Huh7; Jurkat; HEK293A-TOA; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225798
mod ID: M6ASITE017026		Click to Show/Hide the Full List
mod site	chr13:40558433-40558434:-		[11]
Sequence	TCAATCTGCTAAATTAATGGACTTGTTAAACTTTTGGAAAA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; H1A; H1B; hESCs; fibroblasts; GM12878; CD8T; Huh7; Jurkat; HEK293A-TOA; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225799
mod ID: M6ASITE017027		Click to Show/Hide the Full List
mod site	chr13:40558469-40558470:-		[11]
Sequence	GCCACAGAATTCACATGAGAACCAAGTAGCCTGTTATCAAT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; H1A; H1B; hESCs; fibroblasts; A549; GM12878; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225800
mod ID: M6ASITE017028		Click to Show/Hide the Full List
mod site	chr13:40558477-40558478:-		[14]
Sequence	TTCACGTTGCCACAGAATTCACATGAGAACCAAGTAGCCTG
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225801
mod ID: M6ASITE017029		Click to Show/Hide the Full List
mod site	chr13:40558502-40558503:-		[11]
Sequence	TCTCCATTGAACAGCCTTGGACCTGTTCACGTTGCCACAGA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; H1A; H1B; hESCs; fibroblasts; A549; GM12878; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225802
mod ID: M6ASITE017030		Click to Show/Hide the Full List
mod site	chr13:40558512-40558513:-		[11]
Sequence	CCATTCTGCATCTCCATTGAACAGCCTTGGACCTGTTCACG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; H1A; H1B; hESCs; fibroblasts; A549; GM12878; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225803
mod ID: M6ASITE017031		Click to Show/Hide the Full List
mod site	chr13:40558541-40558542:-		[11]
Sequence	GAACTGACGGATCACAAAGAACTGAATCTCCATTCTGCATC
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293T; H1A; H1B; hESCs; fibroblasts; A549; GM12878; Huh7; Jurkat; HEK293A-TOA; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225804
mod ID: M6ASITE017032		Click to Show/Hide the Full List
mod site	chr13:40558548-40558549:-		[14]
Sequence	TTCTGCGGAACTGACGGATCACAAAGAACTGAATCTCCATT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225805
mod ID: M6ASITE017033		Click to Show/Hide the Full List
mod site	chr13:40558559-40558560:-		[11]
Sequence	TACTACCTGTTTTCTGCGGAACTGACGGATCACAAAGAACT
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293T; H1A; H1B; hESCs; fibroblasts; A549; GM12878; Huh7; Jurkat; HEK293A-TOA; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225806
mod ID: M6ASITE017034		Click to Show/Hide the Full List
mod site	chr13:40558590-40558591:-		[11]
Sequence	CTCATGTCTTGATAAGTTAAACTTTTGTTTGTACTACCTGT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; HepG2; H1A; hESCs; fibroblasts; A549; GM12878; Huh7; HEK293A-TOA; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225807
mod ID: M6ASITE017035		Click to Show/Hide the Full List
mod site	chr13:40558777-40558778:-		[11]
Sequence	TCATTACAATGAAGTGCCAAACTCACTACACCATATAATTG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; Huh7; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225808
mod ID: M6ASITE017036		Click to Show/Hide the Full List
mod site	chr13:40558815-40558816:-		[11]
Sequence	ATGTGCTGCTGTAGATAAGGACTGTGCCATTGGAAATTTCA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; CD8T; Huh7; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225809
mod ID: M6ASITE017037		Click to Show/Hide the Full List
mod site	chr13:40558877-40558878:-		[11]
Sequence	CGTCAGACTTGGCAGCAAAGACATTTTTCCTGTACAGGATG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; HEK293T; kidney; A549; hESC-HEK293T; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; CD8T; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225810
mod ID: M6ASITE017038		Click to Show/Hide the Full List
mod site	chr13:40558891-40558892:-		[11]
Sequence	TCCTTTTTTCCTTTCGTCAGACTTGGCAGCAAAGACATTTT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225811
mod ID: M6ASITE017039		Click to Show/Hide the Full List
mod site	chr13:40558915-40558916:-		[11]
Sequence	AAAAAAAAACAAAAAAAAAAACCCTCCTTTTTTCCTTTCGT
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; Huh7; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225812
mod ID: M6ASITE017040		Click to Show/Hide the Full List
mod site	chr13:40558927-40558928:-		[11]
Sequence	TTTCTTGGTTAAAAAAAAAAACAAAAAAAAAAACCCTCCTT
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; Huh7; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225813
mod ID: M6ASITE017041		Click to Show/Hide the Full List
mod site	chr13:40558994-40558995:-		[11]
Sequence	CAGATTGTCTGACAGCAGGAACTGAGAGAAGCAGTCCAAAG
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; CD8T; Huh7; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225814
mod ID: M6ASITE017042		Click to Show/Hide the Full List
mod site	chr13:40559551-40559552:-		[11]
Sequence	GCTTCCCACACAGTGTCAAGACAACGACACATAGCTGGGTG
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; Huh7; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225815
mod ID: M6ASITE017043		Click to Show/Hide the Full List
mod site	chr13:40559628-40559629:-		[16]
Sequence	GGAATCCATCATTCGGAATGACCTCATGGATGGAGATACAT
Motif Score	2.839113095
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225816
mod ID: M6ASITE017044		Click to Show/Hide the Full List
mod site	chr13:40559652-40559653:-		[14]
Sequence	CATTGAGCGCTTAGACTGTGACATGGAATCCATCATTCGGA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225817
mod ID: M6ASITE017045		Click to Show/Hide the Full List
mod site	chr13:40559658-40559659:-		[11]
Sequence	CATGTTCATTGAGCGCTTAGACTGTGACATGGAATCCATCA
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; CD8T; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225818
mod ID: M6ASITE017046		Click to Show/Hide the Full List
mod site	chr13:40559688-40559689:-		[16]
Sequence	CCAGGAGAAGCTCCCAAGTGACTTGGATGGCATGTTCATTG
Motif Score	3.28175
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225819
mod ID: M6ASITE017047		Click to Show/Hide the Full List
mod site	chr13:40559804-40559805:-		[14]
Sequence	ACCCAAGTGAAGACACCTGTACAAGTGCCTCTGCCCCACCC
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225820
mod ID: M6ASITE017048		Click to Show/Hide the Full List
mod site	chr13:40559812-40559813:-		[11]
Sequence	ACCGCCTGACCCAAGTGAAGACACCTGTACAAGTGCCTCTG
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; U2OS; hESCs; GM12878; MT4; Huh7; HEK293A-TOA; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225821
mod ID: M6ASITE017049		Click to Show/Hide the Full List
mod site	chr13:40559832-40559833:-		[11]
Sequence	GCCCCACACCTCGGGTATGAACCGCCTGACCCAAGTGAAGA
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; U2OS; hESCs; GM12878; MT4; Huh7; HEK293A-TOA; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225822
mod ID: M6ASITE017050		Click to Show/Hide the Full List
mod site	chr13:40559899-40559900:-		[11]
Sequence	ACCCTGGACATGCTCAGCAGACATCTGCAGTTAACGGGCGT
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; hESCs; GM12878; MT4; Huh7; HEK293A-TOA; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225823
mod ID: M6ASITE017051		Click to Show/Hide the Full List
mod site	chr13:40559912-40559913:-		[11]
Sequence	AGCTCCCATACCCACCCTGGACATGCTCAGCAGACATCTGC
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; hESCs; GM12878; MT4; Huh7; HEK293A-TOA; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225824
mod ID: M6ASITE017052		Click to Show/Hide the Full List
mod site	chr13:40560110-40560111:-		[11]
Sequence	CAGTATAACTGTGCGCCTGGACTCTTGAAGGAGTTGCTGAC
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225825
mod ID: M6ASITE017053		Click to Show/Hide the Full List
mod site	chr13:40560159-40560160:-		[11]
Sequence	GCCTATACAAACACTTCAGGACAATAAGTCGAGTTATGGAG
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; CD8T; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225826
mod ID: M6ASITE017054		Click to Show/Hide the Full List
mod site	chr13:40560169-40560170:-		[11]
Sequence	TGCCCCAGATGCCTATACAAACACTTCAGGACAATAAGTCG
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1B; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225827
mod ID: M6ASITE017055		Click to Show/Hide the Full List
mod site	chr13:40560231-40560232:-		[11]
Sequence	TTTGAATTCACCCAGCCCAAACTACCAAAAATATACATATG
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; hESCs; fibroblasts; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225828
mod ID: M6ASITE017056		Click to Show/Hide the Full List
mod site	chr13:40560258-40560259:-		[11]
Sequence	CTACTCGTTTGCGCCACCAAACACCAGTTTGAATTCACCCA
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; hESCs; fibroblasts; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225829
mod ID: M6ASITE017057		Click to Show/Hide the Full List
mod site	chr13:40560381-40560382:-		[11]
Sequence	TGAGATAAGCAATCCCGAAAACATGGAAAATCTTTTGGATA
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; MSC; TIME; TREX; iSLK; endometrial
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225830
mod ID: M6ASITE017058		Click to Show/Hide the Full List
mod site	chr13:40560488-40560489:-		[11]
Sequence	CTCTCACCCATTATGACCGAACAGGATGATCTTGGAGAAGG
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; Huh7; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225831
mod ID: M6ASITE017059		Click to Show/Hide the Full List
mod site	chr13:40560509-40560510:-		[11]
Sequence	GCTAGTACTATTAGTGGGAGACTCTCACCCATTATGACCGA
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225832
mod ID: M6ASITE017060		Click to Show/Hide the Full List
mod site	chr13:40560541-40560542:-		[11]
Sequence	GGAGTACATTTCGCCCTCGAACTAGCTCAAATGCTAGTACT
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000636651.1; ENST00000379561.6
External Link	RMBase: m6A_site_225833
mod ID: M6ASITE017061		Click to Show/Hide the Full List
mod site	chr13:40560633-40560634:-		[11]
Sequence	TGGCCAGGAGGGTGCTGGGGACAGCCCTGGATCACAGTTTT
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225834
mod ID: M6ASITE017062		Click to Show/Hide the Full List
mod site	chr13:40560717-40560718:-		[11]
Sequence	GAGAAGAGCTGCATCCATGGACAACAACAGTAAATTTGCTA
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; H1A; H1B; hNPCs; hESCs; fibroblasts; A549; GM12878; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6; ENST00000636651.1
External Link	RMBase: m6A_site_225835
mod ID: M6ASITE017063		Click to Show/Hide the Full List
mod site	chr13:40560799-40560800:-		[11]
Sequence	TTCGTGTGCAGAATGAAGGAACTGGAAAAAGTTCTTGGTGG
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; fibroblasts; GM12878; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000636651.1; ENST00000473775.1; ENST00000379561.6
External Link	RMBase: m6A_site_225836
mod ID: M6ASITE017064		Click to Show/Hide the Full List
mod site	chr13:40562727-40562728:-		[11]
Sequence	TTCTGCTGAAACTTGGAGAGACCACCTCTGGCCCCTTTCAC
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000379561.6; ENST00000473775.1; ENST00000636651.1
External Link	RMBase: m6A_site_225837
mod ID: M6ASITE017065		Click to Show/Hide the Full List
mod site	chr13:40562737-40562738:-		[13]
Sequence	GCTCTGGTGTTTCTGCTGAAACTTGGAGAGACCACCTCTGG
Motif Score	2.627720238
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000636651.1; ENST00000473775.1; ENST00000379561.6
External Link	RMBase: m6A_site_225838
mod ID: M6ASITE017066		Click to Show/Hide the Full List
mod site	chr13:40665886-40665887:-		[17]
Sequence	CACCGGGGGGCTGTGCGGGGACTTCCAGGGCCCGGAGGCGG
Motif Score	4.065041667
Cell/Tissue List	HEK293T; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m6A_site_225839
mod ID: M6ASITE017067		Click to Show/Hide the Full List
mod site	chr13:40665967-40665968:-		[17]
Sequence	CTTGCTGGAGGAGAGCGAGGACTTCCCGCAGGCGCCCGGCT
Motif Score	4.065041667
Cell/Tissue List	HEK293T; HEK293A-TOA; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m6A_site_225840
mod ID: M6ASITE017068		Click to Show/Hide the Full List
mod site	chr13:40666174-40666175:-		[11]
Sequence	GGTGGTGGAGATCGACCCGGACTTCGAGCCGCTGCCCCGGC
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; H1A; H1B; GM12878; Jurkat; CD4T; GSC-11; HEK293A-TOA; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m6A_site_225841
mod ID: M6ASITE017069		Click to Show/Hide the Full List
mod site	chr13:40666303-40666304:-		[11]
Sequence	TTCGTTCCCCCAAATCTCGGACCGTCCCTTCGCGCCCCCTC
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; H1A; H1B; hESCs; GM12878; Jurkat; CD4T; GSC-11; HEK293A-TOA; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m6A_site_225842
mod ID: M6ASITE017070		Click to Show/Hide the Full List
mod site	chr13:40666429-40666430:-		[11]
Sequence	CCGTCCAGTCCGTGCGGCGGACCCCGAGGAGCCTCGATGTG
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; H1B; CD4T; GSC-11; HEK293T; HEK293A-TOA; MSC; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379561.6
External Link	RMBase: m6A_site_225843

Ref 1	METTL14 aggravates endothelial inflammation and atherosclerosis by increasing FOXO1 N6-methyladeosine modifications. Theranostics. 2020 Jul 11;10(20):8939-8956. doi: 10.7150/thno.45178. eCollection 2020.
Ref 2	METTL3 inhibits hepatic insulin sensitivity via N6-methyladenosine modification of Fasn mRNA and promoting fatty acid metabolism. Biochem Biophys Res Commun. 2019 Oct 8;518(1):120-126. doi: 10.1016/j.bbrc.2019.08.018. Epub 2019 Aug 10.
Ref 3	Glucose Is Involved in the Dynamic Regulation of m6A in Patients With Type 2 Diabetes. J Clin Endocrinol Metab. 2019 Mar 1;104(3):665-673. doi: 10.1210/jc.2018-00619.
Ref 4	TNFerade, an adenovector carrying the transgene for human tumor necrosis factor alpha, for patients with advanced solid tumors: surgical experience and long-term follow-up. Ann Surg Oncol. 2005 Oct;12(10):825-30. doi: 10.1245/ASO.2005.03.023. Epub 2005 Aug 9.
Ref 5	In vitro metabolism study of buprenorphine: evidence for new metabolic pathways. Drug Metab Dispos. 2005 May;33(5):689-95. doi: 10.1124/dmd.105.003681. Epub 2005 Mar 2.
Ref 6	US patent application no. 6,159,697, Antisense modulation of Smad7 expression.
Ref 7	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 8	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 9	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 10	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 11	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 12	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 13	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 14	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 15	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 16	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 17	Dynamics of Human and Viral RNA Methylation during Zika Virus Infection. Cell Host Microbe. 2016 Nov 9;20(5):666-673. doi: 10.1016/j.chom.2016.10.002. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map