m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00246)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ERCC1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Fat mass and obesity-associated protein (FTO) [ERASER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | The mRNA level of FTO is elevated in cervical squamous cell carcinoma (CSCC) tissues when compared with respective adjacent normal tissues.FTO enhances the chemo-radiotherapy resistance both in vitro and in vivo through regulating expression of beta-catenin by reducing m6A levels in its mRNA transcripts and in turn increases DNA excision repair protein ERCC-1 (ERCC1) activity. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Cervical squamous cell carcinoma | ICD-11: 2E66.2 | ||
| Cell Process | RNA decay | |||
| In-vitro Model | C-33 A | Cervical squamous cell carcinoma | Homo sapiens | CVCL_1094 |
| SiHa | Cervical squamous cell carcinoma | Homo sapiens | CVCL_0032 | |
| In-vivo Model | Either SiHa cells or FTO overexpressed SiHa cells were injected subcutaneously into the right flanks of 4- to 6-week-old female athymic nude mice (CAS, Beijing, China). The mice were divided into four groups (N = 6). After transplantation, tumor size was measured by caliper every other day. Tumor volume was calculated using the formula: volume = (length × width2)/2. When the tumor volumes reached 50 mm3, the animals were treated with intraperitoneal injection of cisplatin (3 mg/kg) every other day for seven times and local irradiation of 8 Gy one time. | |||
Cervical intraepithelial neoplasia [ICD-11: 2E66]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | The mRNA level of FTO is elevated in cervical squamous cell carcinoma (CSCC) tissues when compared with respective adjacent normal tissues.FTO enhances the chemo-radiotherapy resistance both in vitro and in vivo through regulating expression of beta-catenin by reducing m6A levels in its mRNA transcripts and in turn increases DNA excision repair protein ERCC-1 (ERCC1) activity. | |||
| Responsed Disease | Cervical squamous cell carcinoma [ICD-11: 2E66.2] | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Target Regulation | Up regulation | |||
| Cell Process | RNA decay | |||
| In-vitro Model | C-33 A | Cervical squamous cell carcinoma | Homo sapiens | CVCL_1094 |
| SiHa | Cervical squamous cell carcinoma | Homo sapiens | CVCL_0032 | |
| In-vivo Model | Either SiHa cells or FTO overexpressed SiHa cells were injected subcutaneously into the right flanks of 4- to 6-week-old female athymic nude mice (CAS, Beijing, China). The mice were divided into four groups (N = 6). After transplantation, tumor size was measured by caliper every other day. Tumor volume was calculated using the formula: volume = (length × width2)/2. When the tumor volumes reached 50 mm3, the animals were treated with intraperitoneal injection of cisplatin (3 mg/kg) every other day for seven times and local irradiation of 8 Gy one time. | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00246)
| In total 8 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE009231 | Click to Show/Hide the Full List | ||
| mod site | chr19:45415842-45415843:- | [2] | |
| Sequence | ATGCCTGACCACCCCACTTTACAGTGAGGAAACAGGCCCAG | ||
| Transcript ID List | ENST00000589381.5; ENST00000591636.5; ENST00000423698.6; ENST00000589165.5; ENST00000592023.5; ENST00000592083.5; ENST00000340192.11; ENST00000592905.5; ENST00000592444.5; ENST00000590701.5; ENST00000013807.9; ENST00000300853.7; ENST00000587888.5 | ||
| External Link | RMBase: RNA-editing_site_71014 | ||
| mod ID: A2ISITE009232 | Click to Show/Hide the Full List | ||
| mod site | chr19:45417224-45417225:- | [2] | |
| Sequence | CTCAGCCACTGCTGGGTCCTAGCACTGCTTAGCACGGGCCA | ||
| Transcript ID List | ENST00000423698.6; ENST00000591636.5; ENST00000589165.5; ENST00000592023.5; ENST00000013807.9; ENST00000589381.5; ENST00000588300.1; ENST00000590701.5; ENST00000300853.7; ENST00000592083.5; ENST00000587888.5; ENST00000340192.11; ENST00000592905.5; rmsk_5010667 | ||
| External Link | RMBase: RNA-editing_site_71015 | ||
| mod ID: A2ISITE009233 | Click to Show/Hide the Full List | ||
| mod site | chr19:45442309-45442310:- | [3] | |
| Sequence | CTTTTTTTTTTTTTTGAGACAGGGTCTCTGTTGCCCACGCT | ||
| Transcript ID List | ENST00000423698.6; ENST00000592083.5 | ||
| External Link | RMBase: RNA-editing_site_71016 | ||
| mod ID: A2ISITE009234 | Click to Show/Hide the Full List | ||
| mod site | chr19:45445153-45445154:- | [3] | |
| Sequence | CGTGGAGGCACAGGCTTGTAATCCTAGCTACCTGGGAGGCT | ||
| Transcript ID List | ENST00000423698.6; rmsk_5010763; ENST00000592083.5 | ||
| External Link | RMBase: RNA-editing_site_71017 | ||
| mod ID: A2ISITE009235 | Click to Show/Hide the Full List | ||
| mod site | chr19:45445154-45445155:- | [3] | |
| Sequence | GCGTGGAGGCACAGGCTTGTAATCCTAGCTACCTGGGAGGC | ||
| Transcript ID List | rmsk_5010763; ENST00000592083.5; ENST00000423698.6 | ||
| External Link | RMBase: RNA-editing_site_71018 | ||
| mod ID: A2ISITE009236 | Click to Show/Hide the Full List | ||
| mod site | chr19:45445922-45445923:- | [3] | |
| Sequence | GCACTCCAGCTTGGGCAGCAAGAAAGAAACTCTGTCTCAAA | ||
| Transcript ID List | ENST00000592083.5; ENST00000423698.6; rmsk_5010765 | ||
| External Link | RMBase: RNA-editing_site_71019 | ||
| mod ID: A2ISITE009237 | Click to Show/Hide the Full List | ||
| mod site | chr19:45446085-45446086:- | [3] | |
| Sequence | CCAACATTGGGTTGAGTGAAACCTCATCTCTATAAAAATGC | ||
| Transcript ID List | rmsk_5010765; ENST00000423698.6; ENST00000592083.5 | ||
| External Link | RMBase: RNA-editing_site_71020 | ||
| mod ID: A2ISITE009238 | Click to Show/Hide the Full List | ||
| mod site | chr19:45447056-45447057:- | [2] | |
| Sequence | TGCCAACCTGCCTCTAAGCAAGTGTCCTGGGCCAGCATTCT | ||
| Transcript ID List | ENST00000592083.5; ENST00000423698.6 | ||
| External Link | RMBase: RNA-editing_site_71021 | ||
2'-O-Methylation (2'-O-Me)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: 2OMSITE000214 | Click to Show/Hide the Full List | ||
| mod site | chr19:45407841-45407842:- | [4] | |
| Sequence | GCTGGTCTTGAACTCCTGACCTCAAGTGATCTGCTCGCCTC | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | Nm-seq | ||
| Transcript ID List | ENST00000300853.7; ENST00000423698.6 | ||
| External Link | RMBase: Nm_site_2925 | ||
Other RNA modification (i6A)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: RNASITE000011 | Click to Show/Hide the Full List | ||
| mod site | chr19:45478648-45478649:- | [5] | |
| Sequence | GGTCTGGGGTGCAGGCTTCAAACCTGTAGCTGTCTAGCGAC | ||
| Cell/Tissue List | cytosolic | ||
| Transcript ID List | ENST00000423698.6; chr19.trna9; rmsk_5010859 | ||
| External Link | RMBase: otherMod_site_579 | ||
| mod ID: RNASITE000012 | Click to Show/Hide the Full List | ||
| mod site | chr19:45478651-45478652:- | [5] | |
| Sequence | AGTGGTCTGGGGTGCAGGCTTCAAACCTGTAGCTGTCTAGC | ||
| Cell/Tissue List | cytosolic | ||
| Transcript ID List | ENST00000423698.6; rmsk_5010859; chr19.trna9 | ||
| External Link | RMBase: otherMod_site_580 | ||
N1-methyladenosine (m1A)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: M1ASITE000070 | Click to Show/Hide the Full List | ||
| mod site | chr19:45478616-45478617:- | [6] | |
| Sequence | TCTAGCGACAGAGTGGTTCAATTCCACCTTTCGGGCGGTAG | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | m1A-MAP-seq; m1A-seq | ||
| Transcript ID List | rmsk_5010859; ENST00000423698.6; chr19.trna9 | ||
| External Link | RMBase: m1A_site_558 | ||
5-methylcytidine (m5C)
N6-methyladenosine (m6A)
| In total 63 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE041508 | Click to Show/Hide the Full List | ||
| mod site | chr19:45407623-45407624:- | [7] | |
| Sequence | AATATTTATGGCCATACAGAACATGTTCCACCAAGCCTGCA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000300853.7; ENST00000423698.6 | ||
| External Link | RMBase: m6A_site_443990 | ||
| mod ID: M6ASITE041509 | Click to Show/Hide the Full List | ||
| mod site | chr19:45408093-45408094:- | [7] | |
| Sequence | AGGGCAGAGGCTTAAGTGGAACAGGAGAGGGAAGGTTTTTT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; peripheral-blood; GSC-11; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000300853.7; ENST00000423698.6 | ||
| External Link | RMBase: m6A_site_443991 | ||
| mod ID: M6ASITE041510 | Click to Show/Hide the Full List | ||
| mod site | chr19:45408119-45408120:- | [7] | |
| Sequence | CATTGAAGCTACAGAGAGAAACAGGGAGGGCAGAGGCTTAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HepG2; peripheral-blood; GSC-11; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000300853.7; ENST00000423698.6 | ||
| External Link | RMBase: m6A_site_443992 | ||
| mod ID: M6ASITE041511 | Click to Show/Hide the Full List | ||
| mod site | chr19:45408212-45408213:- | [7] | |
| Sequence | CTTGGGGACAGCTGCTGAGGACTCGATAGCGGTGCCGCTTG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; H1A; H1B; A549; peripheral-blood; HEK293A-TOA; iSLK; TIME; TREX; MSC; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000423698.6; ENST00000300853.7 | ||
| External Link | RMBase: m6A_site_443993 | ||
| mod ID: M6ASITE041512 | Click to Show/Hide the Full List | ||
| mod site | chr19:45408225-45408226:- | [7] | |
| Sequence | GTCGCTTCTCCAGCTTGGGGACAGCTGCTGAGGACTCGATA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; H1A; H1B; A549; peripheral-blood; HEK293A-TOA; iSLK; TIME; TREX; MSC; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000423698.6; ENST00000300853.7 | ||
| External Link | RMBase: m6A_site_443994 | ||
| mod ID: M6ASITE041513 | Click to Show/Hide the Full List | ||
| mod site | chr19:45408327-45408328:- | [7] | |
| Sequence | CCTGACAGGGATTGCTGGGGACCCTCAAGGATCCTTAGGGT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; H1A; H1B; A549; H1299; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000300853.7; ENST00000423698.6 | ||
| External Link | RMBase: m6A_site_443996 | ||
| mod ID: M6ASITE041514 | Click to Show/Hide the Full List | ||
| mod site | chr19:45408375-45408376:- | [7] | |
| Sequence | GGAGGGATCTGTGGTGGGGGACTTGCTGGGATGGGCTGCAG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; H1A; H1B; A549; H1299; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000423698.6; ENST00000300853.7 | ||
| External Link | RMBase: m6A_site_443997 | ||
| mod ID: M6ASITE041515 | Click to Show/Hide the Full List | ||
| mod site | chr19:45408412-45408413:- | [7] | |
| Sequence | GTTGCCCCCAAAGGCACAGAACCGAGGCCTCAGGCCAGGAG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; H1A; A549; H1299; MM6; Huh7; peripheral-blood; iSLK; MSC; TIME; TREX; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000300853.7; ENST00000423698.6 | ||
| External Link | RMBase: m6A_site_443998 | ||
| mod ID: M6ASITE041516 | Click to Show/Hide the Full List | ||
| mod site | chr19:45408703-45408704:- | [7] | |
| Sequence | CTTCTTGGTGGTGGACGGGAACAGCACTCCCAGAGGCTCCA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; A549; HEK293T; U2OS; H1A; H1B; hESCs; H1299; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000423698.6; ENST00000300853.7 | ||
| External Link | RMBase: m6A_site_444003 | ||
| mod ID: M6ASITE041517 | Click to Show/Hide the Full List | ||
| mod site | chr19:45408815-45408816:- | [7] | |
| Sequence | TCTTTTTGGTCGGGGACAGGACTGTGTCTTCTAGAGGCTCA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; A549; H1299; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000300853.7; ENST00000423698.6 | ||
| External Link | RMBase: m6A_site_444009 | ||
| mod ID: M6ASITE041518 | Click to Show/Hide the Full List | ||
| mod site | chr19:45408820-45408821:- | [7] | |
| Sequence | CTTTCTCTTTTTGGTCGGGGACAGGACTGTGTCTTCTAGAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; A549; H1299; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000300853.7; ENST00000423698.6 | ||
| External Link | RMBase: m6A_site_444010 | ||
| mod ID: M6ASITE041519 | Click to Show/Hide the Full List | ||
| mod site | chr19:45408892-45408893:- | [7] | |
| Sequence | CACCTTCACCTGTGGCTGAGACTCAACTGTCACCCCCTCCT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; A549; H1299; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000300853.7; ENST00000423698.6 | ||
| External Link | RMBase: m6A_site_444011 | ||
| mod ID: M6ASITE041520 | Click to Show/Hide the Full List | ||
| mod site | chr19:45409042-45409043:- | [7] | |
| Sequence | CGCCATGGTCCCCCCTGGGGACTCCAGAGGCTTCATCTCCG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; A549; HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000300853.7; ENST00000423698.6 | ||
| External Link | RMBase: m6A_site_444013 | ||
| mod ID: M6ASITE041521 | Click to Show/Hide the Full List | ||
| mod site | chr19:45409435-45409436:- | [7] | |
| Sequence | TGTGGGAGCCTCCTCCCCAGACTCTGAATTCAGTGGCGGCC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000423698.6; ENST00000300853.7 | ||
| External Link | RMBase: m6A_site_444022 | ||
| mod ID: M6ASITE041522 | Click to Show/Hide the Full List | ||
| mod site | chr19:45409501-45409502:- | [7] | |
| Sequence | CCTCAGTTTCCCGGGGGCAGACTACACAGGCTGCTGCTGCT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000423698.6; ENST00000300853.7 | ||
| External Link | RMBase: m6A_site_444024 | ||
| mod ID: M6ASITE041523 | Click to Show/Hide the Full List | ||
| mod site | chr19:45409653-45409654:- | [7] | |
| Sequence | TGACCCCAGCTGCCAAGGAAACCCCCAGTGTAATAATAAAT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000300853.7; ENST00000423698.6; ENST00000340192.11; ENST00000590701.5; ENST00000588738.5; ENST00000591636.5 | ||
| External Link | RMBase: m6A_site_444031 | ||
| mod ID: M6ASITE041524 | Click to Show/Hide the Full List | ||
| mod site | chr19:45413131-45413132:- | [8] | |
| Sequence | GAAGCTCTCCAGGACATTGAACTGGGCAGAGATTTCTTGAG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000423698.6; ENST00000340192.11; ENST00000590701.5; ENST00000589165.5; rmsk_5010653; ENST00000588738.5; ENST00000300853.7; ENST00000591636.5 | ||
| External Link | RMBase: m6A_site_444038 | ||
| mod ID: M6ASITE041525 | Click to Show/Hide the Full List | ||
| mod site | chr19:45413444-45413445:- | [7] | |
| Sequence | TTTTACTAAAAATAAAAAAAACTAGCTGGGCATGGTGGTGT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; A549; HEK293T; H1A; H1B; hESCs; GM12878; LCLs; H1299; MM6; Huh7; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000423698.6; ENST00000590701.5; ENST00000592444.5; ENST00000592410.5; ENST00000013807.9; ENST00000588738.5; ENST00000340192.11; ENST00000591636.5; ENST00000589165.5; rmsk_5010654; ENST00000300853.7 | ||
| External Link | RMBase: m6A_site_444039 | ||
| mod ID: M6ASITE041526 | Click to Show/Hide the Full List | ||
| mod site | chr19:45413473-45413474:- | [7] | |
| Sequence | AGACCAGCCTGGGCAAGTGGACACCTCATTTTTACTAAAAA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; GM12878; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000591636.5; ENST00000588738.5; ENST00000300853.7; ENST00000340192.11; ENST00000589165.5; ENST00000590701.5; ENST00000013807.9; ENST00000423698.6; ENST00000592410.5; rmsk_5010654; ENST00000592444.5 | ||
| External Link | RMBase: m6A_site_444040 | ||
| mod ID: M6ASITE041527 | Click to Show/Hide the Full List | ||
| mod site | chr19:45413491-45413492:- | [7] | |
| Sequence | CTTGAGGCCAGAAGTTGGAGACCAGCCTGGGCAAGTGGACA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; GM12878; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000591636.5; ENST00000423698.6; ENST00000590701.5; ENST00000588738.5; ENST00000300853.7; rmsk_5010654; ENST00000592410.5; ENST00000340192.11; ENST00000589165.5; ENST00000592444.5; ENST00000013807.9 | ||
| External Link | RMBase: m6A_site_444041 | ||
| mod ID: M6ASITE041528 | Click to Show/Hide the Full List | ||
| mod site | chr19:45413515-45413516:- | [7] | |
| Sequence | TGGGAGGCCAAGGCGGGAGGACTGCTTGAGGCCAGAAGTTG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; GM12878; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; MSC; TIME; TREX; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000590701.5; ENST00000300853.7; ENST00000588738.5; ENST00000340192.11; ENST00000423698.6; ENST00000591636.5; ENST00000592444.5; ENST00000589165.5; rmsk_5010654; ENST00000592410.5; ENST00000013807.9 | ||
| External Link | RMBase: m6A_site_444042 | ||
| mod ID: M6ASITE041529 | Click to Show/Hide the Full List | ||
| mod site | chr19:45413568-45413569:- | [7] | |
| Sequence | AAAAAAGAACCAAAGACCAGACACAGTGGCTTCCGCCTGTA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; hESC-HEK293T; H1A; H1B; hNPCs; hESCs; fibroblasts; MT4; H1299; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000588738.5; ENST00000300853.7; ENST00000589165.5; ENST00000592444.5; ENST00000423698.6; ENST00000591636.5; ENST00000590701.5; rmsk_5010654; ENST00000340192.11; ENST00000592410.5; ENST00000013807.9 | ||
| External Link | RMBase: m6A_site_444043 | ||
| mod ID: M6ASITE041530 | Click to Show/Hide the Full List | ||
| mod site | chr19:45413573-45413574:- | [7] | |
| Sequence | AGGTGAAAAAAGAACCAAAGACCAGACACAGTGGCTTCCGC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; MT4; H1299; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000300853.7; ENST00000340192.11; ENST00000423698.6; rmsk_5010654; ENST00000590701.5; ENST00000591636.5; ENST00000592410.5; ENST00000013807.9; ENST00000589165.5; ENST00000588738.5; ENST00000592444.5 | ||
| External Link | RMBase: m6A_site_444044 | ||
| mod ID: M6ASITE041531 | Click to Show/Hide the Full List | ||
| mod site | chr19:45413580-45413581:- | [7] | |
| Sequence | AGTTTTAAGGTGAAAAAAGAACCAAAGACCAGACACAGTGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; MT4; H1299; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000590701.5; ENST00000013807.9; ENST00000589165.5; ENST00000588738.5; ENST00000300853.7; ENST00000592444.5; ENST00000340192.11; ENST00000592410.5; ENST00000423698.6; ENST00000591636.5 | ||
| External Link | RMBase: m6A_site_444045 | ||
| mod ID: M6ASITE041532 | Click to Show/Hide the Full List | ||
| mod site | chr19:45413607-45413608:- | [7] | |
| Sequence | CCAAATAAACACAACCTGAGACCCCAAAGTTTTAAGGTGAA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; hESCs; fibroblasts; MT4; H1299; MM6; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000589165.5; ENST00000590701.5; ENST00000592444.5; ENST00000300853.7; ENST00000340192.11; ENST00000423698.6; ENST00000591636.5; ENST00000592410.5; ENST00000588738.5; ENST00000013807.9 | ||
| External Link | RMBase: m6A_site_444046 | ||
| mod ID: M6ASITE041533 | Click to Show/Hide the Full List | ||
| mod site | chr19:45413619-45413620:- | [9] | |
| Sequence | AAGGAGAGAGCCCCAAATAAACACAACCTGAGACCCCAAAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T; A549; MT4; H1299; MM6; HEK293A-TOA; endometrial | ||
| Seq Type List | MeRIP-seq; MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000588738.5; ENST00000340192.11; ENST00000592410.5; ENST00000423698.6; ENST00000591636.5; ENST00000592444.5; ENST00000589165.5; ENST00000590701.5; ENST00000013807.9; ENST00000300853.7 | ||
| External Link | RMBase: m6A_site_444047 | ||
| mod ID: M6ASITE041534 | Click to Show/Hide the Full List | ||
| mod site | chr19:45413656-45413657:- | [10] | |
| Sequence | AGTAAGAGCTCTGGGAAAGAACCCAAGGAGTTGGGGGAAGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HEK293T; MT4; MM6; endometrial | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000589165.5; ENST00000592410.5; ENST00000590701.5; ENST00000423698.6; ENST00000300853.7; ENST00000591636.5; ENST00000588738.5; ENST00000340192.11; ENST00000013807.9; ENST00000592444.5 | ||
| External Link | RMBase: m6A_site_444048 | ||
| mod ID: M6ASITE041535 | Click to Show/Hide the Full List | ||
| mod site | chr19:45413736-45413737:- | [11] | |
| Sequence | TTCACCTTTCAGTCTCTGGAACAGCTCATCGCCGCATCAAG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000587888.5; ENST00000590701.5; ENST00000340192.11; ENST00000591636.5; ENST00000592410.5; ENST00000588738.5; ENST00000592444.5; ENST00000589381.5; ENST00000300853.7; ENST00000589165.5; ENST00000013807.9; ENST00000423698.6 | ||
| External Link | RMBase: m6A_site_444049 | ||
| mod ID: M6ASITE041536 | Click to Show/Hide the Full List | ||
| mod site | chr19:45413982-45413983:- | [12] | |
| Sequence | TCAACAAAACGGACAGTCAGACCCTCCTGACCACATTTGGA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HepG2; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000591636.5; ENST00000589165.5; ENST00000423698.6; ENST00000589381.5; ENST00000592083.5; ENST00000590701.5; ENST00000587888.5; ENST00000588738.5; ENST00000340192.11; ENST00000592444.5; ENST00000300853.7; ENST00000013807.9; ENST00000592410.5 | ||
| External Link | RMBase: m6A_site_444050 | ||
| mod ID: M6ASITE041537 | Click to Show/Hide the Full List | ||
| mod site | chr19:45413990-45413991:- | [12] | |
| Sequence | GAAGTCAGTCAACAAAACGGACAGTCAGACCCTCCTGACCA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HepG2; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000587888.5; ENST00000590701.5; ENST00000592410.5; ENST00000340192.11; ENST00000013807.9; ENST00000300853.7; ENST00000592444.5; ENST00000592083.5; ENST00000591636.5; ENST00000588738.5; ENST00000589165.5; ENST00000423698.6; ENST00000589381.5 | ||
| External Link | RMBase: m6A_site_444051 | ||
| mod ID: M6ASITE041538 | Click to Show/Hide the Full List | ||
| mod site | chr19:45413999-45414000:- | [9] | |
| Sequence | GACCACCGTGAAGTCAGTCAACAAAACGGACAGTCAGACCC | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000592444.5; ENST00000340192.11; ENST00000590701.5; ENST00000591636.5; ENST00000592410.5; ENST00000592083.5; ENST00000587888.5; ENST00000013807.9; ENST00000588738.5; ENST00000589381.5; ENST00000300853.7; ENST00000589165.5; ENST00000423698.6 | ||
| External Link | RMBase: m6A_site_444052 | ||
| mod ID: M6ASITE041539 | Click to Show/Hide the Full List | ||
| mod site | chr19:45414357-45414358:- | [11] | |
| Sequence | GAGCCTCCTGAGTAGCTGGGACTACAGGTGCCCACAACCAT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000592410.5; ENST00000423698.6; ENST00000589165.5; ENST00000592444.5; ENST00000340192.11; ENST00000013807.9; ENST00000590701.5; ENST00000592083.5; ENST00000300853.7; ENST00000587888.5; ENST00000589381.5; ENST00000591636.5; ENST00000588738.5 | ||
| External Link | RMBase: m6A_site_444053 | ||
| mod ID: M6ASITE041540 | Click to Show/Hide the Full List | ||
| mod site | chr19:45414873-45414874:- | [7] | |
| Sequence | GATGGAGAAGCTAGAGCAGGACTTCGTCTCCCGGGTGAGGC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000589165.5; ENST00000592905.5; ENST00000592023.5; ENST00000592444.5; ENST00000589381.5; ENST00000340192.11; ENST00000423698.6; ENST00000590701.5; ENST00000300853.7; ENST00000587888.5; ENST00000013807.9; ENST00000591636.5; ENST00000592083.5 | ||
| External Link | RMBase: m6A_site_444054 | ||
| mod ID: M6ASITE041541 | Click to Show/Hide the Full List | ||
| mod site | chr19:45414900-45414901:- | [7] | |
| Sequence | CTATGAGCAGAAACCAGCGGACCTCCTGATGGAGAAGCTAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000589165.5; ENST00000589381.5; ENST00000340192.11; ENST00000592444.5; ENST00000587888.5; ENST00000590701.5; ENST00000300853.7; ENST00000592083.5; ENST00000592905.5; ENST00000591636.5; ENST00000013807.9; ENST00000423698.6; ENST00000592023.5 | ||
| External Link | RMBase: m6A_site_444055 | ||
| mod ID: M6ASITE041542 | Click to Show/Hide the Full List | ||
| mod site | chr19:45414908-45414909:- | [7] | |
| Sequence | TACAAGGCCTATGAGCAGAAACCAGCGGACCTCCTGATGGA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000589165.5; ENST00000423698.6; ENST00000590701.5; ENST00000592023.5; ENST00000592444.5; ENST00000592905.5; ENST00000340192.11; ENST00000013807.9; ENST00000589381.5; ENST00000300853.7; ENST00000587888.5; ENST00000592083.5; ENST00000591636.5 | ||
| External Link | RMBase: m6A_site_444056 | ||
| mod ID: M6ASITE041543 | Click to Show/Hide the Full List | ||
| mod site | chr19:45414927-45414928:- | [9] | |
| Sequence | TGGGCGGTACCTGGAGACCTACAAGGCCTATGAGCAGAAAC | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000589381.5; ENST00000591636.5; ENST00000300853.7; ENST00000340192.11; ENST00000592444.5; ENST00000592023.5; ENST00000013807.9; ENST00000589165.5; ENST00000590701.5; ENST00000587888.5; ENST00000423698.6; ENST00000592083.5; ENST00000592905.5 | ||
| External Link | RMBase: m6A_site_444057 | ||
| mod ID: M6ASITE041544 | Click to Show/Hide the Full List | ||
| mod site | chr19:45414931-45414932:- | [7] | |
| Sequence | AAGCTGGGCGGTACCTGGAGACCTACAAGGCCTATGAGCAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000592083.5; ENST00000587888.5; ENST00000300853.7; ENST00000013807.9; ENST00000592905.5; ENST00000590701.5; ENST00000340192.11; ENST00000591636.5; ENST00000423698.6; ENST00000592023.5; ENST00000589381.5; ENST00000589165.5; ENST00000592444.5 | ||
| External Link | RMBase: m6A_site_444058 | ||
| mod ID: M6ASITE041545 | Click to Show/Hide the Full List | ||
| mod site | chr19:45416839-45416840:- | [9] | |
| Sequence | TGTGTATCCTGGCCGACTGCACATTGATCCTCGCCTGGAGG | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000589381.5; ENST00000013807.9; ENST00000592905.5; ENST00000590701.5; ENST00000592444.5; ENST00000592083.5; ENST00000591636.5; ENST00000300853.7; ENST00000588300.1; ENST00000423698.6; ENST00000587888.5; ENST00000592023.5; ENST00000340192.11; ENST00000589165.5 | ||
| External Link | RMBase: m6A_site_444059 | ||
| mod ID: M6ASITE041546 | Click to Show/Hide the Full List | ||
| mod site | chr19:45419134-45419135:- | [13] | |
| Sequence | GCTGCAGAGCCTGGGGAAGAACTTCGCCTTGCGGGTCCTGC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000340192.11; ENST00000590701.5; ENST00000589381.5; ENST00000588300.1; ENST00000591636.5; ENST00000587888.5; ENST00000592905.5; ENST00000300853.7; ENST00000592023.5; ENST00000423698.6; ENST00000589165.5; ENST00000013807.9; ENST00000592083.5 | ||
| External Link | RMBase: m6A_site_444060 | ||
| mod ID: M6ASITE041547 | Click to Show/Hide the Full List | ||
| mod site | chr19:45419167-45419168:- | [14] | |
| Sequence | CCACAACCTGCACCCAGACTACATCCATGGGCGGCTGCAGA | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | brain; kidney; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000300853.7; ENST00000589165.5; ENST00000592023.5; ENST00000588300.1; ENST00000592083.5; ENST00000340192.11; ENST00000423698.6; ENST00000589381.5; ENST00000587888.5; ENST00000013807.9; ENST00000590701.5; ENST00000591636.5; ENST00000592905.5 | ||
| External Link | RMBase: m6A_site_444061 | ||
| mod ID: M6ASITE041548 | Click to Show/Hide the Full List | ||
| mod site | chr19:45419170-45419171:- | [13] | |
| Sequence | CTACCACAACCTGCACCCAGACTACATCCATGGGCGGCTGC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000592023.5; ENST00000013807.9; ENST00000587888.5; ENST00000589381.5; ENST00000588300.1; ENST00000591636.5; ENST00000590701.5; ENST00000589165.5; ENST00000423698.6; ENST00000592905.5; ENST00000300853.7; ENST00000592083.5; ENST00000340192.11 | ||
| External Link | RMBase: m6A_site_444062 | ||
| mod ID: M6ASITE041549 | Click to Show/Hide the Full List | ||
| mod site | chr19:45419185-45419186:- | [9] | |
| Sequence | CCCCACCAGCCTCCGCTACCACAACCTGCACCCAGACTACA | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000592023.5; ENST00000590701.5; ENST00000592083.5; ENST00000423698.6; ENST00000591636.5; ENST00000013807.9; ENST00000300853.7; ENST00000340192.11; ENST00000587888.5; ENST00000588300.1; ENST00000592905.5; ENST00000589381.5; ENST00000589165.5 | ||
| External Link | RMBase: m6A_site_444063 | ||
| mod ID: M6ASITE041550 | Click to Show/Hide the Full List | ||
| mod site | chr19:45421219-45421220:- | [15] | |
| Sequence | ACGCCCAACCAGGCCCTGAAACCCGGGGCAAAATCCAACAG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000592083.5; ENST00000423698.6; ENST00000591636.5; ENST00000013807.9; ENST00000340192.11; ENST00000592023.5; ENST00000592905.5; ENST00000589214.1; ENST00000589381.5; ENST00000300853.7; ENST00000589165.5; ENST00000588300.1 | ||
| External Link | RMBase: m6A_site_444064 | ||
| mod ID: M6ASITE041551 | Click to Show/Hide the Full List | ||
| mod site | chr19:45421323-45421324:- | [15] | |
| Sequence | CGGCCCAGGCGGCCCCTCAGACCTACGCCGAATATGCCATC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000592023.5; ENST00000592083.5; ENST00000589381.5; ENST00000588300.1; ENST00000340192.11; ENST00000592905.5; ENST00000589165.5; ENST00000591636.5; ENST00000589214.1; ENST00000300853.7; ENST00000013807.9; ENST00000423698.6 | ||
| External Link | RMBase: m6A_site_444065 | ||
| mod ID: M6ASITE041552 | Click to Show/Hide the Full List | ||
| mod site | chr19:45421349-45421350:- | [9] | |
| Sequence | ACAGAGCCTTCCCACTGTGGACACCTCGGCCCAGGCGGCCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hESC-HEK293T; peripheral-blood; endometrial | ||
| Seq Type List | MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000589381.5; ENST00000591636.5; ENST00000589165.5; ENST00000423698.6; ENST00000300853.7; ENST00000592083.5; ENST00000592905.5; ENST00000340192.11; ENST00000589214.1; ENST00000013807.9; ENST00000588300.1; ENST00000592023.5 | ||
| External Link | RMBase: m6A_site_444066 | ||
| mod ID: M6ASITE041553 | Click to Show/Hide the Full List | ||
| mod site | chr19:45421371-45421372:- | [9] | |
| Sequence | CCAAGCCCTTATTCCGATCTACACAGAGCCTTCCCACTGTG | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000340192.11; ENST00000592023.5; ENST00000589165.5; ENST00000013807.9; ENST00000588300.1; ENST00000592083.5; ENST00000423698.6; ENST00000589381.5; ENST00000300853.7; ENST00000591636.5; ENST00000592905.5; ENST00000589214.1 | ||
| External Link | RMBase: m6A_site_444067 | ||
| mod ID: M6ASITE041554 | Click to Show/Hide the Full List | ||
| mod site | chr19:45423357-45423358:- | [7] | |
| Sequence | CCAGATGGACCCTGGGAAGGACAAAGAGGGGGTGCCCCAGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; hESC-HEK293T; MM6; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000592083.5; ENST00000591636.5; ENST00000588300.1; ENST00000589381.5; ENST00000592023.5; ENST00000589214.1; ENST00000340192.11; ENST00000300853.7; ENST00000589165.5; ENST00000423698.6; ENST00000013807.9; ENST00000592905.5 | ||
| External Link | RMBase: m6A_site_444068 | ||
| mod ID: M6ASITE041555 | Click to Show/Hide the Full List | ||
| mod site | chr19:45423369-45423370:- | [7] | |
| Sequence | CCCTTTCAGGCTCCAGATGGACCCTGGGAAGGACAAAGAGG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; MM6; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000591636.5; ENST00000592023.5; ENST00000588300.1; ENST00000340192.11; ENST00000589214.1; ENST00000592083.5; ENST00000589165.5; ENST00000300853.7; ENST00000589381.5; ENST00000423698.6; ENST00000013807.9; ENST00000592905.5 | ||
| External Link | RMBase: m6A_site_444069 | ||
| mod ID: M6ASITE041556 | Click to Show/Hide the Full List | ||
| mod site | chr19:45423499-45423500:- | [7] | |
| Sequence | TCTAGCGCTGGGTGTTGGGGACCTGACGCTATGGAGCTCTC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; H1B; MM6; GSC-11; MSC; iSLK; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000592023.5; ENST00000340192.11; ENST00000591636.5; ENST00000300853.7; ENST00000589165.5; ENST00000013807.9; ENST00000589214.1; ENST00000588300.1; ENST00000592905.5; ENST00000592083.5; ENST00000423698.6 | ||
| External Link | RMBase: m6A_site_444070 | ||
| mod ID: M6ASITE041557 | Click to Show/Hide the Full List | ||
| mod site | chr19:45423579-45423580:- | [7] | |
| Sequence | CGGAGCGATGGGACTTGTGGACCTGTAAGGGGCGGGGCGAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; A549; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000589165.5; ENST00000588300.1; ENST00000300853.7; ENST00000340192.11; ENST00000592023.5; ENST00000592083.5; ENST00000592905.5; ENST00000423698.6; ENST00000589214.1 | ||
| External Link | RMBase: m6A_site_444071 | ||
| mod ID: M6ASITE041558 | Click to Show/Hide the Full List | ||
| mod site | chr19:45423587-45423588:- | [7] | |
| Sequence | GCGAGGGGCGGAGCGATGGGACTTGTGGACCTGTAAGGGGC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; A549; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000592023.5; ENST00000589214.1; ENST00000592905.5; ENST00000592083.5; ENST00000588300.1; ENST00000340192.11; ENST00000423698.6; ENST00000589165.5; ENST00000300853.7 | ||
| External Link | RMBase: m6A_site_444072 | ||
| mod ID: M6ASITE041559 | Click to Show/Hide the Full List | ||
| mod site | chr19:45423786-45423787:- | [7] | |
| Sequence | GCTGAAACCGTGAGGCCCGGACCACAGGTGCGGGAGGCGGA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; A549; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000592905.5; ENST00000423698.6; ENST00000588300.1; ENST00000589214.1; ENST00000592083.5; ENST00000589165.5; ENST00000340192.11; ENST00000300853.7 | ||
| External Link | RMBase: m6A_site_444073 | ||
| mod ID: M6ASITE041560 | Click to Show/Hide the Full List | ||
| mod site | chr19:45423800-45423801:- | [7] | |
| Sequence | TGAGGCCTCGCGGCGCTGAAACCGTGAGGCCCGGACCACAG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; A549; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000592083.5; ENST00000300853.7; ENST00000340192.11; ENST00000423698.6; ENST00000589214.1; ENST00000589165.5; ENST00000588300.1; ENST00000592905.5 | ||
| External Link | RMBase: m6A_site_444074 | ||
| mod ID: M6ASITE041561 | Click to Show/Hide the Full List | ||
| mod site | chr19:45423829-45423830:- | [7] | |
| Sequence | CTTTCCCTTGAGGCTCCAAGACCAGCAGGTGAGGCCTCGCG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; A549; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000423698.6; ENST00000592905.5; ENST00000300853.7; ENST00000592083.5; ENST00000589165.5; ENST00000589214.1; ENST00000340192.11; ENST00000588300.1 | ||
| External Link | RMBase: m6A_site_444075 | ||
| mod ID: M6ASITE041562 | Click to Show/Hide the Full List | ||
| mod site | chr19:45423987-45423988:- | [7] | |
| Sequence | GACCTCCGCGGTCCTCCAGAACCATAGAGAGTTGTACAGAG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; A549 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000589165.5; ENST00000423698.6; ENST00000589214.1; ENST00000592083.5; ENST00000300853.7 | ||
| External Link | RMBase: m6A_site_444076 | ||
| mod ID: M6ASITE041563 | Click to Show/Hide the Full List | ||
| mod site | chr19:45424171-45424172:- | [16] | |
| Sequence | AATGTCTGAGTTGGATTCAAACTTAAGTCTCTCCTTACTGA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | MSC; TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000589165.5; ENST00000423698.6; ENST00000589214.1; ENST00000592083.5; ENST00000300853.7 | ||
| External Link | RMBase: m6A_site_444077 | ||
| mod ID: M6ASITE041564 | Click to Show/Hide the Full List | ||
| mod site | chr19:45424205-45424206:- | [16] | |
| Sequence | ATAAATGAATGAATGAGGAAACTGAAGCCAAGTCAATGTCT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | MSC; TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000589165.5; ENST00000589214.1; ENST00000592083.5; ENST00000300853.7; ENST00000423698.6 | ||
| External Link | RMBase: m6A_site_444078 | ||
| mod ID: M6ASITE041565 | Click to Show/Hide the Full List | ||
| mod site | chr19:45424265-45424266:- | [16] | |
| Sequence | CCAGCACGGACTCGCACAGGACCGGGAAGAGAGGAAGCGCG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | MSC; TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | rmsk_5010687; ENST00000592083.5; ENST00000300853.7; ENST00000589165.5; ENST00000423698.6; ENST00000589214.1 | ||
| External Link | RMBase: m6A_site_444079 | ||
| mod ID: M6ASITE041566 | Click to Show/Hide the Full List | ||
| mod site | chr19:45424276-45424277:- | [16] | |
| Sequence | CTGCTGTGTCACCAGCACGGACTCGCACAGGACCGGGAAGA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | MSC; TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000592083.5; ENST00000589214.1; ENST00000300853.7; ENST00000589165.5; ENST00000423698.6; rmsk_5010687 | ||
| External Link | RMBase: m6A_site_444080 | ||
| mod ID: M6ASITE041567 | Click to Show/Hide the Full List | ||
| mod site | chr19:45424320-45424321:- | [16] | |
| Sequence | GAACCGTAAGCTCCGGGAGGACAACACGGGGCTGTCGTTGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | MSC; TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000589165.5; ENST00000589214.1; rmsk_5010687; ENST00000423698.6; ENST00000592083.5; ENST00000300853.7 | ||
| External Link | RMBase: m6A_site_444081 | ||
| mod ID: M6ASITE041568 | Click to Show/Hide the Full List | ||
| mod site | chr19:45424338-45424339:- | [16] | |
| Sequence | GTGTCTGTGTCCCTTACTGAACCGTAAGCTCCGGGAGGACA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | MSC; TIME | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | rmsk_5010687; ENST00000589165.5; ENST00000592083.5; ENST00000589214.1; ENST00000423698.6; ENST00000300853.7 | ||
| External Link | RMBase: m6A_site_444082 | ||
| mod ID: M6ASITE041569 | Click to Show/Hide the Full List | ||
| mod site | chr19:45478629-45478630:- | [9] | |
| Sequence | AAACCTGTAGCTGTCTAGCGACAGAGTGGTTCAATTCCACC | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T; CD8T | ||
| Seq Type List | MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000423698.6; rmsk_5010859; chr19.trna9 | ||
| External Link | RMBase: m6A_site_444135 | ||
| mod ID: M6ASITE041570 | Click to Show/Hide the Full List | ||
| mod site | chr19:45478647-45478648:- | [17] | |
| Sequence | GTCTGGGGTGCAGGCTTCAAACCTGTAGCTGTCTAGCGACA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | AML | ||
| Seq Type List | miCLIP | ||
| Transcript ID List | rmsk_5010859; ENST00000423698.6; chr19.trna9 | ||
| External Link | RMBase: m6A_site_444136 | ||
Pseudouridine (Pseudo)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: PSESITE000129 | Click to Show/Hide the Full List | ||
| mod site | chr19:45478619-45478620:- | [18] | |
| Sequence | CTGTCTAGCGACAGAGTGGTTCAATTCCACCTTTCGGGCGG | ||
| Transcript ID List | ENST00000423698.6; rmsk_5010859; chr19.trna9 | ||
| External Link | RMBase: Pseudo_site_2510 | ||
References