m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00241)

Target Name	ELAV-like protein 1 (HuR/ELAVL1)
Synonyms	Hu-antigen R; HuR; HUR Click to Show/Hide
Gene Name	ELAVL1
Chromosomal Location	19p13.2
Family	RRM elav family
Function	RNA-binding protein that binds to the 3'-UTR region of mRNAs and increases their stability. Involved in embryonic stem cells (ESCs) differentiation: preferentially binds mRNAs that are not methylated by N6-methyladenosine (m6A), stabilizing them, promoting ESCs differentiation (By similarity). Binds to poly-U elements and AU-rich elements (AREs) in the 3'-UTR of target mRNAs. Binds avidly to the AU-rich element in FOS and IL3/interleukin-3 mRNAs. In the case of the FOS AU-rich element, binds to a core element of 27 nucleotides that contain AUUUA, AUUUUA, and AUUUUUA motifs. Binds preferentially to the 5'-UUUU[AG]UUU-3' motif in vitro. With ZNF385A, binds the 3'-UTR of p53/TP53 mRNA to control their nuclear export induced by CDKN2A. Hence, may regulate p53/TP53 expression and mediate in part the CDKN2A anti-proliferative activity. May also bind with ZNF385A the CCNB1 mRNA (By similarity). Increases the stability of the leptin mRNA harboring an AU-rich element (ARE) in its 3' UTR. Click to Show/Hide
Gene ID	1994
Uniprot ID	ELAV1_HUMAN
HGNC ID	HGNC:3312
KEGG ID	hsa:1994

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ELAVL1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	Neural progenitor cell line	Mus musculus
Treatment: METTL14 knockout NPCs Control: Wild type NPCs		GSE158985
Regulation		logFC: 8.91E-01 p-value: 1.25E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL14 and ALKBH5 determine the m6A status of target genes by controlling each other's expression and by inhibiting m6A reader YTHDF3 (YTH N 6-methyladenosine RNA binding protein 3), which blocks RNA demethylase activity. ALKBH5/METTL14 constitute a positive feedback loop with RNA stability factor ELAV-like protein 1 (HuR/ELAVL1) to regulate the stability of target transcripts. This study unveils a previously undefined role for m6A in cancer and shows that the collaboration among writers-erasers-readers sets up the m6A threshold to ensure the stability of progrowth/proliferation-specific genes, and protumorigenic stimulus.
Target Regulation	Up regulation
Responsed Disease	Solid tumour/cancer		ICD-11: 2A00-2F9Z	Disease Info
Cell Process	RNA stability
Cell Process	Cell apoptosis
In-vitro Model	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
In-vivo Model	For tumor xenograft studies, MDA-MB-231 cells transfected with scrambled-siRNA or METTL14-siRNA or ALKBH5-siRNA (2 × 10⁶) were mixed with Matrigel and injected subcutaneously in the flank of 6-week-old female athymic nude mice.

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Embryonic stem cells	Mus musculus
Treatment: METTL3 knockout ESCs Control: Wild type ESCs		GSE146466
Regulation		logFC: 6.09E-01 p-value: 1.50E-08
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	m6A modification levels were markedly upregulated in human PCa tissues due to increased expression of METTL3. METTL3 mediates m6A modification of USP4 mRNA at A2696, and m6A reader protein YTHDF2 binds to and induces degradation of USP4 mRNA by recruiting RNA-binding protein HNRNPD to the mRNA. Decrease of USP4 fails to remove the ubiquitin group from ELAVL1 protein, resulting in a reduction of ELAVL1 protein. Lastly, downregulation of ELAV-like protein 1 (HuR/ELAVL1) in turn increases ARHGDIA expression, promoting migration and invasion of PCa cells.
Target Regulation	Down regulation
Responsed Disease	Prostate cancer		ICD-11: 2C82	Disease Info
In-vitro Model	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	LNCaP	Prostate carcinoma	Homo sapiens	CVCL_0395
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
In-vivo Model	A total of 1 × 10⁶ PC3 cells or DU145 cells suspended in a mixture of 100 uL PBS and Matrigel were subcutaneously injected into BALB/c nude mice. Tumor weight were measured 2 months after the engraftment. To evaluate the role of METTL3 in tumor metastasis, PC3 cells with or without knockdown of METTL3 were injected into SCID mice through the tail vein (1 × 10⁶ cells per mouse). After eight weeks, mice were sacrificed and their lung tissues were collected for subsequent analyses.

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL14 and ALKBH5 determine the m6A status of target genes by controlling each other's expression and by inhibiting m6A reader YTHDF3 (YTH N 6-methyladenosine RNA binding protein 3), which blocks RNA demethylase activity. ALKBH5/METTL14 constitute a positive feedback loop with RNA stability factor ELAV-like protein 1 (HuR/ELAVL1) to regulate the stability of target transcripts. This study unveils a previously undefined role for m6A in cancer and shows that the collaboration among writers-erasers-readers sets up the m6A threshold to ensure the stability of progrowth/proliferation-specific genes, and protumorigenic stimulus.
Target Regulation	Up regulation
Responsed Disease	Solid tumour/cancer		ICD-11: 2A00-2F9Z	Disease Info
Cell Process	RNA stability
Cell Process	Cell apoptosis
In-vitro Model	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
In-vivo Model	For tumor xenograft studies, MDA-MB-231 cells transfected with scrambled-siRNA or METTL14-siRNA or ALKBH5-siRNA (2 × 10⁶) were mixed with Matrigel and injected subcutaneously in the flank of 6-week-old female athymic nude mice.

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	m6A modification levels were markedly upregulated in human PCa tissues due to increased expression of METTL3. METTL3 mediates m6A modification of USP4 mRNA at A2696, and m6A reader protein YTHDF2 binds to and induces degradation of USP4 mRNA by recruiting RNA-binding protein HNRNPD to the mRNA. Decrease of USP4 fails to remove the ubiquitin group from ELAV-like protein 1 (HuR/ELAVL1) protein, resulting in a reduction of ELAVL1 protein. Lastly, downregulation of ELAVL1 in turn increases ARHGDIA expression, promoting migration and invasion of PCa cells.
Target Regulation	Down regulation
Responsed Disease	Prostate cancer		ICD-11: 2C82	Disease Info
In-vitro Model	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	LNCaP	Prostate carcinoma	Homo sapiens	CVCL_0395
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
In-vivo Model	A total of 1 × 10⁶ PC3 cells or DU145 cells suspended in a mixture of 100 uL PBS and Matrigel were subcutaneously injected into BALB/c nude mice. Tumor weight were measured 2 months after the engraftment. To evaluate the role of METTL3 in tumor metastasis, PC3 cells with or without knockdown of METTL3 were injected into SCID mice through the tail vein (1 × 10⁶ cells per mouse). After eight weeks, mice were sacrificed and their lung tissues were collected for subsequent analyses.

Solid tumour/cancer [ICD-11: 2A00-2F9Z]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL14 and ALKBH5 determine the m6A status of target genes by controlling each other's expression and by inhibiting m6A reader YTHDF3 (YTH N 6-methyladenosine RNA binding protein 3), which blocks RNA demethylase activity. ALKBH5/METTL14 constitute a positive feedback loop with RNA stability factor ELAV-like protein 1 (HuR/ELAVL1) to regulate the stability of target transcripts. This study unveils a previously undefined role for m6A in cancer and shows that the collaboration among writers-erasers-readers sets up the m6A threshold to ensure the stability of progrowth/proliferation-specific genes, and protumorigenic stimulus.
Responsed Disease	Solid tumour/cancer [ICD-11: 2A00-2F9Z]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	RNA stability
Cell Process	Cell apoptosis
In-vitro Model	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
In-vivo Model	For tumor xenograft studies, MDA-MB-231 cells transfected with scrambled-siRNA or METTL14-siRNA or ALKBH5-siRNA (2 × 10⁶) were mixed with Matrigel and injected subcutaneously in the flank of 6-week-old female athymic nude mice.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL14 and ALKBH5 determine the m6A status of target genes by controlling each other's expression and by inhibiting m6A reader YTHDF3 (YTH N 6-methyladenosine RNA binding protein 3), which blocks RNA demethylase activity. ALKBH5/METTL14 constitute a positive feedback loop with RNA stability factor ELAV-like protein 1 (HuR/ELAVL1) to regulate the stability of target transcripts. This study unveils a previously undefined role for m6A in cancer and shows that the collaboration among writers-erasers-readers sets up the m6A threshold to ensure the stability of progrowth/proliferation-specific genes, and protumorigenic stimulus.
Responsed Disease	Solid tumour/cancer [ICD-11: 2A00-2F9Z]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Cell Process	RNA stability
Cell Process	Cell apoptosis
In-vitro Model	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-MB-468	Breast adenocarcinoma	Homo sapiens	CVCL_0419
In-vivo Model	For tumor xenograft studies, MDA-MB-231 cells transfected with scrambled-siRNA or METTL14-siRNA or ALKBH5-siRNA (2 × 10⁶) were mixed with Matrigel and injected subcutaneously in the flank of 6-week-old female athymic nude mice.

Prostate cancer [ICD-11: 2C82]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	m6A modification levels were markedly upregulated in human PCa tissues due to increased expression of METTL3. METTL3 mediates m6A modification of USP4 mRNA at A2696, and m6A reader protein YTHDF2 binds to and induces degradation of USP4 mRNA by recruiting RNA-binding protein HNRNPD to the mRNA. Decrease of USP4 fails to remove the ubiquitin group from ELAVL1 protein, resulting in a reduction of ELAVL1 protein. Lastly, downregulation of ELAV-like protein 1 (HuR/ELAVL1) in turn increases ARHGDIA expression, promoting migration and invasion of PCa cells.
Responsed Disease	Prostate cancer [ICD-11: 2C82]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	LNCaP	Prostate carcinoma	Homo sapiens	CVCL_0395
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
In-vivo Model	A total of 1 × 10⁶ PC3 cells or DU145 cells suspended in a mixture of 100 uL PBS and Matrigel were subcutaneously injected into BALB/c nude mice. Tumor weight were measured 2 months after the engraftment. To evaluate the role of METTL3 in tumor metastasis, PC3 cells with or without knockdown of METTL3 were injected into SCID mice through the tail vein (1 × 10⁶ cells per mouse). After eight weeks, mice were sacrificed and their lung tissues were collected for subsequent analyses.
Experiment 2 Reporting the m6A-centered Disease Response				[2]
Response Summary	m6A modification levels were markedly upregulated in human PCa tissues due to increased expression of METTL3. METTL3 mediates m6A modification of USP4 mRNA at A2696, and m6A reader protein YTHDF2 binds to and induces degradation of USP4 mRNA by recruiting RNA-binding protein HNRNPD to the mRNA. Decrease of USP4 fails to remove the ubiquitin group from ELAV-like protein 1 (HuR/ELAVL1) protein, resulting in a reduction of ELAVL1 protein. Lastly, downregulation of ELAVL1 in turn increases ARHGDIA expression, promoting migration and invasion of PCa cells.
Responsed Disease	Prostate cancer [ICD-11: 2C82]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	LNCaP	Prostate carcinoma	Homo sapiens	CVCL_0395
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
In-vivo Model	A total of 1 × 10⁶ PC3 cells or DU145 cells suspended in a mixture of 100 uL PBS and Matrigel were subcutaneously injected into BALB/c nude mice. Tumor weight were measured 2 months after the engraftment. To evaluate the role of METTL3 in tumor metastasis, PC3 cells with or without knockdown of METTL3 were injected into SCID mice through the tail vein (1 × 10⁶ cells per mouse). After eight weeks, mice were sacrificed and their lung tissues were collected for subsequent analyses.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03332		Crosstalk Info
Epigenetic Regulator	Lysine-specific demethylase 5A (KDM5A)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Prostate cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00241)

ELAV-like protein 1 (HuR/ELAVL1)

N4-acetylcytidine (ac4C)

In total 2 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000248		Click to Show/Hide the Full List
mod site	chr19:7963326-7963327:-		[4]
Sequence	TTTATACTCTGGGATGCAACCGACATGTTCAAATGTTTGAA
Cell/Tissue List	HEK293T
Seq Type List	ac4C-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5; ENST00000596459.5
External Link	RMBase: ac4C_site_940
mod ID: AC4SITE000249		Click to Show/Hide the Full List
mod site	chr19:7973821-7973822:-
Sequence	GACGCCAACTTGTACATCAGCGGGCTCCCGCGGACCATGAC
Cell/Tissue List	DLD1
Seq Type List	acRIP-seq
Transcript ID List	ENST00000593807.1; ENST00000407627.7; ENST00000596459.5; ENST00000596154.5
External Link	RMBase: ac4C_site_941

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE008927		Click to Show/Hide the Full List
mod site	chr19:7976886-7976887:-		[5]
Sequence	AAGTCTAACCTGAGCAACATAGCAAGACCCTGTCTCTACAA
Transcript ID List	ENST00000596459.5; ENST00000407627.7; rmsk_4929596; ENST00000593807.1; ENST00000596154.5
External Link	RMBase: RNA-editing_site_65458

5-methylcytidine (m5C)

In total 5 m6A sequence/site(s) in this target gene
mod ID: M5CSITE001726		Click to Show/Hide the Full List
mod site	chr19:7962913-7962914:-
Sequence	GGAATGGCGGCGGGCCCGTCCAGCGTGGGCCACCACTGGGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5
External Link	RMBase: m5C_site_22403
mod ID: M5CSITE001727		Click to Show/Hide the Full List
mod site	chr19:7962914-7962915:-
Sequence	GGGAATGGCGGCGGGCCCGTCCAGCGTGGGCCACCACTGGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5
External Link	RMBase: m5C_site_22404
mod ID: M5CSITE001728		Click to Show/Hide the Full List
mod site	chr19:7962919-7962920:-
Sequence	GTCCTGGGAATGGCGGCGGGCCCGTCCAGCGTGGGCCACCA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m5C_site_22405
mod ID: M5CSITE001729		Click to Show/Hide the Full List
mod site	chr19:7963182-7963183:-
Sequence	GGATGGTGGTGAACCTGAAGCATGCTTTAACCTCTAAGACT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000596154.5; ENST00000596459.5; ENST00000407627.7
External Link	RMBase: m5C_site_22406
mod ID: M5CSITE001730		Click to Show/Hide the Full List
mod site	chr19:8005651-8005652:-		[6]
Sequence	GGCGTGTCCGGGCCGCGGGCCGGAGCGGGTCGTGCGCGCTG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000593807.1
External Link	RMBase: m5C_site_22407

N6-methyladenosine (m6A)

In total 72 m6A sequence/site(s) in this target gene
mod ID: M6ASITE039167		Click to Show/Hide the Full List
mod site	chr19:7959403-7959404:-		[7]
Sequence	GACCATGTGATGTTCCGTTTACAGTGACTTGCTTTGGGGGA
Motif Score	2.07285119
Cell/Tissue List	brain
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000407627.7
External Link	RMBase: m6A_site_415962
mod ID: M6ASITE039168		Click to Show/Hide the Full List
mod site	chr19:7959665-7959666:-		[8]
Sequence	TCGGATCCCAGGCAGGGTTCACATTTCCAAACCTTTTTGAT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407627.7
External Link	RMBase: m6A_site_415963
mod ID: M6ASITE039169		Click to Show/Hide the Full List
mod site	chr19:7959749-7959750:-		[8]
Sequence	CGCAAGACAGCCCTGAAGTCACAAGTGCTTTCTTTTAAGTG
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407627.7
External Link	RMBase: m6A_site_415964
mod ID: M6ASITE039170		Click to Show/Hide the Full List
mod site	chr19:7960079-7960080:-		[9]
Sequence	GTCCACCAGGCATTGAAAAGACATGACTTACCCAGTCCGGC
Motif Score	2.897386905
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000407627.7
External Link	RMBase: m6A_site_415965
mod ID: M6ASITE039171		Click to Show/Hide the Full List
mod site	chr19:7960784-7960785:-		[10]
Sequence	ACCATTTCTTAAAAAATTTTACATAGATCAGTTGTATTTCT
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000407627.7
External Link	RMBase: m6A_site_415966
mod ID: M6ASITE039172		Click to Show/Hide the Full List
mod site	chr19:7960871-7960872:-		[8]
Sequence	CTGTGTCCTCAAAGTTCATTACATCTTATCAAGGCCTGTTT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407627.7
External Link	RMBase: m6A_site_415967
mod ID: M6ASITE039173		Click to Show/Hide the Full List
mod site	chr19:7960947-7960948:-		[8]
Sequence	TTGTGGAAGGATTTAGCTTAACAACTGTCACTCCTGAAAAG
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5
External Link	RMBase: m6A_site_415968
mod ID: M6ASITE039174		Click to Show/Hide the Full List
mod site	chr19:7961260-7961261:-		[8]
Sequence	CCCCCTGGAGTCTCACTCCCACACATGCCCATAGCTAGCAT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_415969
mod ID: M6ASITE039175		Click to Show/Hide the Full List
mod site	chr19:7961283-7961284:-		[11]
Sequence	GCGGGATTCCCGCTTCTGAAACTCCCCCTGGAGTCTCACTC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5
External Link	RMBase: m6A_site_415970
mod ID: M6ASITE039176		Click to Show/Hide the Full List
mod site	chr19:7961433-7961434:-		[8]
Sequence	CTGATGGAAGGTGGGAGCCAACACCCTTCTGATGGAAGGTG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_415971
mod ID: M6ASITE039177		Click to Show/Hide the Full List
mod site	chr19:7961941-7961942:-		[10]
Sequence	ACCAGCAGTTTTTAACCTTGACGTGAGACTAAAACGTGACC
Motif Score	2.833690476
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_415972
mod ID: M6ASITE039178		Click to Show/Hide the Full List
mod site	chr19:7961968-7961969:-		[10]
Sequence	AGAGAATCACAAACAGGATAACTTAGTACCAGCAGTTTTTA
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5
External Link	RMBase: m6A_site_415973
mod ID: M6ASITE039179		Click to Show/Hide the Full List
mod site	chr19:7962301-7962302:-		[10]
Sequence	TTTTTACTTTTGCATTTAAGACCATTAAATTTGATTTTGTT
Motif Score	2.876744048
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_415974
mod ID: M6ASITE039180		Click to Show/Hide the Full List
mod site	chr19:7962379-7962380:-		[10]
Sequence	TTCTCTTCATAACTGCCTTGACATTTTGGGTTGTTCTGTTC
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_415975
mod ID: M6ASITE039181		Click to Show/Hide the Full List
mod site	chr19:7962436-7962437:-		[11]
Sequence	CCAGTTATCTATTAACCAAAACCTTTGATTTGTAGTTTTAA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5
External Link	RMBase: m6A_site_415976
mod ID: M6ASITE039182		Click to Show/Hide the Full List
mod site	chr19:7962464-7962465:-		[10]
Sequence	CACTCAGCAGAAAAGTACTTACTTCTTGCCAGTTATCTATT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5
External Link	RMBase: m6A_site_415977
mod ID: M6ASITE039183		Click to Show/Hide the Full List
mod site	chr19:7962483-7962484:-		[10]
Sequence	AATTTTGCTTTTGTATGAACACTCAGCAGAAAAGTACTTAC
Motif Score	2.506922619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_415978
mod ID: M6ASITE039184		Click to Show/Hide the Full List
mod site	chr19:7962485-7962486:-		[11]
Sequence	GGAATTTTGCTTTTGTATGAACACTCAGCAGAAAAGTACTT
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_415979
mod ID: M6ASITE039185		Click to Show/Hide the Full List
mod site	chr19:7962536-7962537:-		[11]
Sequence	CCCTTCTCGTGAGCGCTTAGACCTTTTTCTATTTTAGTCGG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_415980
mod ID: M6ASITE039186		Click to Show/Hide the Full List
mod site	chr19:7962582-7962583:-		[11]
Sequence	TGTATTTTAATAACACAGAAACATTTGAGCATTGTATTTCT
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5
External Link	RMBase: m6A_site_415981
mod ID: M6ASITE039187		Click to Show/Hide the Full List
mod site	chr19:7962590-7962591:-		[10]
Sequence	AATGGCTCTGTATTTTAATAACACAGAAACATTTGAGCATT
Motif Score	2.168095238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5
External Link	RMBase: m6A_site_415982
mod ID: M6ASITE039188		Click to Show/Hide the Full List
mod site	chr19:7962629-7962630:-		[8]
Sequence	CCCGTTTTCCAGAGCATTTAACATAGCTTGGAGGCGTAAAA
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_415983
mod ID: M6ASITE039189		Click to Show/Hide the Full List
mod site	chr19:7962705-7962706:-		[8]
Sequence	GACATCCCGAGTTTCTGTCCACACATTGCATGCACAGCGCC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_415984
mod ID: M6ASITE039190		Click to Show/Hide the Full List
mod site	chr19:7962724-7962725:-		[8]
Sequence	GAAGATGTGTTGCTACTCTGACATCCCGAGTTTCTGTCCAC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5
External Link	RMBase: m6A_site_415985
mod ID: M6ASITE039191		Click to Show/Hide the Full List
mod site	chr19:7962848-7962849:-		[11]
Sequence	GGCGGGCCCTCCAGAGAAGGACACAAACGTGTTTCGTAAGC
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T; MM6
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5
External Link	RMBase: m6A_site_415986
mod ID: M6ASITE039192		Click to Show/Hide the Full List
mod site	chr19:7963073-7963074:-		[10]
Sequence	TTTTAATCTAAAGATGTTAGACAGATGCTGAGTGTGCGTTT
Motif Score	2.897386905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5
External Link	RMBase: m6A_site_415987
mod ID: M6ASITE039193		Click to Show/Hide the Full List
mod site	chr19:7963128-7963129:-		[11]
Sequence	TTCATTCAATGTCTCCACAGACTGGGTAGCAAAAAAATCAC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_415988
mod ID: M6ASITE039194		Click to Show/Hide the Full List
mod site	chr19:7963132-7963133:-		[7]
Sequence	GCGTTTCATTCAATGTCTCCACAGACTGGGTAGCAAAAAAA
Motif Score	2.053113095
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_415989
mod ID: M6ASITE039195		Click to Show/Hide the Full List
mod site	chr19:7963156-7963157:-		[7]
Sequence	TTAACCTCTAAGACTGTCTAACACGCGTTTCATTCAATGTC
Motif Score	2.168095238
Cell/Tissue List	kidney; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5
External Link	RMBase: m6A_site_415990
mod ID: M6ASITE039196		Click to Show/Hide the Full List
mod site	chr19:7963164-7963165:-		[11]
Sequence	AGCATGCTTTAACCTCTAAGACTGTCTAACACGCGTTTCAT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000407627.7; ENST00000596459.5; ENST00000596154.5
External Link	RMBase: m6A_site_415991
mod ID: M6ASITE039197		Click to Show/Hide the Full List
mod site	chr19:7963190-7963191:-		[11]
Sequence	GTCCCTCTGGATGGTGGTGAACCTGAAGCATGCTTTAACCT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000596459.5; ENST00000407627.7; ENST00000596154.5
External Link	RMBase: m6A_site_415992
mod ID: M6ASITE039198		Click to Show/Hide the Full List
mod site	chr19:7963218-7963219:-		[10]
Sequence	ATCTAAGTAGAACTGCATTGACTAACCAGTCCCTCTGGATG
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000407627.7; ENST00000596459.5; ENST00000596154.5
External Link	RMBase: m6A_site_415993
mod ID: M6ASITE039199		Click to Show/Hide the Full List
mod site	chr19:7963227-7963228:-		[11]
Sequence	TAAACAGAAATCTAAGTAGAACTGCATTGACTAACCAGTCC
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7; ENST00000596459.5
External Link	RMBase: m6A_site_415994
mod ID: M6ASITE039200		Click to Show/Hide the Full List
mod site	chr19:7963244-7963245:-		[11]
Sequence	TCCTTTAAGATATATATTAAACAGAAATCTAAGTAGAACTG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; HepG2
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5; ENST00000596459.5
External Link	RMBase: m6A_site_415995
mod ID: M6ASITE039201		Click to Show/Hide the Full List
mod site	chr19:7963290-7963291:-		[11]
Sequence	TTGAAATCCCACAATGTTAGACCAATCTTAAGTTTCGTAAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000407627.7; ENST00000596459.5; ENST00000596154.5
External Link	RMBase: m6A_site_415996
mod ID: M6ASITE039202		Click to Show/Hide the Full List
mod site	chr19:7963300-7963301:-		[8]
Sequence	GTTCAAATGTTTGAAATCCCACAATGTTAGACCAATCTTAA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000596459.5; ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_415997
mod ID: M6ASITE039203		Click to Show/Hide the Full List
mod site	chr19:7963324-7963325:-		[8]
Sequence	TATACTCTGGGATGCAACCGACATGTTCAAATGTTTGAAAT
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000596459.5; ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_415998
mod ID: M6ASITE039204		Click to Show/Hide the Full List
mod site	chr19:7963386-7963387:-		[8]
Sequence	CTCATTTTGCGCCAATTTTCACAAGTGTTTGTCTTTGTCTG
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407627.7; ENST00000596459.5; ENST00000596154.5
External Link	RMBase: m6A_site_415999
mod ID: M6ASITE039206		Click to Show/Hide the Full List
mod site	chr19:7963407-7963408:-		[10]
Sequence	ACTTTTCTTGTTAGTGTACAACTCATTTTGCGCCAATTTTC
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7; ENST00000596459.5
External Link	RMBase: m6A_site_416000
mod ID: M6ASITE039207		Click to Show/Hide the Full List
mod site	chr19:7963410-7963411:-		[8]
Sequence	GAAACTTTTCTTGTTAGTGTACAACTCATTTTGCGCCAATT
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000596459.5; ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_416001
mod ID: M6ASITE039208		Click to Show/Hide the Full List
mod site	chr19:7963427-7963428:-		[12]
Sequence	TTAAGAGTGAAGGAGTTGAAACTTTTCTTGTTAGTGTACAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; A549; HEK293T; LCLs; H1299; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000407627.7; ENST00000596459.5; ENST00000596154.5
External Link	RMBase: m6A_site_416002
mod ID: M6ASITE039209		Click to Show/Hide the Full List
mod site	chr19:7963460-7963461:-		[10]
Sequence	TCGCTCATGCTTTTTTTTGTACGGAATAGATAATTAAGAGT
Motif Score	2.830077381
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7; ENST00000596459.5
External Link	RMBase: m6A_site_416003
mod ID: M6ASITE039210		Click to Show/Hide the Full List
mod site	chr19:7963489-7963490:-		[8]
Sequence	CTTCAAAACCAACAAGTCCCACAAATAACTCGCTCATGCTT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5; ENST00000596459.5
External Link	RMBase: m6A_site_416004
mod ID: M6ASITE039211		Click to Show/Hide the Full List
mod site	chr19:7963502-7963503:-		[12]
Sequence	TCTTACAGGTTTCCTTCAAAACCAACAAGTCCCACAAATAA
Motif Score	2.185083333
Cell/Tissue List	HEK293T; HeLa; A549; HepG2; hNPCs; hESCs; fibroblasts; LCLs; MT4; H1299; MM6; HEK293A-TOA; iSLK; TREX
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000596459.5; ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_416005
mod ID: M6ASITE039212		Click to Show/Hide the Full List
mod site	chr19:7963528-7963529:-		[12]
Sequence	GAACGGCTACCGCCTGGGGGACAAAATCTTACAGGTTTCCT
Motif Score	3.643047619
Cell/Tissue List	HEK293T; HeLa; A549; hESC-HEK293T; HepG2; hNPCs; hESCs; fibroblasts; LCLs; MT4; H1299; MM6; HEK293A-TOA; iSLK; TREX; AML
Seq Type List	MeRIP-seq; MAZTER-seq; m6A-seq; miCLIP
Transcript ID List	ENST00000596459.5; ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_416006
mod ID: M6ASITE039213		Click to Show/Hide the Full List
mod site	chr19:7963582-7963583:-		[12]
Sequence	TGGCTTTGTGACCATGACAAACTATGAAGAAGCCGCGATGG
Motif Score	2.627720238
Cell/Tissue List	HEK293T; HeLa; HepG2; hNPCs; hESCs; fibroblasts; A549; CD8T; MT4; MM6; Huh7; HEK293A-TOA; TREX
Seq Type List	MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000596459.5; ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_416007
mod ID: M6ASITE039214		Click to Show/Hide the Full List
mod site	chr19:7963586-7963587:-		[8]
Sequence	GGTTTGGCTTTGTGACCATGACAAACTATGAAGAAGCCGCG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000596154.5; ENST00000407627.7; ENST00000596459.5
External Link	RMBase: m6A_site_416008
mod ID: M6ASITE039215		Click to Show/Hide the Full List
mod site	chr19:7963592-7963593:-		[13]
Sequence	GCAAAGGGTTTGGCTTTGTGACCATGACAAACTATGAAGAA
Motif Score	2.839113095
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000407627.7; ENST00000596459.5; ENST00000596154.5
External Link	RMBase: m6A_site_416009
mod ID: M6ASITE039216		Click to Show/Hide the Full List
mod site	chr19:7963618-7963619:-		[8]
Sequence	GATCCGCGACTTCAACACCAACAAGTGCAAAGGGTTTGGCT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000596459.5; ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_416010
mod ID: M6ASITE039217		Click to Show/Hide the Full List
mod site	chr19:7963624-7963625:-		[8]
Sequence	GAAAGTGATCCGCGACTTCAACACCAACAAGTGCAAAGGGT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5; ENST00000596459.5
External Link	RMBase: m6A_site_416011
mod ID: M6ASITE039218		Click to Show/Hide the Full List
mod site	chr19:7963717-7963718:-		[8]
Sequence	CGGCTGGTGCATTTTCATCTACAACCTGGGGCAGGATGCCG
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407627.7; ENST00000593807.1; ENST00000596154.5; ENST00000596459.5
External Link	RMBase: m6A_site_416012
mod ID: M6ASITE039219		Click to Show/Hide the Full List
mod site	chr19:7963783-7963784:-		[8]
Sequence	CTCCCCCATGGGCGTCGATCACATGAGCGGGCTCTCTGGCG
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000596154.5; ENST00000593807.1; ENST00000407627.7; ENST00000596459.5
External Link	RMBase: m6A_site_416013
mod ID: M6ASITE039220		Click to Show/Hide the Full List
mod site	chr19:7967651-7967652:-		[8]
Sequence	TGCAGCCAACCCCAACCAGAACAAAAACGTGGCACTCCTCT
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T; Huh7
Seq Type List	MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000596154.5; ENST00000593807.1; ENST00000596459.5; ENST00000407627.7
External Link	RMBase: m6A_site_416014
mod ID: M6ASITE039221		Click to Show/Hide the Full List
mod site	chr19:7967707-7967708:-		[14]
Sequence	ACCAGTTTCAATGGTCATAAACCCCCAGGTTCCTCTGAGCC
Motif Score	2.185083333
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000596154.5; ENST00000596459.5; ENST00000407627.7; ENST00000593807.1
External Link	RMBase: m6A_site_416015
mod ID: M6ASITE039222		Click to Show/Hide the Full List
mod site	chr19:7967752-7967753:-		[10]
Sequence	GCGTTTATCCGGTTTGACAAACGGTCGGAGGCAGAAGAGGC
Motif Score	2.179660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000407627.7; ENST00000596459.5; ENST00000596154.5; ENST00000593807.1
External Link	RMBase: m6A_site_416016
mod ID: M6ASITE039223		Click to Show/Hide the Full List
mod site	chr19:7967756-7967757:-		[8]
Sequence	GGTTGCGTTTATCCGGTTTGACAAACGGTCGGAGGCAGAAG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000596154.5; ENST00000593807.1; ENST00000407627.7; ENST00000596459.5
External Link	RMBase: m6A_site_416017
mod ID: M6ASITE039224		Click to Show/Hide the Full List
mod site	chr19:7972908-7972909:-		[14]
Sequence	GAGGCAGGAGAATCGCCTGGACCCCAGGAGGCGGAGATTGC
Motif Score	3.622404762
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5; rmsk_4929588; ENST00000595499.1; ENST00000593807.1; ENST00000596459.5
External Link	RMBase: m6A_site_416018
mod ID: M6ASITE039225		Click to Show/Hide the Full List
mod site	chr19:7973727-7973728:-		[7]
Sequence	GGGTCCTCGTGGATCAGACTACAGGTACCAGAGGGGCCCCA
Motif Score	2.078666667
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000595499.1; ENST00000596154.5; ENST00000593807.1; ENST00000596459.5; ENST00000407627.7
External Link	RMBase: m6A_site_416019
mod ID: M6ASITE039226		Click to Show/Hide the Full List
mod site	chr19:7973783-7973784:-		[8]
Sequence	GACCCAGAAGGACGTAGAAGACATGTTCTCTCGGTTTGGGC
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T; HepG2
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000595499.1; ENST00000407627.7; ENST00000593807.1; ENST00000596459.5; ENST00000596154.5
External Link	RMBase: m6A_site_416020
mod ID: M6ASITE039227		Click to Show/Hide the Full List
mod site	chr19:7973808-7973809:-		[15]
Sequence	ACATCAGCGGGCTCCCGCGGACCATGACCCAGAAGGACGTA
Motif Score	3.622404762
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000407627.7; ENST00000593807.1; ENST00000596154.5; ENST00000596459.5
External Link	RMBase: m6A_site_416021
mod ID: M6ASITE039228		Click to Show/Hide the Full List
mod site	chr19:7973828-7973829:-		[8]
Sequence	GATCAAAGACGCCAACTTGTACATCAGCGGGCTCCCGCGGA
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000593807.1; ENST00000596459.5; ENST00000596154.5; ENST00000407627.7
External Link	RMBase: m6A_site_416022
mod ID: M6ASITE039229		Click to Show/Hide the Full List
mod site	chr19:7981090-7981091:-		[15]
Sequence	GCTTGAGGCTCCAGTCAAAAACCATTAAGGTAAAGGGATCT
Motif Score	2.185083333
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000407627.7; ENST00000596154.5; ENST00000596459.5; ENST00000593807.1
External Link	RMBase: m6A_site_416023
mod ID: M6ASITE039230		Click to Show/Hide the Full List
mod site	chr19:7981122-7981123:-		[8]
Sequence	GGATGCAGAGAGAGCGATCAACACGCTGAACGGCTTGAGGC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000596459.5; ENST00000407627.7; ENST00000593807.1
External Link	RMBase: m6A_site_416024
mod ID: M6ASITE039231		Click to Show/Hide the Full List
mod site	chr19:7981158-7981159:-		[11]
Sequence	CTTGGGCTATGGCTTTGTGAACTACGTGACCGCGAAGGATG
Motif Score	3.373380952
Cell/Tissue List	HeLa; MT4; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000596459.5; ENST00000593807.1; ENST00000407627.7
External Link	RMBase: m6A_site_416025
mod ID: M6ASITE039232		Click to Show/Hide the Full List
mod site	chr19:7981184-7981185:-		[8]
Sequence	TTCATGTTCTCTTGCACAGGACACAGCTTGGGCTATGGCTT
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000593807.1; ENST00000596459.5; ENST00000407627.7
External Link	RMBase: m6A_site_416026
mod ID: M6ASITE039233		Click to Show/Hide the Full List
mod site	chr19:7991665-7991666:-		[11]
Sequence	GGTGAAGTTGAATCTGCAAAACTTATTCGGGATAAAGTAGC
Motif Score	2.627720238
Cell/Tissue List	HeLa; MT4; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000593807.1; ENST00000596459.5; ENST00000407627.7
External Link	RMBase: m6A_site_416027
mod ID: M6ASITE039234		Click to Show/Hide the Full List
mod site	chr19:7991726-7991727:-		[11]
Sequence	CGTCAACTACCTCCCTCAGAACATGACCCAGGATGAGTTAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000593807.1; ENST00000407627.7; ENST00000596459.5
External Link	RMBase: m6A_site_416028
mod ID: M6ASITE039235		Click to Show/Hide the Full List
mod site	chr19:7991768-7991769:-		[8]
Sequence	GGCCGAAGACTGCAGGGGTGACATCGGGAGAACGAATTTGA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000596459.5; ENST00000407627.7; ENST00000593807.1
External Link	RMBase: m6A_site_416029
mod ID: M6ASITE039236		Click to Show/Hide the Full List
mod site	chr19:7991780-7991781:-		[11]
Sequence	TGAAGACCACATGGCCGAAGACTGCAGGGGTGACATCGGGA
Motif Score	3.319380952
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000596459.5; ENST00000407627.7; ENST00000593807.1
External Link	RMBase: m6A_site_416030
mod ID: M6ASITE039237		Click to Show/Hide the Full List
mod site	chr19:7991792-7991793:-		[7]
Sequence	GTCTAATGGTTATGAAGACCACATGGCCGAAGACTGCAGGG
Motif Score	2.053113095
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000596459.5; ENST00000593807.1; ENST00000407627.7
External Link	RMBase: m6A_site_416031
mod ID: M6ASITE039238		Click to Show/Hide the Full List
mod site	chr19:7991795-7991796:-		[11]
Sequence	AATGTCTAATGGTTATGAAGACCACATGGCCGAAGACTGCA
Motif Score	2.876744048
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407627.7; ENST00000596459.5; ENST00000593807.1
External Link	RMBase: m6A_site_416032
mod ID: M6ASITE039239		Click to Show/Hide the Full List
mod site	chr19:7991817-7991818:-		[8]
Sequence	TTGGCAGATTTTTGAAAAATACAATGTCTAATGGTTATGAA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000593807.1; ENST00000596459.5; ENST00000407627.7
External Link	RMBase: m6A_site_416033

Ref 1	Cross-talk among writers, readers, and erasers of m(6)A regulates cancer growth and progression. Sci Adv. 2018 Oct 3;4(10):eaar8263. doi: 10.1126/sciadv.aar8263. eCollection 2018 Oct.
Ref 2	Silencing of METTL3 effectively hinders invasion and metastasis of prostate cancer cells. Theranostics. 2021 Jun 11;11(16):7640-7657. doi: 10.7150/thno.61178. eCollection 2021.
Ref 3	The impact of P-glycoprotein and breast cancer resistance protein on the brain pharmacokinetics and pharmacodynamics of a panel of MEK inhibitors. Int J Cancer. 2018 Jan 15;142(2):381-391. doi: 10.1002/ijc.31052. Epub 2017 Oct 4.
Ref 4	Dynamic RNA acetylation revealed by quantitative cross-evolutionary mapping. Nature. 2020 Jul;583(7817):638-643. doi: 10.1038/s41586-020-2418-2. Epub 2020 Jun 17.
Ref 5	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 6	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 7	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 8	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 9	Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat Microbiol. 2016 Feb 22;1:16011. doi: 10.1038/nmicrobiol.2016.11.
Ref 10	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 11	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 12	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 13	The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 2017 Nov;23(11):1369-1376. doi: 10.1038/nm.4416. Epub 2017 Sep 18.
Ref 14	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 15	Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012 Apr 29;485(7397):201-6. doi: 10.1038/nature11112.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map