m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00241)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ELAVL1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 14 (METTL14) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL14 | ||
| Cell Line | Neural progenitor cell line | Mus musculus |
|
Treatment: METTL14 knockout NPCs
Control: Wild type NPCs
|
GSE158985 | |
| Regulation |
![]() ![]() |
logFC: 8.91E-01 p-value: 1.25E-03 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL14 and ALKBH5 determine the m6A status of target genes by controlling each other's expression and by inhibiting m6A reader YTHDF3 (YTH N 6-methyladenosine RNA binding protein 3), which blocks RNA demethylase activity. ALKBH5/METTL14 constitute a positive feedback loop with RNA stability factor ELAV-like protein 1 (HuR/ELAVL1) to regulate the stability of target transcripts. This study unveils a previously undefined role for m6A in cancer and shows that the collaboration among writers-erasers-readers sets up the m6A threshold to ensure the stability of progrowth/proliferation-specific genes, and protumorigenic stimulus. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Solid tumour/cancer | ICD-11: 2A00-2F9Z | ||
| Cell Process | RNA stability | |||
| Cell apoptosis | ||||
| In-vitro Model | BT-549 | Invasive breast carcinoma | Homo sapiens | CVCL_1092 |
| DU145 | Prostate carcinoma | Homo sapiens | CVCL_0105 | |
| HeLa | Endocervical adenocarcinoma | Homo sapiens | CVCL_0030 | |
| Hep-G2 | Hepatoblastoma | Homo sapiens | CVCL_0027 | |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| MDA-MB-468 | Breast adenocarcinoma | Homo sapiens | CVCL_0419 | |
| In-vivo Model | For tumor xenograft studies, MDA-MB-231 cells transfected with scrambled-siRNA or METTL14-siRNA or ALKBH5-siRNA (2 × 106) were mixed with Matrigel and injected subcutaneously in the flank of 6-week-old female athymic nude mice. | |||
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | Embryonic stem cells | Mus musculus |
|
Treatment: METTL3 knockout ESCs
Control: Wild type ESCs
|
GSE146466 | |
| Regulation |
![]() ![]() |
logFC: 6.09E-01 p-value: 1.50E-08 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | m6A modification levels were markedly upregulated in human PCa tissues due to increased expression of METTL3. METTL3 mediates m6A modification of USP4 mRNA at A2696, and m6A reader protein YTHDF2 binds to and induces degradation of USP4 mRNA by recruiting RNA-binding protein HNRNPD to the mRNA. Decrease of USP4 fails to remove the ubiquitin group from ELAVL1 protein, resulting in a reduction of ELAVL1 protein. Lastly, downregulation of ELAV-like protein 1 (HuR/ELAVL1) in turn increases ARHGDIA expression, promoting migration and invasion of PCa cells. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Prostate cancer | ICD-11: 2C82 | ||
| In-vitro Model | PC-3 | Prostate carcinoma | Homo sapiens | CVCL_0035 |
| LNCaP | Prostate carcinoma | Homo sapiens | CVCL_0395 | |
| DU145 | Prostate carcinoma | Homo sapiens | CVCL_0105 | |
| In-vivo Model | A total of 1 × 106 PC3 cells or DU145 cells suspended in a mixture of 100 uL PBS and Matrigel were subcutaneously injected into BALB/c nude mice. Tumor weight were measured 2 months after the engraftment. To evaluate the role of METTL3 in tumor metastasis, PC3 cells with or without knockdown of METTL3 were injected into SCID mice through the tail vein (1 × 106 cells per mouse). After eight weeks, mice were sacrificed and their lung tissues were collected for subsequent analyses. | |||
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL14 and ALKBH5 determine the m6A status of target genes by controlling each other's expression and by inhibiting m6A reader YTHDF3 (YTH N 6-methyladenosine RNA binding protein 3), which blocks RNA demethylase activity. ALKBH5/METTL14 constitute a positive feedback loop with RNA stability factor ELAV-like protein 1 (HuR/ELAVL1) to regulate the stability of target transcripts. This study unveils a previously undefined role for m6A in cancer and shows that the collaboration among writers-erasers-readers sets up the m6A threshold to ensure the stability of progrowth/proliferation-specific genes, and protumorigenic stimulus. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Solid tumour/cancer | ICD-11: 2A00-2F9Z | ||
| Cell Process | RNA stability | |||
| Cell apoptosis | ||||
| In-vitro Model | BT-549 | Invasive breast carcinoma | Homo sapiens | CVCL_1092 |
| DU145 | Prostate carcinoma | Homo sapiens | CVCL_0105 | |
| HeLa | Endocervical adenocarcinoma | Homo sapiens | CVCL_0030 | |
| Hep-G2 | Hepatoblastoma | Homo sapiens | CVCL_0027 | |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| MDA-MB-468 | Breast adenocarcinoma | Homo sapiens | CVCL_0419 | |
| In-vivo Model | For tumor xenograft studies, MDA-MB-231 cells transfected with scrambled-siRNA or METTL14-siRNA or ALKBH5-siRNA (2 × 106) were mixed with Matrigel and injected subcutaneously in the flank of 6-week-old female athymic nude mice. | |||
YTH domain-containing family protein 2 (YTHDF2) [READER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | m6A modification levels were markedly upregulated in human PCa tissues due to increased expression of METTL3. METTL3 mediates m6A modification of USP4 mRNA at A2696, and m6A reader protein YTHDF2 binds to and induces degradation of USP4 mRNA by recruiting RNA-binding protein HNRNPD to the mRNA. Decrease of USP4 fails to remove the ubiquitin group from ELAV-like protein 1 (HuR/ELAVL1) protein, resulting in a reduction of ELAVL1 protein. Lastly, downregulation of ELAVL1 in turn increases ARHGDIA expression, promoting migration and invasion of PCa cells. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Prostate cancer | ICD-11: 2C82 | ||
| In-vitro Model | PC-3 | Prostate carcinoma | Homo sapiens | CVCL_0035 |
| LNCaP | Prostate carcinoma | Homo sapiens | CVCL_0395 | |
| DU145 | Prostate carcinoma | Homo sapiens | CVCL_0105 | |
| In-vivo Model | A total of 1 × 106 PC3 cells or DU145 cells suspended in a mixture of 100 uL PBS and Matrigel were subcutaneously injected into BALB/c nude mice. Tumor weight were measured 2 months after the engraftment. To evaluate the role of METTL3 in tumor metastasis, PC3 cells with or without knockdown of METTL3 were injected into SCID mice through the tail vein (1 × 106 cells per mouse). After eight weeks, mice were sacrificed and their lung tissues were collected for subsequent analyses. | |||
Solid tumour/cancer [ICD-11: 2A00-2F9Z]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL14 and ALKBH5 determine the m6A status of target genes by controlling each other's expression and by inhibiting m6A reader YTHDF3 (YTH N 6-methyladenosine RNA binding protein 3), which blocks RNA demethylase activity. ALKBH5/METTL14 constitute a positive feedback loop with RNA stability factor ELAV-like protein 1 (HuR/ELAVL1) to regulate the stability of target transcripts. This study unveils a previously undefined role for m6A in cancer and shows that the collaboration among writers-erasers-readers sets up the m6A threshold to ensure the stability of progrowth/proliferation-specific genes, and protumorigenic stimulus. | |||
| Responsed Disease | Solid tumour/cancer [ICD-11: 2A00-2F9Z] | |||
| Target Regulator | Methyltransferase-like 14 (METTL14) | WRITER | ||
| Target Regulation | Up regulation | |||
| Cell Process | RNA stability | |||
| Cell apoptosis | ||||
| In-vitro Model | BT-549 | Invasive breast carcinoma | Homo sapiens | CVCL_1092 |
| DU145 | Prostate carcinoma | Homo sapiens | CVCL_0105 | |
| HeLa | Endocervical adenocarcinoma | Homo sapiens | CVCL_0030 | |
| Hep-G2 | Hepatoblastoma | Homo sapiens | CVCL_0027 | |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| MDA-MB-468 | Breast adenocarcinoma | Homo sapiens | CVCL_0419 | |
| In-vivo Model | For tumor xenograft studies, MDA-MB-231 cells transfected with scrambled-siRNA or METTL14-siRNA or ALKBH5-siRNA (2 × 106) were mixed with Matrigel and injected subcutaneously in the flank of 6-week-old female athymic nude mice. | |||
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL14 and ALKBH5 determine the m6A status of target genes by controlling each other's expression and by inhibiting m6A reader YTHDF3 (YTH N 6-methyladenosine RNA binding protein 3), which blocks RNA demethylase activity. ALKBH5/METTL14 constitute a positive feedback loop with RNA stability factor ELAV-like protein 1 (HuR/ELAVL1) to regulate the stability of target transcripts. This study unveils a previously undefined role for m6A in cancer and shows that the collaboration among writers-erasers-readers sets up the m6A threshold to ensure the stability of progrowth/proliferation-specific genes, and protumorigenic stimulus. | |||
| Responsed Disease | Solid tumour/cancer [ICD-11: 2A00-2F9Z] | |||
| Target Regulator | RNA demethylase ALKBH5 (ALKBH5) | ERASER | ||
| Target Regulation | Up regulation | |||
| Cell Process | RNA stability | |||
| Cell apoptosis | ||||
| In-vitro Model | BT-549 | Invasive breast carcinoma | Homo sapiens | CVCL_1092 |
| DU145 | Prostate carcinoma | Homo sapiens | CVCL_0105 | |
| HeLa | Endocervical adenocarcinoma | Homo sapiens | CVCL_0030 | |
| Hep-G2 | Hepatoblastoma | Homo sapiens | CVCL_0027 | |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| MDA-MB-468 | Breast adenocarcinoma | Homo sapiens | CVCL_0419 | |
| In-vivo Model | For tumor xenograft studies, MDA-MB-231 cells transfected with scrambled-siRNA or METTL14-siRNA or ALKBH5-siRNA (2 × 106) were mixed with Matrigel and injected subcutaneously in the flank of 6-week-old female athymic nude mice. | |||
Prostate cancer [ICD-11: 2C82]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | m6A modification levels were markedly upregulated in human PCa tissues due to increased expression of METTL3. METTL3 mediates m6A modification of USP4 mRNA at A2696, and m6A reader protein YTHDF2 binds to and induces degradation of USP4 mRNA by recruiting RNA-binding protein HNRNPD to the mRNA. Decrease of USP4 fails to remove the ubiquitin group from ELAVL1 protein, resulting in a reduction of ELAVL1 protein. Lastly, downregulation of ELAV-like protein 1 (HuR/ELAVL1) in turn increases ARHGDIA expression, promoting migration and invasion of PCa cells. | |||
| Responsed Disease | Prostate cancer [ICD-11: 2C82] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Down regulation | |||
| In-vitro Model | PC-3 | Prostate carcinoma | Homo sapiens | CVCL_0035 |
| LNCaP | Prostate carcinoma | Homo sapiens | CVCL_0395 | |
| DU145 | Prostate carcinoma | Homo sapiens | CVCL_0105 | |
| In-vivo Model | A total of 1 × 106 PC3 cells or DU145 cells suspended in a mixture of 100 uL PBS and Matrigel were subcutaneously injected into BALB/c nude mice. Tumor weight were measured 2 months after the engraftment. To evaluate the role of METTL3 in tumor metastasis, PC3 cells with or without knockdown of METTL3 were injected into SCID mice through the tail vein (1 × 106 cells per mouse). After eight weeks, mice were sacrificed and their lung tissues were collected for subsequent analyses. | |||
| Experiment 2 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | m6A modification levels were markedly upregulated in human PCa tissues due to increased expression of METTL3. METTL3 mediates m6A modification of USP4 mRNA at A2696, and m6A reader protein YTHDF2 binds to and induces degradation of USP4 mRNA by recruiting RNA-binding protein HNRNPD to the mRNA. Decrease of USP4 fails to remove the ubiquitin group from ELAV-like protein 1 (HuR/ELAVL1) protein, resulting in a reduction of ELAVL1 protein. Lastly, downregulation of ELAVL1 in turn increases ARHGDIA expression, promoting migration and invasion of PCa cells. | |||
| Responsed Disease | Prostate cancer [ICD-11: 2C82] | |||
| Target Regulator | YTH domain-containing family protein 2 (YTHDF2) | READER | ||
| Target Regulation | Down regulation | |||
| In-vitro Model | PC-3 | Prostate carcinoma | Homo sapiens | CVCL_0035 |
| LNCaP | Prostate carcinoma | Homo sapiens | CVCL_0395 | |
| DU145 | Prostate carcinoma | Homo sapiens | CVCL_0105 | |
| In-vivo Model | A total of 1 × 106 PC3 cells or DU145 cells suspended in a mixture of 100 uL PBS and Matrigel were subcutaneously injected into BALB/c nude mice. Tumor weight were measured 2 months after the engraftment. To evaluate the role of METTL3 in tumor metastasis, PC3 cells with or without knockdown of METTL3 were injected into SCID mice through the tail vein (1 × 106 cells per mouse). After eight weeks, mice were sacrificed and their lung tissues were collected for subsequent analyses. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03332 | ||
| Epigenetic Regulator | Lysine-specific demethylase 5A (KDM5A) | |
| Regulated Target | Histone H3 lysine 4 trimethylation (H3K4me3) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Prostate cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00241)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: AC4SITE000248 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963326-7963327:- | [4] | |
| Sequence | TTTATACTCTGGGATGCAACCGACATGTTCAAATGTTTGAA | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | ac4C-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5; ENST00000596459.5 | ||
| External Link | RMBase: ac4C_site_940 | ||
| mod ID: AC4SITE000249 | Click to Show/Hide the Full List | ||
| mod site | chr19:7973821-7973822:- | ||
| Sequence | GACGCCAACTTGTACATCAGCGGGCTCCCGCGGACCATGAC | ||
| Cell/Tissue List | DLD1 | ||
| Seq Type List | acRIP-seq | ||
| Transcript ID List | ENST00000593807.1; ENST00000407627.7; ENST00000596459.5; ENST00000596154.5 | ||
| External Link | RMBase: ac4C_site_941 | ||
Adenosine-to-Inosine editing (A-to-I)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE008927 | Click to Show/Hide the Full List | ||
| mod site | chr19:7976886-7976887:- | [5] | |
| Sequence | AAGTCTAACCTGAGCAACATAGCAAGACCCTGTCTCTACAA | ||
| Transcript ID List | ENST00000596459.5; ENST00000407627.7; rmsk_4929596; ENST00000593807.1; ENST00000596154.5 | ||
| External Link | RMBase: RNA-editing_site_65458 | ||
5-methylcytidine (m5C)
| In total 5 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE001726 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962913-7962914:- | ||
| Sequence | GGAATGGCGGCGGGCCCGTCCAGCGTGGGCCACCACTGGGG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5 | ||
| External Link | RMBase: m5C_site_22403 | ||
| mod ID: M5CSITE001727 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962914-7962915:- | ||
| Sequence | GGGAATGGCGGCGGGCCCGTCCAGCGTGGGCCACCACTGGG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5 | ||
| External Link | RMBase: m5C_site_22404 | ||
| mod ID: M5CSITE001728 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962919-7962920:- | ||
| Sequence | GTCCTGGGAATGGCGGCGGGCCCGTCCAGCGTGGGCCACCA | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m5C_site_22405 | ||
| mod ID: M5CSITE001729 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963182-7963183:- | ||
| Sequence | GGATGGTGGTGAACCTGAAGCATGCTTTAACCTCTAAGACT | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000596459.5; ENST00000407627.7 | ||
| External Link | RMBase: m5C_site_22406 | ||
| mod ID: M5CSITE001730 | Click to Show/Hide the Full List | ||
| mod site | chr19:8005651-8005652:- | [6] | |
| Sequence | GGCGTGTCCGGGCCGCGGGCCGGAGCGGGTCGTGCGCGCTG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000593807.1 | ||
| External Link | RMBase: m5C_site_22407 | ||
N6-methyladenosine (m6A)
| In total 72 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE039167 | Click to Show/Hide the Full List | ||
| mod site | chr19:7959403-7959404:- | [7] | |
| Sequence | GACCATGTGATGTTCCGTTTACAGTGACTTGCTTTGGGGGA | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | brain | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415962 | ||
| mod ID: M6ASITE039168 | Click to Show/Hide the Full List | ||
| mod site | chr19:7959665-7959666:- | [8] | |
| Sequence | TCGGATCCCAGGCAGGGTTCACATTTCCAAACCTTTTTGAT | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415963 | ||
| mod ID: M6ASITE039169 | Click to Show/Hide the Full List | ||
| mod site | chr19:7959749-7959750:- | [8] | |
| Sequence | CGCAAGACAGCCCTGAAGTCACAAGTGCTTTCTTTTAAGTG | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415964 | ||
| mod ID: M6ASITE039170 | Click to Show/Hide the Full List | ||
| mod site | chr19:7960079-7960080:- | [9] | |
| Sequence | GTCCACCAGGCATTGAAAAGACATGACTTACCCAGTCCGGC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | MT4 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415965 | ||
| mod ID: M6ASITE039171 | Click to Show/Hide the Full List | ||
| mod site | chr19:7960784-7960785:- | [10] | |
| Sequence | ACCATTTCTTAAAAAATTTTACATAGATCAGTTGTATTTCT | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415966 | ||
| mod ID: M6ASITE039172 | Click to Show/Hide the Full List | ||
| mod site | chr19:7960871-7960872:- | [8] | |
| Sequence | CTGTGTCCTCAAAGTTCATTACATCTTATCAAGGCCTGTTT | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415967 | ||
| mod ID: M6ASITE039173 | Click to Show/Hide the Full List | ||
| mod site | chr19:7960947-7960948:- | [8] | |
| Sequence | TTGTGGAAGGATTTAGCTTAACAACTGTCACTCCTGAAAAG | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415968 | ||
| mod ID: M6ASITE039174 | Click to Show/Hide the Full List | ||
| mod site | chr19:7961260-7961261:- | [8] | |
| Sequence | CCCCCTGGAGTCTCACTCCCACACATGCCCATAGCTAGCAT | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415969 | ||
| mod ID: M6ASITE039175 | Click to Show/Hide the Full List | ||
| mod site | chr19:7961283-7961284:- | [11] | |
| Sequence | GCGGGATTCCCGCTTCTGAAACTCCCCCTGGAGTCTCACTC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415970 | ||
| mod ID: M6ASITE039176 | Click to Show/Hide the Full List | ||
| mod site | chr19:7961433-7961434:- | [8] | |
| Sequence | CTGATGGAAGGTGGGAGCCAACACCCTTCTGATGGAAGGTG | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415971 | ||
| mod ID: M6ASITE039177 | Click to Show/Hide the Full List | ||
| mod site | chr19:7961941-7961942:- | [10] | |
| Sequence | ACCAGCAGTTTTTAACCTTGACGTGAGACTAAAACGTGACC | ||
| Motif Score | 2.833690476 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415972 | ||
| mod ID: M6ASITE039178 | Click to Show/Hide the Full List | ||
| mod site | chr19:7961968-7961969:- | [10] | |
| Sequence | AGAGAATCACAAACAGGATAACTTAGTACCAGCAGTTTTTA | ||
| Motif Score | 2.590089286 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415973 | ||
| mod ID: M6ASITE039179 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962301-7962302:- | [10] | |
| Sequence | TTTTTACTTTTGCATTTAAGACCATTAAATTTGATTTTGTT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415974 | ||
| mod ID: M6ASITE039180 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962379-7962380:- | [10] | |
| Sequence | TTCTCTTCATAACTGCCTTGACATTTTGGGTTGTTCTGTTC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415975 | ||
| mod ID: M6ASITE039181 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962436-7962437:- | [11] | |
| Sequence | CCAGTTATCTATTAACCAAAACCTTTGATTTGTAGTTTTAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415976 | ||
| mod ID: M6ASITE039182 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962464-7962465:- | [10] | |
| Sequence | CACTCAGCAGAAAAGTACTTACTTCTTGCCAGTTATCTATT | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415977 | ||
| mod ID: M6ASITE039183 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962483-7962484:- | [10] | |
| Sequence | AATTTTGCTTTTGTATGAACACTCAGCAGAAAAGTACTTAC | ||
| Motif Score | 2.506922619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415978 | ||
| mod ID: M6ASITE039184 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962485-7962486:- | [11] | |
| Sequence | GGAATTTTGCTTTTGTATGAACACTCAGCAGAAAAGTACTT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T | ||
| Seq Type List | m6A-seq; DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415979 | ||
| mod ID: M6ASITE039185 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962536-7962537:- | [11] | |
| Sequence | CCCTTCTCGTGAGCGCTTAGACCTTTTTCTATTTTAGTCGG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415980 | ||
| mod ID: M6ASITE039186 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962582-7962583:- | [11] | |
| Sequence | TGTATTTTAATAACACAGAAACATTTGAGCATTGTATTTCT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415981 | ||
| mod ID: M6ASITE039187 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962590-7962591:- | [10] | |
| Sequence | AATGGCTCTGTATTTTAATAACACAGAAACATTTGAGCATT | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415982 | ||
| mod ID: M6ASITE039188 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962629-7962630:- | [8] | |
| Sequence | CCCGTTTTCCAGAGCATTTAACATAGCTTGGAGGCGTAAAA | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415983 | ||
| mod ID: M6ASITE039189 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962705-7962706:- | [8] | |
| Sequence | GACATCCCGAGTTTCTGTCCACACATTGCATGCACAGCGCC | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415984 | ||
| mod ID: M6ASITE039190 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962724-7962725:- | [8] | |
| Sequence | GAAGATGTGTTGCTACTCTGACATCCCGAGTTTCTGTCCAC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415985 | ||
| mod ID: M6ASITE039191 | Click to Show/Hide the Full List | ||
| mod site | chr19:7962848-7962849:- | [11] | |
| Sequence | GGCGGGCCCTCCAGAGAAGGACACAAACGTGTTTCGTAAGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T; MM6 | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415986 | ||
| mod ID: M6ASITE039192 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963073-7963074:- | [10] | |
| Sequence | TTTTAATCTAAAGATGTTAGACAGATGCTGAGTGTGCGTTT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415987 | ||
| mod ID: M6ASITE039193 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963128-7963129:- | [11] | |
| Sequence | TTCATTCAATGTCTCCACAGACTGGGTAGCAAAAAAATCAC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415988 | ||
| mod ID: M6ASITE039194 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963132-7963133:- | [7] | |
| Sequence | GCGTTTCATTCAATGTCTCCACAGACTGGGTAGCAAAAAAA | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415989 | ||
| mod ID: M6ASITE039195 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963156-7963157:- | [7] | |
| Sequence | TTAACCTCTAAGACTGTCTAACACGCGTTTCATTCAATGTC | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | kidney; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415990 | ||
| mod ID: M6ASITE039196 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963164-7963165:- | [11] | |
| Sequence | AGCATGCTTTAACCTCTAAGACTGTCTAACACGCGTTTCAT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596459.5; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415991 | ||
| mod ID: M6ASITE039197 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963190-7963191:- | [11] | |
| Sequence | GTCCCTCTGGATGGTGGTGAACCTGAAGCATGCTTTAACCT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000596459.5; ENST00000407627.7; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415992 | ||
| mod ID: M6ASITE039198 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963218-7963219:- | [10] | |
| Sequence | ATCTAAGTAGAACTGCATTGACTAACCAGTCCCTCTGGATG | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596459.5; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415993 | ||
| mod ID: M6ASITE039199 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963227-7963228:- | [11] | |
| Sequence | TAAACAGAAATCTAAGTAGAACTGCATTGACTAACCAGTCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7; ENST00000596459.5 | ||
| External Link | RMBase: m6A_site_415994 | ||
| mod ID: M6ASITE039200 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963244-7963245:- | [11] | |
| Sequence | TCCTTTAAGATATATATTAAACAGAAATCTAAGTAGAACTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2 | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5; ENST00000596459.5 | ||
| External Link | RMBase: m6A_site_415995 | ||
| mod ID: M6ASITE039201 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963290-7963291:- | [11] | |
| Sequence | TTGAAATCCCACAATGTTAGACCAATCTTAAGTTTCGTAAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596459.5; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415996 | ||
| mod ID: M6ASITE039202 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963300-7963301:- | [8] | |
| Sequence | GTTCAAATGTTTGAAATCCCACAATGTTAGACCAATCTTAA | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000596459.5; ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415997 | ||
| mod ID: M6ASITE039203 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963324-7963325:- | [8] | |
| Sequence | TATACTCTGGGATGCAACCGACATGTTCAAATGTTTGAAAT | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000596459.5; ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_415998 | ||
| mod ID: M6ASITE039204 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963386-7963387:- | [8] | |
| Sequence | CTCATTTTGCGCCAATTTTCACAAGTGTTTGTCTTTGTCTG | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596459.5; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_415999 | ||
| mod ID: M6ASITE039206 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963407-7963408:- | [10] | |
| Sequence | ACTTTTCTTGTTAGTGTACAACTCATTTTGCGCCAATTTTC | ||
| Motif Score | 2.595904762 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7; ENST00000596459.5 | ||
| External Link | RMBase: m6A_site_416000 | ||
| mod ID: M6ASITE039207 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963410-7963411:- | [8] | |
| Sequence | GAAACTTTTCTTGTTAGTGTACAACTCATTTTGCGCCAATT | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000596459.5; ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_416001 | ||
| mod ID: M6ASITE039208 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963427-7963428:- | [12] | |
| Sequence | TTAAGAGTGAAGGAGTTGAAACTTTTCTTGTTAGTGTACAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; A549; HEK293T; LCLs; H1299; iSLK | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596459.5; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_416002 | ||
| mod ID: M6ASITE039209 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963460-7963461:- | [10] | |
| Sequence | TCGCTCATGCTTTTTTTTGTACGGAATAGATAATTAAGAGT | ||
| Motif Score | 2.830077381 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7; ENST00000596459.5 | ||
| External Link | RMBase: m6A_site_416003 | ||
| mod ID: M6ASITE039210 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963489-7963490:- | [8] | |
| Sequence | CTTCAAAACCAACAAGTCCCACAAATAACTCGCTCATGCTT | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5; ENST00000596459.5 | ||
| External Link | RMBase: m6A_site_416004 | ||
| mod ID: M6ASITE039211 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963502-7963503:- | [12] | |
| Sequence | TCTTACAGGTTTCCTTCAAAACCAACAAGTCCCACAAATAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HEK293T; HeLa; A549; HepG2; hNPCs; hESCs; fibroblasts; LCLs; MT4; H1299; MM6; HEK293A-TOA; iSLK; TREX | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000596459.5; ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_416005 | ||
| mod ID: M6ASITE039212 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963528-7963529:- | [12] | |
| Sequence | GAACGGCTACCGCCTGGGGGACAAAATCTTACAGGTTTCCT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HEK293T; HeLa; A549; hESC-HEK293T; HepG2; hNPCs; hESCs; fibroblasts; LCLs; MT4; H1299; MM6; HEK293A-TOA; iSLK; TREX; AML | ||
| Seq Type List | MeRIP-seq; MAZTER-seq; m6A-seq; miCLIP | ||
| Transcript ID List | ENST00000596459.5; ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_416006 | ||
| mod ID: M6ASITE039213 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963582-7963583:- | [12] | |
| Sequence | TGGCTTTGTGACCATGACAAACTATGAAGAAGCCGCGATGG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HEK293T; HeLa; HepG2; hNPCs; hESCs; fibroblasts; A549; CD8T; MT4; MM6; Huh7; HEK293A-TOA; TREX | ||
| Seq Type List | MeRIP-seq; m6A-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000596459.5; ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_416007 | ||
| mod ID: M6ASITE039214 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963586-7963587:- | [8] | |
| Sequence | GGTTTGGCTTTGTGACCATGACAAACTATGAAGAAGCCGCG | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000407627.7; ENST00000596459.5 | ||
| External Link | RMBase: m6A_site_416008 | ||
| mod ID: M6ASITE039215 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963592-7963593:- | [13] | |
| Sequence | GCAAAGGGTTTGGCTTTGTGACCATGACAAACTATGAAGAA | ||
| Motif Score | 2.839113095 | ||
| Cell/Tissue List | AML | ||
| Seq Type List | miCLIP | ||
| Transcript ID List | ENST00000407627.7; ENST00000596459.5; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_416009 | ||
| mod ID: M6ASITE039216 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963618-7963619:- | [8] | |
| Sequence | GATCCGCGACTTCAACACCAACAAGTGCAAAGGGTTTGGCT | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000596459.5; ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_416010 | ||
| mod ID: M6ASITE039217 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963624-7963625:- | [8] | |
| Sequence | GAAAGTGATCCGCGACTTCAACACCAACAAGTGCAAAGGGT | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5; ENST00000596459.5 | ||
| External Link | RMBase: m6A_site_416011 | ||
| mod ID: M6ASITE039218 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963717-7963718:- | [8] | |
| Sequence | CGGCTGGTGCATTTTCATCTACAACCTGGGGCAGGATGCCG | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000593807.1; ENST00000596154.5; ENST00000596459.5 | ||
| External Link | RMBase: m6A_site_416012 | ||
| mod ID: M6ASITE039219 | Click to Show/Hide the Full List | ||
| mod site | chr19:7963783-7963784:- | [8] | |
| Sequence | CTCCCCCATGGGCGTCGATCACATGAGCGGGCTCTCTGGCG | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000593807.1; ENST00000407627.7; ENST00000596459.5 | ||
| External Link | RMBase: m6A_site_416013 | ||
| mod ID: M6ASITE039220 | Click to Show/Hide the Full List | ||
| mod site | chr19:7967651-7967652:- | [8] | |
| Sequence | TGCAGCCAACCCCAACCAGAACAAAAACGTGGCACTCCTCT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hESC-HEK293T; Huh7 | ||
| Seq Type List | MAZTER-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000593807.1; ENST00000596459.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_416014 | ||
| mod ID: M6ASITE039221 | Click to Show/Hide the Full List | ||
| mod site | chr19:7967707-7967708:- | [14] | |
| Sequence | ACCAGTTTCAATGGTCATAAACCCCCAGGTTCCTCTGAGCC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000596459.5; ENST00000407627.7; ENST00000593807.1 | ||
| External Link | RMBase: m6A_site_416015 | ||
| mod ID: M6ASITE039222 | Click to Show/Hide the Full List | ||
| mod site | chr19:7967752-7967753:- | [10] | |
| Sequence | GCGTTTATCCGGTTTGACAAACGGTCGGAGGCAGAAGAGGC | ||
| Motif Score | 2.179660714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596459.5; ENST00000596154.5; ENST00000593807.1 | ||
| External Link | RMBase: m6A_site_416016 | ||
| mod ID: M6ASITE039223 | Click to Show/Hide the Full List | ||
| mod site | chr19:7967756-7967757:- | [8] | |
| Sequence | GGTTGCGTTTATCCGGTTTGACAAACGGTCGGAGGCAGAAG | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000596154.5; ENST00000593807.1; ENST00000407627.7; ENST00000596459.5 | ||
| External Link | RMBase: m6A_site_416017 | ||
| mod ID: M6ASITE039224 | Click to Show/Hide the Full List | ||
| mod site | chr19:7972908-7972909:- | [14] | |
| Sequence | GAGGCAGGAGAATCGCCTGGACCCCAGGAGGCGGAGATTGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5; rmsk_4929588; ENST00000595499.1; ENST00000593807.1; ENST00000596459.5 | ||
| External Link | RMBase: m6A_site_416018 | ||
| mod ID: M6ASITE039225 | Click to Show/Hide the Full List | ||
| mod site | chr19:7973727-7973728:- | [7] | |
| Sequence | GGGTCCTCGTGGATCAGACTACAGGTACCAGAGGGGCCCCA | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000595499.1; ENST00000596154.5; ENST00000593807.1; ENST00000596459.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_416019 | ||
| mod ID: M6ASITE039226 | Click to Show/Hide the Full List | ||
| mod site | chr19:7973783-7973784:- | [8] | |
| Sequence | GACCCAGAAGGACGTAGAAGACATGTTCTCTCGGTTTGGGC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hESC-HEK293T; HepG2 | ||
| Seq Type List | MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000595499.1; ENST00000407627.7; ENST00000593807.1; ENST00000596459.5; ENST00000596154.5 | ||
| External Link | RMBase: m6A_site_416020 | ||
| mod ID: M6ASITE039227 | Click to Show/Hide the Full List | ||
| mod site | chr19:7973808-7973809:- | [15] | |
| Sequence | ACATCAGCGGGCTCCCGCGGACCATGACCCAGAAGGACGTA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000593807.1; ENST00000596154.5; ENST00000596459.5 | ||
| External Link | RMBase: m6A_site_416021 | ||
| mod ID: M6ASITE039228 | Click to Show/Hide the Full List | ||
| mod site | chr19:7973828-7973829:- | [8] | |
| Sequence | GATCAAAGACGCCAACTTGTACATCAGCGGGCTCCCGCGGA | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000593807.1; ENST00000596459.5; ENST00000596154.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_416022 | ||
| mod ID: M6ASITE039229 | Click to Show/Hide the Full List | ||
| mod site | chr19:7981090-7981091:- | [15] | |
| Sequence | GCTTGAGGCTCCAGTCAAAAACCATTAAGGTAAAGGGATCT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596154.5; ENST00000596459.5; ENST00000593807.1 | ||
| External Link | RMBase: m6A_site_416023 | ||
| mod ID: M6ASITE039230 | Click to Show/Hide the Full List | ||
| mod site | chr19:7981122-7981123:- | [8] | |
| Sequence | GGATGCAGAGAGAGCGATCAACACGCTGAACGGCTTGAGGC | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000596459.5; ENST00000407627.7; ENST00000593807.1 | ||
| External Link | RMBase: m6A_site_416024 | ||
| mod ID: M6ASITE039231 | Click to Show/Hide the Full List | ||
| mod site | chr19:7981158-7981159:- | [11] | |
| Sequence | CTTGGGCTATGGCTTTGTGAACTACGTGACCGCGAAGGATG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; MT4; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000596459.5; ENST00000593807.1; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_416025 | ||
| mod ID: M6ASITE039232 | Click to Show/Hide the Full List | ||
| mod site | chr19:7981184-7981185:- | [8] | |
| Sequence | TTCATGTTCTCTTGCACAGGACACAGCTTGGGCTATGGCTT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000593807.1; ENST00000596459.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_416026 | ||
| mod ID: M6ASITE039233 | Click to Show/Hide the Full List | ||
| mod site | chr19:7991665-7991666:- | [11] | |
| Sequence | GGTGAAGTTGAATCTGCAAAACTTATTCGGGATAAAGTAGC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; MT4; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000593807.1; ENST00000596459.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_416027 | ||
| mod ID: M6ASITE039234 | Click to Show/Hide the Full List | ||
| mod site | chr19:7991726-7991727:- | [11] | |
| Sequence | CGTCAACTACCTCCCTCAGAACATGACCCAGGATGAGTTAC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; MT4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000593807.1; ENST00000407627.7; ENST00000596459.5 | ||
| External Link | RMBase: m6A_site_416028 | ||
| mod ID: M6ASITE039235 | Click to Show/Hide the Full List | ||
| mod site | chr19:7991768-7991769:- | [8] | |
| Sequence | GGCCGAAGACTGCAGGGGTGACATCGGGAGAACGAATTTGA | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000596459.5; ENST00000407627.7; ENST00000593807.1 | ||
| External Link | RMBase: m6A_site_416029 | ||
| mod ID: M6ASITE039236 | Click to Show/Hide the Full List | ||
| mod site | chr19:7991780-7991781:- | [11] | |
| Sequence | TGAAGACCACATGGCCGAAGACTGCAGGGGTGACATCGGGA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; MT4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000596459.5; ENST00000407627.7; ENST00000593807.1 | ||
| External Link | RMBase: m6A_site_416030 | ||
| mod ID: M6ASITE039237 | Click to Show/Hide the Full List | ||
| mod site | chr19:7991792-7991793:- | [7] | |
| Sequence | GTCTAATGGTTATGAAGACCACATGGCCGAAGACTGCAGGG | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000596459.5; ENST00000593807.1; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_416031 | ||
| mod ID: M6ASITE039238 | Click to Show/Hide the Full List | ||
| mod site | chr19:7991795-7991796:- | [11] | |
| Sequence | AATGTCTAATGGTTATGAAGACCACATGGCCGAAGACTGCA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; MT4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000407627.7; ENST00000596459.5; ENST00000593807.1 | ||
| External Link | RMBase: m6A_site_416032 | ||
| mod ID: M6ASITE039239 | Click to Show/Hide the Full List | ||
| mod site | chr19:7991817-7991818:- | [8] | |
| Sequence | TTGGCAGATTTTTGAAAAATACAATGTCTAATGGTTATGAA | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000593807.1; ENST00000596459.5; ENST00000407627.7 | ||
| External Link | RMBase: m6A_site_416033 | ||
References



