General Information of the m6A Target Gene (ID: M6ATAR00238)
Target Name E3 SUMO-protein ligase EGR2 (EGR2)
Synonyms
AT591; E3 SUMO-protein transferase ERG2; Early growth response protein 2; EGR-2; Zinc finger protein Krox-20; KROX20
    Click to Show/Hide
Gene Name EGR2
Chromosomal Location 10q21.3
Family EGR C2H2-type zinc-finger protein family
Function
Sequence-specific DNA-binding transcription factor. Plays a role in hindbrain segmentation by regulating the expression of a subset of homeobox containing genes and in Schwann cell myelination by regulating the expression of genes involved in the formation and maintenance of myelin (By similarity). Binds to two EGR2-consensus sites EGR2A (5'-CTGTAGGAG-3') and EGR2B (5'-ATGTAGGTG-3') in the HOXB3 enhancer and promotes HOXB3 transcriptional activation (By similarity). Binds to specific DNA sites located in the promoter region of HOXA4, HOXB2 and ERBB2 (By similarity). Regulates hindbrain segmentation by controlling the expression of Hox genes, such as HOXA4, HOXB3 and HOXB2, and thereby specifying odd and even rhombomeres (By similarity). Promotes the expression of HOXB3 in the rhombomere r5 in the hindbrain (By similarity). Regulates myelination in the peripheral nervous system after birth, possibly by regulating the expression of myelin proteins, such as MPZ, and by promoting the differentiation of Schwann cells (By similarity). Involved in the development of the jaw openener musculature, probably by playing a role in its innervation through trigeminal motor neurons (By similarity). May play a role in adipogenesis, possibly by regulating the expression of CEBPB (By similarity). E3 SUMO-protein ligase helping SUMO1 conjugation to its coregulators NAB1 and NAB2, whose sumoylation down-regulates EGR2 transcriptional activity.
    Click to Show/Hide
Gene ID 1959
Uniprot ID
EGR2_HUMAN
HGNC ID
HGNC:3239
KEGG ID
hsa:1959
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
EGR2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, CDK4, E3 SUMO-protein ligase EGR2 (EGR2), YBX1, and TLX, which were associated with lung cancers.
Responsed Disease Lung cancer ICD-11: 2C25
Cell Process Cell apoptosis
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H520 Lung squamous cell carcinoma Homo sapiens CVCL_1566
HBE (Human bronchial epithelial cell line)
LTEP-a2 Endocervical adenocarcinoma Homo sapiens CVCL_6929
SK-MES-1 Lung squamous cell carcinoma Homo sapiens CVCL_0630
Protein virilizer homolog (VIRMA) [WRITER]
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, CDK4, E3 SUMO-protein ligase EGR2 (EGR2), YBX1, and TLX, which were associated with lung cancers.
Responsed Disease Lung cancer ICD-11: 2C25
Cell Process Cell apoptosis
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H520 Lung squamous cell carcinoma Homo sapiens CVCL_1566
HBE (Human bronchial epithelial cell line)
LTEP-a2 Endocervical adenocarcinoma Homo sapiens CVCL_6929
SK-MES-1 Lung squamous cell carcinoma Homo sapiens CVCL_0630
Lung cancer [ICD-11: 2C25]
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, CDK4, E3 SUMO-protein ligase EGR2 (EGR2), YBX1, and TLX, which were associated with lung cancers.
Responsed Disease Lung cancer [ICD-11: 2C25]
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) READER
Cell Process Cell apoptosis
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H520 Lung squamous cell carcinoma Homo sapiens CVCL_1566
HBE (Human bronchial epithelial cell line)
LTEP-a2 Endocervical adenocarcinoma Homo sapiens CVCL_6929
SK-MES-1 Lung squamous cell carcinoma Homo sapiens CVCL_0630
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary GSEA revealed that KIAA1429, METTL3, and IGF2BP1 were significantly related to multiple biological behaviors, including proliferation, apoptosis, metastasis, energy metabolism, drug resistance, and recurrence, and that KIAA1429 and IGF2BP1 had potential target genes, including E2F3, WTAP, CCND1, CDK4, E3 SUMO-protein ligase EGR2 (EGR2), YBX1, and TLX, which were associated with lung cancers.
Responsed Disease Lung cancer [ICD-11: 2C25]
Target Regulator Protein virilizer homolog (VIRMA) WRITER
Cell Process Cell apoptosis
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H520 Lung squamous cell carcinoma Homo sapiens CVCL_1566
HBE (Human bronchial epithelial cell line)
LTEP-a2 Endocervical adenocarcinoma Homo sapiens CVCL_6929
SK-MES-1 Lung squamous cell carcinoma Homo sapiens CVCL_0630
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00238)
E3 SUMO-protein ligase EGR2 (EGR2)
N6-methyladenosine (m6A)
In total 34 m6A sequence/site(s) in this target gene
mod ID: M6ASITE000108 Click to Show/Hide the Full List
mod site chr10:62812600-62812601:- [2]
Sequence ATGTATTATAAACTCAGAGAACAGAAGTGCAATGTGATGGG
Motif Score 2.951386905
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000439032.4; ENST00000242480.4; ENST00000411732.3; ENST00000639815.1
External Link RMBase: m6A_site_102433
mod ID: M6ASITE000109 Click to Show/Hide the Full List
mod site chr10:62812609-62812610:- [2]
Sequence TGAAGCAATATGTATTATAAACTCAGAGAACAGAAGTGCAA
Motif Score 2.627720238
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000439032.4; ENST00000242480.4; ENST00000639815.1; ENST00000411732.3
External Link RMBase: m6A_site_102434
mod ID: M6ASITE000110 Click to Show/Hide the Full List
mod site chr10:62812718-62812719:- [2]
Sequence GCTTGGGACTGATTTGGGGGACATTGTACAGTGAGTGAAGT
Motif Score 3.643047619
Cell/Tissue List GM12878; LCLs; HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000242480.4; ENST00000411732.3; ENST00000439032.4; ENST00000639815.1
External Link RMBase: m6A_site_102435
mod ID: M6ASITE000111 Click to Show/Hide the Full List
mod site chr10:62812731-62812732:- [2]
Sequence TGTGCACTTTATGGCTTGGGACTGATTTGGGGGACATTGTA
Motif Score 4.065041667
Cell/Tissue List GM12878; LCLs; CD8T; HEK293A-TOA
Seq Type List m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000411732.3; ENST00000639815.1; ENST00000242480.4; ENST00000439032.4
External Link RMBase: m6A_site_102436
mod ID: M6ASITE000112 Click to Show/Hide the Full List
mod site chr10:62812756-62812757:- [2]
Sequence ACAGCAAAAAGACAAGCAAAACTGATGTGCACTTTATGGCT
Motif Score 2.627720238
Cell/Tissue List GM12878; LCLs; CD8T; HEK293A-TOA
Seq Type List m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000242480.4; ENST00000439032.4; ENST00000411732.3; ENST00000639815.1
External Link RMBase: m6A_site_102437
mod ID: M6ASITE000113 Click to Show/Hide the Full List
mod site chr10:62812765-62812766:- [3]
Sequence CAAGTGGGGACAGCAAAAAGACAAGCAAAACTGATGTGCAC
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T; GM12878; LCLs; CD8T; HEK293A-TOA
Seq Type List MAZTER-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000439032.4; ENST00000242480.4; ENST00000639815.1; ENST00000411732.3
External Link RMBase: m6A_site_102438
mod ID: M6ASITE000114 Click to Show/Hide the Full List
mod site chr10:62812776-62812777:- [2]
Sequence GCTGATCCCTTCAAGTGGGGACAGCAAAAAGACAAGCAAAA
Motif Score 3.643047619
Cell/Tissue List GM12878; LCLs; HEK293A-TOA
Seq Type List m6A-seq
Transcript ID List ENST00000242480.4; ENST00000411732.3; ENST00000639815.1; ENST00000439032.4
External Link RMBase: m6A_site_102439
mod ID: M6ASITE000115 Click to Show/Hide the Full List
mod site chr10:62813032-62813033:- [2]
Sequence AGAAGCAGGTTCTTCCTAAAACTTAGCCCATTCTAGTCTCT
Motif Score 2.627720238
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000242480.4; ENST00000639815.1; ENST00000411732.3; ENST00000439032.4
External Link RMBase: m6A_site_102440
mod ID: M6ASITE000116 Click to Show/Hide the Full List
mod site chr10:62813133-62813134:- [4]
Sequence CCACTGGAGCTGCACAACAAACACTACCACCCTTTCCTGTC
Motif Score 2.20572619
Cell/Tissue List A549; hESC-HEK293T; GM12878; LCLs; CD8T; CD4T; GSC-11; HEK293A-TOA; iSLK; endometrial
Seq Type List MeRIP-seq; MAZTER-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000242480.4; ENST00000411732.3; ENST00000639815.1; ENST00000439032.4
External Link RMBase: m6A_site_102441
mod ID: M6ASITE000117 Click to Show/Hide the Full List
mod site chr10:62813137-62813138:- [3]
Sequence TTGTCCACTGGAGCTGCACAACAAACACTACCACCCTTTCC
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T; CD8T
Seq Type List MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000411732.3; ENST00000639815.1; ENST00000242480.4; ENST00000439032.4
External Link RMBase: m6A_site_102442
mod ID: M6ASITE000118 Click to Show/Hide the Full List
mod site chr10:62813199-62813200:- [4]
Sequence CCCGGACACCTTGAGATGAGACTCAGGCTGATACACCAGCT
Motif Score 3.319380952
Cell/Tissue List A549; H1A; GM12878; LCLs; CD8T; CD4T; GSC-11; HEK293A-TOA; endometrial; GSCs; NB4
Seq Type List MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000639815.1; ENST00000242480.4; ENST00000439032.4; ENST00000411732.3
External Link RMBase: m6A_site_102443
mod ID: M6ASITE000119 Click to Show/Hide the Full List
mod site chr10:62813214-62813215:- [4]
Sequence CTTGCTCCTCTCGGACCCGGACACCTTGAGATGAGACTCAG
Motif Score 3.643047619
Cell/Tissue List A549; hESC-HEK293T; H1A; GM12878; LCLs; CD8T; CD4T; GSC-11; HEK293A-TOA; endometrial; GSCs; NB4
Seq Type List MeRIP-seq; MAZTER-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000639815.1; ENST00000242480.4; ENST00000411732.3; ENST00000439032.4
External Link RMBase: m6A_site_102444
mod ID: M6ASITE000120 Click to Show/Hide the Full List
mod site chr10:62813220-62813221:- [4]
Sequence TCGCCCCTTGCTCCTCTCGGACCCGGACACCTTGAGATGAG
Motif Score 3.622404762
Cell/Tissue List A549; H1A; GM12878; LCLs; CD8T; CD4T; GSC-11; HEK293A-TOA; endometrial; GSCs; NB4
Seq Type List MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000242480.4; ENST00000411732.3; ENST00000639815.1; ENST00000439032.4
External Link RMBase: m6A_site_102445
mod ID: M6ASITE000121 Click to Show/Hide the Full List
mod site chr10:62813371-62813372:- [2]
Sequence CACACCAAGATCCACCTGAGACAGAAAGAGCGGAAAAGCAG
Motif Score 2.897386905
Cell/Tissue List GM12878; LCLs; MT4; CD4T; GSC-11; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000411732.3; ENST00000242480.4; ENST00000439032.4; ENST00000639815.1
External Link RMBase: m6A_site_102446
mod ID: M6ASITE000122 Click to Show/Hide the Full List
mod site chr10:62813650-62813651:- [2]
Sequence CCTCGCAAGTACCCCAACAGACCCAGCAAGACGCCGGTGCA
Motif Score 2.876744048
Cell/Tissue List GM12878; LCLs; CD8T; MT4; CD4T; GSC-11; HEK293A-TOA
Seq Type List m6A-seq; m6A-CLIP/IP; MeRIP-seq
Transcript ID List ENST00000439032.4; ENST00000242480.4; ENST00000411732.3; ENST00000639815.1
External Link RMBase: m6A_site_102447
mod ID: M6ASITE000123 Click to Show/Hide the Full List
mod site chr10:62813764-62813765:- [4]
Sequence GCCAGTGGAGGCAGCGAGGGACCCCGGCTGCCTGGTAGCAG
Motif Score 3.622404762
Cell/Tissue List A549; GM12878; LCLs; CD4T; GSC-11; HEK293A-TOA; iSLK
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000639815.1; ENST00000411732.3; ENST00000242480.4; ENST00000439032.4
External Link RMBase: m6A_site_102448
mod ID: M6ASITE000124 Click to Show/Hide the Full List
mod site chr10:62813791-62813792:- [4]
Sequence CCCAGTGCTGGGGTGACCGGACCAGGGGCCAGTGGAGGCAG
Motif Score 3.622404762
Cell/Tissue List A549; GM12878; LCLs; CD4T; GSC-11; HEK293A-TOA; iSLK; TIME
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000439032.4; ENST00000411732.3; ENST00000639815.1; ENST00000242480.4
External Link RMBase: m6A_site_102449
mod ID: M6ASITE000125 Click to Show/Hide the Full List
mod site chr10:62813828-62813829:- [5]
Sequence TCCACTCTCTACAATCCGTAACTTTACCCTGGGGGGCCCCA
Motif Score 2.590089286
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000439032.4; ENST00000411732.3; ENST00000242480.4; ENST00000639815.1
External Link RMBase: m6A_site_102450
mod ID: M6ASITE000126 Click to Show/Hide the Full List
mod site chr10:62813876-62813877:- [4]
Sequence GCCCTTTCCCTGCCCACTGGACACCCTGCGGGTGCCCCCTC
Motif Score 3.643047619
Cell/Tissue List HEK293T; A549; H1B; GM12878; LCLs; CD4T; HEK293A-TOA; iSLK
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000411732.3; ENST00000439032.4; ENST00000639815.1; ENST00000242480.4
External Link RMBase: m6A_site_102451
mod ID: M6ASITE000127 Click to Show/Hide the Full List
mod site chr10:62813903-62813904:- [4]
Sequence ACATGGTACAGCTGGCCCAGACCGTAAGCCCTTTCCCTGCC
Motif Score 2.876744048
Cell/Tissue List HEK293T; A549; H1B; GM12878; LCLs; MT4; CD4T; GSC-11; HEK293A-TOA; iSLK
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000439032.4; ENST00000639815.1; ENST00000242480.4; ENST00000411732.3
External Link RMBase: m6A_site_102452
mod ID: M6ASITE000128 Click to Show/Hide the Full List
mod site chr10:62813927-62813928:- [4]
Sequence TCCATCTCAGTGCCAGAGAGACCTACATGGTACAGCTGGCC
Motif Score 2.876744048
Cell/Tissue List HEK293T; A549; H1B; GM12878; LCLs; MT4; CD4T; GSC-11; HEK293A-TOA; iSLK
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000439032.4; ENST00000411732.3; ENST00000242480.4; ENST00000639815.1
External Link RMBase: m6A_site_102453
mod ID: M6ASITE000129 Click to Show/Hide the Full List
mod site chr10:62813963-62813964:- [6]
Sequence TCTCTTCCCAATGATCCCAGACTATCCTGGATTCTTTCCAT
Motif Score 3.319380952
Cell/Tissue List HEK293T; H1B; A549; GM12878; LCLs; CD8T; MT4; CD4T; GSC-11; HEK293A-TOA; iSLK; NB4
Seq Type List MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000242480.4; ENST00000639815.1; ENST00000411732.3; ENST00000439032.4
External Link RMBase: m6A_site_102454
mod ID: M6ASITE000130 Click to Show/Hide the Full List
mod site chr10:62813990-62813991:- [6]
Sequence ATCCCCCAAGCCAGCCACGGACCCAGGTCTCTTCCCAATGA
Motif Score 3.622404762
Cell/Tissue List HEK293T; H1B; GM12878; LCLs; MT4; CD4T; GSC-11; HEK293A-TOA; iSLK
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000411732.3; ENST00000242480.4; ENST00000439032.4; ENST00000639815.1
External Link RMBase: m6A_site_102455
mod ID: M6ASITE000131 Click to Show/Hide the Full List
mod site chr10:62814086-62814087:- [2]
Sequence TGCAGGAGACCTCTACCAGGACCCTTCTGCGTTCCTGTCAG
Motif Score 3.622404762
Cell/Tissue List HEK293T; GM12878; LCLs; MT4; CD4T; GSC-11
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000439032.4; ENST00000639815.1; ENST00000242480.4; ENST00000411732.3
External Link RMBase: m6A_site_102456
mod ID: M6ASITE000132 Click to Show/Hide the Full List
mod site chr10:62814098-62814099:- [2]
Sequence TTATTCTGGCTGTGCAGGAGACCTCTACCAGGACCCTTCTG
Motif Score 2.876744048
Cell/Tissue List HEK293T; GM12878; LCLs; MT4
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000439032.4; ENST00000411732.3; ENST00000639815.1; ENST00000242480.4
External Link RMBase: m6A_site_102457
mod ID: M6ASITE000133 Click to Show/Hide the Full List
mod site chr10:62814152-62814153:- [2]
Sequence CCAGACCCAGCCTGACCTGGACCACCTGTACTCTCCGCCAC
Motif Score 3.622404762
Cell/Tissue List HEK293T; GM12878; LCLs; CD8T; MT4
Seq Type List MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000439032.4; ENST00000639815.1; ENST00000242480.4; ENST00000411732.3
External Link RMBase: m6A_site_102458
mod ID: M6ASITE000134 Click to Show/Hide the Full List
mod site chr10:62814168-62814169:- [2]
Sequence GTGTGTGCACCATGTCCCAGACCCAGCCTGACCTGGACCAC
Motif Score 2.876744048
Cell/Tissue List HEK293T; GM12878; LCLs; MT4
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000242480.4; ENST00000411732.3; ENST00000439032.4; ENST00000639815.1
External Link RMBase: m6A_site_102459
mod ID: M6ASITE000135 Click to Show/Hide the Full List
mod site chr10:62814196-62814197:- [2]
Sequence CCCAACCCACTGGCCACAGGACCCCTGGGTGTGTGCACCAT
Motif Score 3.622404762
Cell/Tissue List GM12878; LCLs; CD8T; MT4
Seq Type List m6A-seq; m6A-CLIP/IP; MeRIP-seq
Transcript ID List ENST00000439032.4; ENST00000411732.3; ENST00000639815.1; ENST00000242480.4
External Link RMBase: m6A_site_102460
mod ID: M6ASITE000136 Click to Show/Hide the Full List
mod site chr10:62814372-62814373:- [7]
Sequence TCTCTGCACCTAGAAACCAGACCTTCACTTACATGGGCAAG
Motif Score 2.876744048
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000637191.1; ENST00000242480.4; ENST00000639815.1; ENST00000439032.4; ENST00000411732.3
External Link RMBase: m6A_site_102461
mod ID: M6ASITE000137 Click to Show/Hide the Full List
mod site chr10:62814377-62814378:- [7]
Sequence TCCCGTCTCTGCACCTAGAAACCAGACCTTCACTTACATGG
Motif Score 2.185083333
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000439032.4; ENST00000242480.4; ENST00000637191.1; ENST00000639815.1; ENST00000411732.3
External Link RMBase: m6A_site_102462
mod ID: M6ASITE000138 Click to Show/Hide the Full List
mod site chr10:62816305-62816306:- [3]
Sequence ACTCACTGACTGTTATAATAACACTACACCAGCAACTCCTG
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T; CD8T
Seq Type List MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000411732.3; ENST00000637191.1; ENST00000242480.4; ENST00000493899.2; ENST00000439032.4
External Link RMBase: m6A_site_102463
mod ID: M6ASITE000139 Click to Show/Hide the Full List
mod site chr10:62816325-62816326:- [7]
Sequence ATTAATAGCTCGGCGAGGGGACTCACTGACTGTTATAATAA
Motif Score 4.065041667
Cell/Tissue List MT4; CD4T
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000242480.4; ENST00000637191.1; ENST00000493899.2; ENST00000439032.4
External Link RMBase: m6A_site_102464
mod ID: M6ASITE000140 Click to Show/Hide the Full List
mod site chr10:62816364-62816365:- [5]
Sequence AGAGCAACACTTTCCGTCTAACTGAGCGAGGAGCAATTGAT
Motif Score 2.590089286
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000242480.4; ENST00000439032.4; ENST00000493899.2; ENST00000637191.1
External Link RMBase: m6A_site_102465
mod ID: M6ASITE000141 Click to Show/Hide the Full List
mod site chr10:62818577-62818578:- [7]
Sequence GTCAGCGCGGGGGCCGCGGGACCCGCCAGAGCGCAGGCGGA
Motif Score 3.622404762
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000439032.4; ENST00000493899.2
External Link RMBase: m6A_site_102466