m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00237)

Target Name	Epidermal growth factor receptor (EGFR)
Synonyms	Proto-oncogene c-ErbB-1; Receptor tyrosine-protein kinase erbB-1; ERBB; ERBB1; HER1 Click to Show/Hide
Gene Name	EGFR
Chromosomal Location	7p11.2
Family	protein kinase superfamily; Tyr protein kinase family; EGF receptor subfamily
Function	Receptor tyrosine kinase binding ligands of the EGF family and activating several signaling cascades to convert extracellular cues into appropriate cellular responses. Known ligands include EGF, TGFA/TGF-alpha, AREG, epigen/EPGN, BTC/betacellulin, epiregulin/EREG and HBEGF/heparin-binding EGF. Ligand binding triggers receptor homo- and/or heterodimerization and autophosphorylation on key cytoplasmic residues. The phosphorylated receptor recruits adapter proteins like GRB2 which in turn activates complex downstream signaling cascades. Activates at least 4 major downstream signaling cascades including the RAS-RAF-MEK-ERK, PI3 kinase-AKT, PLCgamma-PKC and STATs modules. May also activate the NF-kappa-B signaling cascade. Also directly phosphorylates other proteins like RGS16, activating its GTPase activity and probably coupling the EGF receptor signaling to the G protein-coupled receptor signaling. Also phosphorylates MUC1 and increases its interaction with SRC and CTNNB1/beta-catenin. Positively regulates cell migration via interaction with CCDC88A/GIV which retains EGFR at the cell membrane following ligand stimulation, promoting EGFR signaling which triggers cell migration. Plays a role in enhancing learning and memory performance (By similarity). Isoform 2 may act as an antagonist of EGF action. (Microbial infection) Acts as a receptor for hepatitis C virus (HCV) in hepatocytes and facilitates its cell entry. Mediates HCV entry by promoting the formation of the CD81-CLDN1 receptor complexes that are essential for HCV entry and by enhancing membrane fusion of cells expressing HCV envelope glycoproteins. Click to Show/Hide
Gene ID	1956
Uniprot ID	EGFR_HUMAN
HGNC ID	HGNC:3236
KEGG ID	hsa:1956

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

EGFR can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF1*
Cell Line	AGS cell line	Homo sapiens
Treatment: shYTHDF1 AGS Control: shControl AGS		GSE159425
Regulation		logFC: -6.10E-01 p-value: 2.21E-04
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between EGFR and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 2.78E+00	GSE63591

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	YTHDF1 regulates the translation of Epidermal growth factor receptor (EGFR) mRNA via binding m6 A sites in the 3'-UTR of EGFR transcript. YTHDF1 is upregulated in ICC and associated with shorter survival of ICC patients.
Target Regulation	Up regulation
Responsed Disease	Intrahepatic cholangiocarcinoma		ICD-11: 2C12.10	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
	Cell migration
	Cell nvasion
In-vitro Model	HuCC-T1	Intrahepatic cholangiocarcinoma	Homo sapiens	CVCL_0324
	RBE	Intrahepatic cholangiocarcinoma	Homo sapiens	CVCL_4896
In-vivo Model	For the subcutaneous implantation ICC mouse model, 6-week-old male NCG mice (Jiangsu, China) were randomly enrolled into shNC group and shYTHDF1 group (n = 9); 1 × 10⁶ HuCCT1 cells in 0.1-mL PBS transfected with shNC or shYTHDF1 were subcutaneously inoculated in the right flanks of the mice. For AKT/YapS127A-induced orthotopic ICC mouse model, 16 mice were divided into two groups randomly. For the control group, 20-ug AKT, 30-ug Yap, and 2-ug pCMV/SB plasmids plus 20-ug vector plasmids as control were diluted in 2-mL saline and then were injected into the lateral tail vein within 7 s. For the YTHDF1-overexpressed group, mice were injected with additional 20-ug YTHDF1 plasmids under the same conditions. Mice were sacrificed at 4 weeks after injection, and liver tissues were harvested for analysis.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Sublethal heat treatment increases epidermal factor growth receptor (EGFR) m6A modification in the vicinity of the 5' untranslated region and promotes its binding with YTHDF1, which enhances the translation of Epidermal growth factor receptor (EGFR) mRNA. Combination of YTHDF1 silencing and EGFR inhibition suppressed the malignancies of HCC cells synergically.
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Pathway Response	mRNA surveillance pathway			hsa03015), RNA degradation
Cell Process	RNA stability
In-vivo Model	The caudal vein injection mouse model, intrasplenic injection mouse model, and orthotopic xenograft IRFA HCC mouse models, including patient-derived xenograft (PDX), and cell-line-derived xenograft implantation models, were established as reported.

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	HepG2 cell line	Homo sapiens
Treatment: shMETTL14 HepG2 cells Control: shCtrl HepG2 cells		GSE121949
Regulation		logFC: 1.00E+00 p-value: 2.28E-08
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL14 was found to inhibit HCC cell migration, invasion, and EMT through modulating Epidermal growth factor receptor (EGFR)/PI3K/AKT signaling pathway in an m6A-dependent manner.
Target Regulation	Down regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	YY-8103	Adult hepatocellular carcinoma	Homo sapiens	CVCL_WY40
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
	HCCLM3	Adult hepatocellular carcinoma	Homo sapiens	CVCL_6832
	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
In-vivo Model	For the lung metastasis model, stably transfected HepG2 cells (1 × 10⁶/0.1 mL DMEM) were injected into each nude mouse through the tail vein. Five weeks later, mice were euthanized, and the lung tissues were collected.

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	ARPE-19 cell line	Homo sapiens
Treatment: shMETTL3 ARPE-19 cells Control: shControl ARPE-19 cells		GSE202017
Regulation		logFC: -6.74E-01 p-value: 1.53E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	METTL3 increased the m6A modification of Epidermal growth factor receptor (EGFR) mRNA in A375R cells, which promoted its translation efficiency. Inhibiting METTL3 function to restore PLX4032 sensitivity in patients with melanoma.
Target Regulation	Up regulation
Responsed Disease	Melanoma		ICD-11: 2C30	Disease Info
Responsed Drug	PLX4032		Approved	Drug Info
Pathway Response	EGFR tyrosine kinase inhibitor resistance			hsa01521
Cell Process	Cell apoptosis
In-vitro Model	A375-R	Amelanotic melanoma	Homo sapiens	CVCL_6234

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	143B cell line	Homo sapiens
Treatment: siALKBH5 transfected 143B cells Control: siControl 143B cells		GSE154528
Regulation		logFC: 9.50E-01 p-value: 4.65E-04
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	ALKBH5 is a tumor-promoting gene in epithelial ovarian cancer, which is involved in the mTOR pathway and BCL-2-Beclin1 complex. ALKBH5 activated Epidermal growth factor receptor (EGFR)-PIK3CA-AKT-mTOR signaling pathway. ALKBH5 inhibited autophagy of epithelial ovarian cancer through miR-7 and BCL-2.
Target Regulation	Up regulation
Responsed Disease	Ovarian cancer		ICD-11: 2C73	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Pathway Response	mTOR signaling pathway			hsa04150
In-vitro Model	A2780	Ovarian endometrioid adenocarcinoma	Homo sapiens	CVCL_0134
	CoC1	Ovarian adenocarcinoma	Homo sapiens	CVCL_6891
	OVCAR-3	Ovarian serous adenocarcinoma	Homo sapiens	CVCL_0465
	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532
In-vivo Model	SKOV3 or A2780 cells were infected with the indicated lentiviral vectors and injected (5 × 10⁶ cells/mouse in 200 uL volume) subcutaneously into the left armpit of 6-week-old BALB/c nude mice. After 21 days, the animals were sacrificed to confirm the presence of tumors and weigh the established tumors.

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

*Representative RIP-seq result supporting the interaction between EGFR and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 1.61E+00	GSE49339

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	YTHDF2 acts as a tumor suppressor to repress cell proliferation and growth via destabilizing the Epidermal growth factor receptor (EGFR) mRNA in HCC.
Target Regulation	Down regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Pathway Response	MAPK signaling pathway			hsa04010
Cell Process	Glucose metabolism
In-vitro Model	BEL-7402	Endocervical adenocarcinoma	Homo sapiens	CVCL_5492
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	QGY-7703	Endocervical adenocarcinoma	Homo sapiens	CVCL_6715
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
In-vivo Model	5 × 10⁶ of HEP3B and SMMC7721 stable cells were resuspended in 0.1 ml of PBS and subcutaneously injected into the flank of mice.

YTH domain-containing family protein 3 (YTHDF3) [READER]

Regulator Info

*Representative RIP-seq result supporting the interaction between EGFR and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 2.94E+00	GSE86214

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[7]
Response Summary	Mechanistically, YTHDF3 enhances the translation of m6A-enriched transcripts for ST6GALNAC5, GJA1, and Epidermal growth factor receptor (EGFR), all associated with breast cancer brain metastasis. This work uncovers an essential role of YTHDF3 in controlling the interaction between cancer cells and brain microenvironment, thereby inducing brain metastatic competence.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Cell Process	Cell metastasis
In-vitro Model	MDA-MB-231Br (After brain metastases of MDA-MB-361 breast adenocarcinoma cells)
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-IBC-3	Breast inflammatory carcinoma	Homo sapiens	CVCL_HC47
	JIMT-1Br3 (After brain metastases of JIMT-1 breast cancer cells)
	JIMT-1	Breast ductal carcinoma	Homo sapiens	CVCL_2077
	HEK293-FT	Normal	Homo sapiens	CVCL_6911
	HCC1954Br (After brain metastases of HCC1954 breast cancer cells)
	HCC1954	Breast ductal carcinoma	Homo sapiens	CVCL_1259
	bEnd.3	Cerebrovascular endothelioma cells from mice	Mus musculus	CVCL_0170
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	4T1Br (After brain metastases of 4T1 mouse breast cancer cells)
	4T1	Normal	Mus musculus	CVCL_0125
In-vivo Model	For the in vivo brain and bone extravasation and seeding assays, cancer cells labeled with CMFDA C2925 (Thermo fisher scientific) or GFP were injected intracardially into the nude mice. Cell number and injection procedure were described in "Animal Experiments". For the in vivo lung extravasation and seeding assays, cancer cells labeled with GFP (2.5 × 10⁵ cells/mouse) were injected into the tail vein of nude mice. At 24 or 48 hrs later, the mice were sacrificed.

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response		[]
Response Summary	WM_Score correlated highly with the regulation of transcription and post-transcriptional events contributing to the development of colorectal cancer. In response to anti-cancer drugs, WM_Score highly negatively correlated (drug sensitive) with drugs which targeted oncogenic related pathways, such as MAPK, Epidermal growth factor receptor (EGFR), and mTOR signaling pathways, positively correlated (drug resistance) with drugs which targeted in apoptosis and cell cycle. Importantly, the WM_Score was associated with the therapeutic efficacy of PD-L1 blockade, suggesting that the development of potential drugs targeting these "writers" to aid the clinical benefits of immunotherapy.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Pathway Response	MAPK signaling pathway	hsa04010
	VEGF signaling pathway	hsa04370
	mTOR signaling pathway	hsa04150
	PD-L1 expression and PD-1 checkpoint pathway in cancer	hsa05235
Cell Process	Cell apoptosis

Liver cancer [ICD-11: 2C12]

Disease Info

In total 4 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL14 was found to inhibit HCC cell migration, invasion, and EMT through modulating Epidermal growth factor receptor (EGFR)/PI3K/AKT signaling pathway in an m6A-dependent manner.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Epithelial-mesenchymal transition
In-vitro Model	YY-8103	Adult hepatocellular carcinoma	Homo sapiens	CVCL_WY40
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
	HCCLM3	Adult hepatocellular carcinoma	Homo sapiens	CVCL_6832
	L-02	Endocervical adenocarcinoma	Homo sapiens	CVCL_6926
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
In-vivo Model	For the lung metastasis model, stably transfected HepG2 cells (1 × 10⁶/0.1 mL DMEM) were injected into each nude mouse through the tail vein. Five weeks later, mice were euthanized, and the lung tissues were collected.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	YTHDF1 regulates the translation of Epidermal growth factor receptor (EGFR) mRNA via binding m6 A sites in the 3'-UTR of EGFR transcript. YTHDF1 is upregulated in ICC and associated with shorter survival of ICC patients.
Responsed Disease	Intrahepatic cholangiocarcinoma [ICD-11: 2C12.10]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
	Cell migration
	Cell nvasion
In-vitro Model	HuCC-T1	Intrahepatic cholangiocarcinoma	Homo sapiens	CVCL_0324
In-vitro Model	RBE	Intrahepatic cholangiocarcinoma	Homo sapiens	CVCL_4896
In-vivo Model	For the subcutaneous implantation ICC mouse model, 6-week-old male NCG mice (Jiangsu, China) were randomly enrolled into shNC group and shYTHDF1 group (n = 9); 1 × 10⁶ HuCCT1 cells in 0.1-mL PBS transfected with shNC or shYTHDF1 were subcutaneously inoculated in the right flanks of the mice. For AKT/YapS127A-induced orthotopic ICC mouse model, 16 mice were divided into two groups randomly. For the control group, 20-ug AKT, 30-ug Yap, and 2-ug pCMV/SB plasmids plus 20-ug vector plasmids as control were diluted in 2-mL saline and then were injected into the lateral tail vein within 7 s. For the YTHDF1-overexpressed group, mice were injected with additional 20-ug YTHDF1 plasmids under the same conditions. Mice were sacrificed at 4 weeks after injection, and liver tissues were harvested for analysis.
Experiment 3 Reporting the m6A-centered Disease Response				[2]
Response Summary	Sublethal heat treatment increases epidermal factor growth receptor (EGFR) m6A modification in the vicinity of the 5' untranslated region and promotes its binding with YTHDF1, which enhances the translation of Epidermal growth factor receptor (EGFR) mRNA. Combination of YTHDF1 silencing and EGFR inhibition suppressed the malignancies of HCC cells synergically.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	mRNA surveillance pathway			hsa03015), RNA degradation
Cell Process	RNA stability
In-vivo Model	The caudal vein injection mouse model, intrasplenic injection mouse model, and orthotopic xenograft IRFA HCC mouse models, including patient-derived xenograft (PDX), and cell-line-derived xenograft implantation models, were established as reported.
Experiment 4 Reporting the m6A-centered Disease Response				[6]
Response Summary	YTHDF2 acts as a tumor suppressor to repress cell proliferation and growth via destabilizing the Epidermal growth factor receptor (EGFR) mRNA in HCC.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	MAPK signaling pathway			hsa04010
Cell Process	Glucose metabolism
In-vitro Model	BEL-7402	Endocervical adenocarcinoma	Homo sapiens	CVCL_5492
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	QGY-7703	Endocervical adenocarcinoma	Homo sapiens	CVCL_6715
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
In-vivo Model	5 × 10⁶ of HEP3B and SMMC7721 stable cells were resuspended in 0.1 ml of PBS and subcutaneously injected into the flank of mice.

Melanoma [ICD-11: 2C30]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	METTL3 increased the m6A modification of Epidermal growth factor receptor (EGFR) mRNA in A375R cells, which promoted its translation efficiency. Inhibiting METTL3 function to restore PLX4032 sensitivity in patients with melanoma.
Responsed Disease	Melanoma [ICD-11: 2C30]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	PLX4032		Approved	Drug Info
Pathway Response	EGFR tyrosine kinase inhibitor resistance			hsa01521
Cell Process	Cell apoptosis
In-vitro Model	A375-R	Amelanotic melanoma	Homo sapiens	CVCL_6234

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[7]
Response Summary	Mechanistically, YTHDF3 enhances the translation of m6A-enriched transcripts for ST6GALNAC5, GJA1, and Epidermal growth factor receptor (EGFR), all associated with breast cancer brain metastasis. This work uncovers an essential role of YTHDF3 in controlling the interaction between cancer cells and brain microenvironment, thereby inducing brain metastatic competence.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	YTH domain-containing family protein 3 (YTHDF3)		READER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell metastasis
In-vitro Model	MDA-MB-231Br (After brain metastases of MDA-MB-361 breast adenocarcinoma cells)
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
	MDA-IBC-3	Breast inflammatory carcinoma	Homo sapiens	CVCL_HC47
	JIMT-1Br3 (After brain metastases of JIMT-1 breast cancer cells)
	JIMT-1	Breast ductal carcinoma	Homo sapiens	CVCL_2077
	HEK293-FT	Normal	Homo sapiens	CVCL_6911
	HCC1954Br (After brain metastases of HCC1954 breast cancer cells)
	HCC1954	Breast ductal carcinoma	Homo sapiens	CVCL_1259
	bEnd.3	Cerebrovascular endothelioma cells from mice	Mus musculus	CVCL_0170
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	4T1Br (After brain metastases of 4T1 mouse breast cancer cells)
	4T1	Normal	Mus musculus	CVCL_0125
In-vivo Model	For the in vivo brain and bone extravasation and seeding assays, cancer cells labeled with CMFDA C2925 (Thermo fisher scientific) or GFP were injected intracardially into the nude mice. Cell number and injection procedure were described in "Animal Experiments". For the in vivo lung extravasation and seeding assays, cancer cells labeled with GFP (2.5 × 10⁵ cells/mouse) were injected into the tail vein of nude mice. At 24 or 48 hrs later, the mice were sacrificed.

Ovarian cancer [ICD-11: 2C73]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[5]
Response Summary	ALKBH5 is a tumor-promoting gene in epithelial ovarian cancer, which is involved in the mTOR pathway and BCL-2-Beclin1 complex. ALKBH5 activated Epidermal growth factor receptor (EGFR)-PIK3CA-AKT-mTOR signaling pathway. ALKBH5 inhibited autophagy of epithelial ovarian cancer through miR-7 and BCL-2.
Responsed Disease	Ovarian cancer [ICD-11: 2C73]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Pathway Response	mTOR signaling pathway			hsa04150
In-vitro Model	A2780	Ovarian endometrioid adenocarcinoma	Homo sapiens	CVCL_0134
	CoC1	Ovarian adenocarcinoma	Homo sapiens	CVCL_6891
	OVCAR-3	Ovarian serous adenocarcinoma	Homo sapiens	CVCL_0465
	SK-OV-3	Ovarian serous cystadenocarcinoma	Homo sapiens	CVCL_0532
In-vivo Model	SKOV3 or A2780 cells were infected with the indicated lentiviral vectors and injected (5 × 10⁶ cells/mouse in 200 uL volume) subcutaneously into the left armpit of 6-week-old BALB/c nude mice. After 21 days, the animals were sacrificed to confirm the presence of tumors and weigh the established tumors.

PLX4032 [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[4]
Response Summary	METTL3 increased the m6A modification of Epidermal growth factor receptor (EGFR) mRNA in A375R cells, which promoted its translation efficiency. Inhibiting METTL3 function to restore PLX4032 sensitivity in patients with melanoma.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Melanoma		ICD-11: 2C30	Disease Info
Pathway Response	EGFR tyrosine kinase inhibitor resistance			hsa01521
Cell Process	Cell apoptosis
In-vitro Model	A375-R	Amelanotic melanoma	Homo sapiens	CVCL_6234

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

RNA modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00441		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 214 (MIR214)
Crosstalk relationship	A-to-I → m6A

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00442		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 214 (MIR214)
Crosstalk relationship	A-to-I → m6A

m6A Regulator: YTH domain-containing family protein 3 (YTHDF3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00443		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 214 (MIR214)
Crosstalk relationship	A-to-I → m6A

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00444		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 214 (MIR214)
Crosstalk relationship	A-to-I → m6A

m6A Regulator: YTH domain-containing family protein 1 (YTHDF1)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT00445		Crosstalk Info
Epigenetic Regulator	Double-stranded RNA-specific editase 1 (ADARB1)
Regulated Target	MicroRNA 214 (MIR214)
Crosstalk relationship	A-to-I → m6A

Histone modification

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03409		Crosstalk Info
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Liver cancer	Disease Info
Crosstalk ID: M6ACROT03420		Crosstalk Info
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Liver cancer	Disease Info

m6A Regulator: YTH domain-containing family protein 3 (YTHDF3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03538		Crosstalk Info
Epigenetic Regulator	Lysine-specific demethylase 5B (KDM5B)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Liver cancer	Disease Info

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05032		Crosstalk Info
Epigenetic Regulator	hsa-miR-33a
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	ncRNA → m6A
Disease	Non-small cell lung cancer	Disease Info

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05037		Crosstalk Info
Epigenetic Regulator	MicroRNA 145 (MIR145)
Regulated Target	YTH domain-containing family protein 2 (YTHDF2)
Crosstalk relationship	ncRNA → m6A
Disease	Liver cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00237)

Epidermal growth factor receptor (EGFR)

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE002154		Click to Show/Hide the Full List
mod site	chr7:55154100-55154101:+		[12]
Sequence	CCACGTACCAGATGGATGTGAACCCCGAGGGCAAATACAGC
Transcript ID List	ENST00000344576.6; ENST00000454757.6; ENST00000455089.5; ENST00000342916.7; ENST00000275493.7; ENST00000420316.6; ENST00000638463.1
External Link	RMBase: RNA-editing_site_122613

5-methylcytidine (m5C)

In total 4 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004133		Click to Show/Hide the Full List
mod site	chr7:55209007-55209008:+
Sequence	GCACTCGCTGGGGGGCCACCCCCCAGTGCCACTCTCACTAG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m5C_site_39375
mod ID: M5CSITE004134		Click to Show/Hide the Full List
mod site	chr7:55209008-55209009:+
Sequence	CACTCGCTGGGGGGCCACCCCCCAGTGCCACTCTCACTAGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m5C_site_39376
mod ID: M5CSITE004135		Click to Show/Hide the Full List
mod site	chr7:55209009-55209010:+
Sequence	ACTCGCTGGGGGGCCACCCCCCAGTGCCACTCTCACTAGGC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m5C_site_39377
mod ID: M5CSITE004136		Click to Show/Hide the Full List
mod site	chr7:55209010-55209011:+
Sequence	CTCGCTGGGGGGCCACCCCCCAGTGCCACTCTCACTAGGCC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m5C_site_39378

N6-methyladenosine (m6A)

In total 158 m6A sequence/site(s) in this target gene
mod ID: M6ASITE080165		Click to Show/Hide the Full List
mod site	chr7:55019141-55019142:+		[13]
Sequence	CGGCGGCCGCCGCCGCCCAGACCGGACGACAGGCCACCTCG
Motif Score	2.876744048
Cell/Tissue List	HeLa; A549; HepG2; U2OS; GSC-11; HEK293T; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000420316.6; ENST00000454757.6; ENST00000275493.7; ENST00000344576.6; ENST00000455089.5; ENST00000342916.7; ENST00000459688.1
External Link	RMBase: m6A_site_757902
mod ID: M6ASITE080166		Click to Show/Hide the Full List
mod site	chr7:55020660-55020661:+		[14]
Sequence	TGAGCGAGTCTGGCTTCGTGACTACCGACCATAAACCCACT
Motif Score	3.28175
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000344576.6; ENST00000454757.6; ENST00000342916.7; ENST00000275493.7; ENST00000455089.5; ENST00000420316.6; ENST00000463948.1; ENST00000459688.1
External Link	RMBase: m6A_site_757903
mod ID: M6ASITE080167		Click to Show/Hide the Full List
mod site	chr7:55043851-55043852:+		[13]
Sequence	GTTAATGATCCTTTGCCTGGACTTTCTAAGTGCCCAGAAGA
Motif Score	4.065041667
Cell/Tissue List	HeLa; GSC-11; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000459688.1; ENST00000463948.1; ENST00000275493.7; ENST00000342916.7; ENST00000454757.6; ENST00000455089.5; ENST00000420316.6; ENST00000344576.6
External Link	RMBase: m6A_site_757904
mod ID: M6ASITE080168		Click to Show/Hide the Full List
mod site	chr7:55109851-55109852:+		[15]
Sequence	CTAAAACAGTTCTCCACTGGACTTCAGAACAAGAGGGAGCT
Motif Score	4.065041667
Cell/Tissue List	GSC-11
Seq Type List	m6A-seq
Transcript ID List	ENST00000455089.5; ENST00000454757.6; ENST00000450046.1; ENST00000275493.7; ENST00000342916.7; ENST00000463948.1; ENST00000344576.6; ENST00000420316.6
External Link	RMBase: m6A_site_757905
mod ID: M6ASITE080169		Click to Show/Hide the Full List
mod site	chr7:55109859-55109860:+		[15]
Sequence	GTTCTCCACTGGACTTCAGAACAAGAGGGAGCTCTGGGCTG
Motif Score	2.951386905
Cell/Tissue List	GSC-11
Seq Type List	m6A-seq
Transcript ID List	ENST00000342916.7; ENST00000275493.7; ENST00000463948.1; ENST00000455089.5; ENST00000450046.1; ENST00000420316.6; ENST00000454757.6; ENST00000344576.6
External Link	RMBase: m6A_site_757906
mod ID: M6ASITE080170		Click to Show/Hide the Full List
mod site	chr7:55119254-55119255:+		[13]
Sequence	GTGTCTATCATGACCTACAAACCCTTTTCCCATGAGGTGTA
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000455089.5; ENST00000344576.6; ENST00000420316.6; ENST00000454757.6; ENST00000275493.7; ENST00000463948.1; ENST00000342916.7; ENST00000450046.1
External Link	RMBase: m6A_site_757907
mod ID: M6ASITE080171		Click to Show/Hide the Full List
mod site	chr7:55119299-55119300:+		[13]
Sequence	AGAGAGATTACAGCCTTGGAACTGGATGTCAGACTCTCCTG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000344576.6; ENST00000275493.7; ENST00000420316.6; ENST00000463948.1; ENST00000450046.1; ENST00000342916.7; ENST00000455089.5; ENST00000454757.6
External Link	RMBase: m6A_site_757908
mod ID: M6ASITE080172		Click to Show/Hide the Full List
mod site	chr7:55119311-55119312:+		[13]
Sequence	GCCTTGGAACTGGATGTCAGACTCTCCTGGTTTAAGACAAT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000342916.7; ENST00000420316.6; ENST00000450046.1; ENST00000344576.6; ENST00000454757.6; ENST00000455089.5; ENST00000463948.1; ENST00000275493.7
External Link	RMBase: m6A_site_757909
mod ID: M6ASITE080173		Click to Show/Hide the Full List
mod site	chr7:55119327-55119328:+		[13]
Sequence	TCAGACTCTCCTGGTTTAAGACAATAAGCCATGACATAGAG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000275493.7; ENST00000342916.7; ENST00000454757.6; ENST00000420316.6; ENST00000344576.6; ENST00000455089.5; ENST00000450046.1; ENST00000463948.1
External Link	RMBase: m6A_site_757910
mod ID: M6ASITE080174		Click to Show/Hide the Full List
mod site	chr7:55119354-55119355:+		[13]
Sequence	GCCATGACATAGAGCCTGAAACCAACACAATCTTCCGAGTG
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000450046.1; ENST00000275493.7; ENST00000455089.5; ENST00000463948.1; ENST00000420316.6; ENST00000344576.6; ENST00000454757.6; ENST00000342916.7
External Link	RMBase: m6A_site_757911
mod ID: M6ASITE080175		Click to Show/Hide the Full List
mod site	chr7:55143371-55143372:+		[13]
Sequence	GGAGCGAATTCCTTTGGAAAACCTGCAGATCATCAGAGGAA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000344576.6; ENST00000342916.7; ENST00000420316.6; ENST00000454757.6; ENST00000450046.1; ENST00000455089.5; ENST00000275493.7
External Link	RMBase: m6A_site_757912
mod ID: M6ASITE080176		Click to Show/Hide the Full List
mod site	chr7:55143451-55143452:+		[13]
Sequence	CTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7; ENST00000455089.5; ENST00000454757.6; ENST00000342916.7; ENST00000420316.6; ENST00000450046.1; ENST00000344576.6
External Link	RMBase: m6A_site_757913
mod ID: M6ASITE080177		Click to Show/Hide the Full List
mod site	chr7:55143456-55143457:+		[13]
Sequence	TATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7; ENST00000344576.6; ENST00000450046.1; ENST00000342916.7; ENST00000454757.6; ENST00000420316.6; ENST00000455089.5
External Link	RMBase: m6A_site_757914
mod ID: M6ASITE080178		Click to Show/Hide the Full List
mod site	chr7:55146677-55146678:+		[13]
Sequence	GGAGAGCATCCAGTGGCGGGACATAGTCAGCAGTGACTTTC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000454757.6; ENST00000455089.5; ENST00000275493.7; ENST00000344576.6; ENST00000342916.7; ENST00000450046.1; ENST00000420316.6
External Link	RMBase: m6A_site_757915
mod ID: M6ASITE080179		Click to Show/Hide the Full List
mod site	chr7:55146716-55146717:+		[13]
Sequence	TCTCAGCAACATGTCGATGGACTTCCAGAACCACCTGGGCA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000454757.6; ENST00000450046.1; ENST00000455089.5; ENST00000420316.6; ENST00000342916.7; ENST00000344576.6; ENST00000275493.7
External Link	RMBase: m6A_site_757916
mod ID: M6ASITE080180		Click to Show/Hide the Full List
mod site	chr7:55146725-55146726:+		[13]
Sequence	CATGTCGATGGACTTCCAGAACCACCTGGGCAGCTGTAAGT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000454757.6; ENST00000455089.5; ENST00000342916.7; ENST00000420316.6; ENST00000275493.7; ENST00000344576.6
External Link	RMBase: m6A_site_757917
mod ID: M6ASITE080181		Click to Show/Hide the Full List
mod site	chr7:55151350-55151351:+		[13]
Sequence	CTGGGGTGCAGGAGAGGAGAACTGCCAGAAACGTAAGTCAG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000455089.5; ENST00000275493.7; ENST00000454757.6; ENST00000344576.6; ENST00000420316.6; ENST00000342916.7
External Link	RMBase: m6A_site_757918
mod ID: M6ASITE080182		Click to Show/Hide the Full List
mod site	chr7:55154047-55154048:+		[13]
Sequence	AGACGAAGCCACGTGCAAGGACACCTGCCCCCCACTCATGC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000344576.6; ENST00000420316.6; ENST00000638463.1; ENST00000342916.7; ENST00000275493.7; ENST00000455089.5; ENST00000454757.6
External Link	RMBase: m6A_site_757919
mod ID: M6ASITE080183		Click to Show/Hide the Full List
mod site	chr7:55154101-55154102:+		[13]
Sequence	CACGTACCAGATGGATGTGAACCCCGAGGGCAAATACAGCT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000455089.5; ENST00000454757.6; ENST00000420316.6; ENST00000342916.7; ENST00000275493.7; ENST00000638463.1; ENST00000344576.6
External Link	RMBase: m6A_site_757920
mod ID: M6ASITE080184		Click to Show/Hide the Full List
mod site	chr7:55156565-55156566:+		[13]
Sequence	AGGTATTGGTGAATTTAAAGACTCACTCTCCATAAATGCTA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000344576.6; ENST00000342916.7; ENST00000454757.6; ENST00000638463.1; ENST00000455089.5; ENST00000275493.7; ENST00000420316.6
External Link	RMBase: m6A_site_757921
mod ID: M6ASITE080185		Click to Show/Hide the Full List
mod site	chr7:55156596-55156597:+		[13]
Sequence	ATAAATGCTACGAATATTAAACACTTCAAAAACTGCACCTC
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000420316.6; ENST00000275493.7; ENST00000638463.1; ENST00000454757.6; ENST00000344576.6; ENST00000455089.5; ENST00000342916.7
External Link	RMBase: m6A_site_757922
mod ID: M6ASITE080186		Click to Show/Hide the Full List
mod site	chr7:55156607-55156608:+		[13]
Sequence	GAATATTAAACACTTCAAAAACTGCACCTCCATCAGTGGCG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000342916.7; ENST00000455089.5; ENST00000420316.6; ENST00000454757.6; ENST00000638463.1; ENST00000344576.6; ENST00000275493.7
External Link	RMBase: m6A_site_757923
mod ID: M6ASITE080187		Click to Show/Hide the Full List
mod site	chr7:55156791-55156792:+		[16]
Sequence	CATACTCCTCCTCTGGATCCACAGGAACTGGATATTCTGAA
Motif Score	2.053113095
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000420316.6; ENST00000275493.7; ENST00000638463.1; ENST00000454757.6; ENST00000344576.6; ENST00000342916.7; ENST00000455089.5
External Link	RMBase: m6A_site_757924
mod ID: M6ASITE080188		Click to Show/Hide the Full List
mod site	chr7:55156797-55156798:+		[13]
Sequence	CCTCCTCTGGATCCACAGGAACTGGATATTCTGAAAACCGT
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000638463.1; ENST00000275493.7; ENST00000344576.6; ENST00000454757.6; ENST00000420316.6; ENST00000455089.5; ENST00000342916.7
External Link	RMBase: m6A_site_757925
mod ID: M6ASITE080189		Click to Show/Hide the Full List
mod site	chr7:55156813-55156814:+		[13]
Sequence	AGGAACTGGATATTCTGAAAACCGTAAAGGAAATCACAGGT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7; ENST00000638463.1; ENST00000454757.6; ENST00000344576.6; ENST00000455089.5; ENST00000420316.6; ENST00000342916.7
External Link	RMBase: m6A_site_757926
mod ID: M6ASITE080190		Click to Show/Hide the Full List
mod site	chr7:55156888-55156889:+		[13]
Sequence	ATCAGTGTTTTAGAGAGAGAACTTTTCGACATATTTCCTGT
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7; ENST00000638463.1; ENST00000455089.5; ENST00000342916.7; ENST00000344576.6; ENST00000454757.6; ENST00000420316.6
External Link	RMBase: m6A_site_757927
mod ID: M6ASITE080191		Click to Show/Hide the Full List
mod site	chr7:55156924-55156925:+		[13]
Sequence	CCTGTTCCCTTGGAATAAAAACATTTCTTCTGAAATTTTAC
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000344576.6; ENST00000638463.1; ENST00000420316.6; ENST00000454757.6; ENST00000342916.7; ENST00000275493.7; ENST00000455089.5
External Link	RMBase: m6A_site_757928
mod ID: M6ASITE080192		Click to Show/Hide the Full List
mod site	chr7:55157692-55157693:+		[13]
Sequence	GATTCAGGCTTGGCCTGAAAACAGGACGGACCTCCATGCCT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000455089.5; ENST00000638463.1; ENST00000344576.6; ENST00000342916.7; ENST00000275493.7; ENST00000454757.6
External Link	RMBase: m6A_site_757929
mod ID: M6ASITE080193		Click to Show/Hide the Full List
mod site	chr7:55157701-55157702:+		[13]
Sequence	TTGGCCTGAAAACAGGACGGACCTCCATGCCTTTGAGAACC
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000638463.1; ENST00000454757.6; ENST00000455089.5; ENST00000342916.7; ENST00000275493.7; ENST00000344576.6
External Link	RMBase: m6A_site_757930
mod ID: M6ASITE080194		Click to Show/Hide the Full List
mod site	chr7:55157719-55157720:+		[13]
Sequence	GGACCTCCATGCCTTTGAGAACCTAGAAATCATACGCGGCA
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000342916.7; ENST00000454757.6; ENST00000275493.7; ENST00000455089.5; ENST00000638463.1; ENST00000344576.6
External Link	RMBase: m6A_site_757931
mod ID: M6ASITE080195		Click to Show/Hide the Full List
mod site	chr7:55157742-55157743:+		[13]
Sequence	TAGAAATCATACGCGGCAGGACCAAGCAACAGTAAGTTGAC
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000455089.5; ENST00000275493.7; ENST00000638463.1; ENST00000454757.6; ENST00000344576.6; ENST00000342916.7
External Link	RMBase: m6A_site_757932
mod ID: M6ASITE080196		Click to Show/Hide the Full List
mod site	chr7:55160170-55160171:+		[13]
Sequence	TCTTGCAGTCGTCAGCCTGAACATAACATCCTTGGGATTAC
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000342916.7; ENST00000454757.6; ENST00000638463.1; ENST00000455089.5; ENST00000344576.6; ENST00000275493.7
External Link	RMBase: m6A_site_757933
mod ID: M6ASITE080197		Click to Show/Hide the Full List
mod site	chr7:55160236-55160237:+		[13]
Sequence	AGATGTGATAATTTCAGGAAACAAAAATTTGTGCTATGCAA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000342916.7; ENST00000455089.5; ENST00000638463.1; ENST00000275493.7; ENST00000344576.6; ENST00000454757.6
External Link	RMBase: m6A_site_757934
mod ID: M6ASITE080198		Click to Show/Hide the Full List
mod site	chr7:55160266-55160267:+		[13]
Sequence	GTGCTATGCAAATACAATAAACTGGAAAAAACTGTTTGGGA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000342916.7; ENST00000455089.5; ENST00000638463.1; ENST00000454757.6; ENST00000275493.7; ENST00000344576.6
External Link	RMBase: m6A_site_757935
mod ID: M6ASITE080199		Click to Show/Hide the Full List
mod site	chr7:55160276-55160277:+		[13]
Sequence	AATACAATAAACTGGAAAAAACTGTTTGGGACCTCCGGTCA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000454757.6; ENST00000342916.7; ENST00000455089.5; ENST00000344576.6; ENST00000275493.7; ENST00000638463.1
External Link	RMBase: m6A_site_757936
mod ID: M6ASITE080200		Click to Show/Hide the Full List
mod site	chr7:55160286-55160287:+		[13]
Sequence	ACTGGAAAAAACTGTTTGGGACCTCCGGTCAGAAAACCAAA
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000344576.6; ENST00000275493.7; ENST00000454757.6; ENST00000455089.5; ENST00000342916.7; ENST00000638463.1
External Link	RMBase: m6A_site_757937
mod ID: M6ASITE080201		Click to Show/Hide the Full List
mod site	chr7:55160301-55160302:+		[13]
Sequence	TTGGGACCTCCGGTCAGAAAACCAAAATTATAAGCAACAGA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000454757.6; ENST00000455089.5; ENST00000344576.6; ENST00000275493.7; ENST00000342916.7; ENST00000638463.1
External Link	RMBase: m6A_site_757938
mod ID: M6ASITE080202		Click to Show/Hide the Full List
mod site	chr7:55160329-55160330:+		[13]
Sequence	TATAAGCAACAGAGGTGAAAACAGCTGCAGTAAGTCACCGC
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000638463.1; ENST00000455089.5; ENST00000342916.7; ENST00000454757.6; ENST00000344576.6; ENST00000275493.7
External Link	RMBase: m6A_site_757939
mod ID: M6ASITE080203		Click to Show/Hide the Full List
mod site	chr7:55161564-55161565:+		[13]
Sequence	CTGGGGCCCGGAGCCCAGGGACTGCGTCTCTTGCCGGAATG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000454757.6; ENST00000344576.6; ENST00000342916.7; ENST00000455089.5; ENST00000638463.1; ENST00000275493.7
External Link	RMBase: m6A_site_757940
mod ID: M6ASITE080204		Click to Show/Hide the Full List
mod site	chr7:55161609-55161610:+		[13]
Sequence	CCGAGGCAGGGAATGCGTGGACAAGTGCAACCTTCTGGAGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7; ENST00000344576.6; ENST00000342916.7; ENST00000454757.6; ENST00000638463.1; ENST00000455089.5
External Link	RMBase: m6A_site_757941
mod ID: M6ASITE080205		Click to Show/Hide the Full List
mod site	chr7:55163755-55163756:+		[13]
Sequence	GCCAAGGGAGTTTGTGGAGAACTCTGAGTGCATACAGTGCC
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000455089.5; ENST00000454757.6; ENST00000275493.7; ENST00000344576.6; ENST00000638463.1; ENST00000342916.7
External Link	RMBase: m6A_site_757942
mod ID: M6ASITE080206		Click to Show/Hide the Full List
mod site	chr7:55163803-55163804:+		[13]
Sequence	GTGCCTGCCTCAGGCCATGAACATCACCTGCACAGGACGGG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000454757.6; ENST00000638463.1; ENST00000344576.6; ENST00000342916.7; ENST00000455089.5; ENST00000275493.7
External Link	RMBase: m6A_site_757943
mod ID: M6ASITE080207		Click to Show/Hide the Full List
mod site	chr7:55165281-55165282:+		[13]
Sequence	TTCTCCACCTTGGTGCAGGGACCAGACAACTGTATCCAGTG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7; ENST00000344576.6; ENST00000455089.5; ENST00000638463.1; ENST00000342916.7; ENST00000454757.6
External Link	RMBase: m6A_site_757944
mod ID: M6ASITE080208		Click to Show/Hide the Full List
mod site	chr7:55165286-55165287:+		[13]
Sequence	CACCTTGGTGCAGGGACCAGACAACTGTATCCAGTGTGCCC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000638463.1; ENST00000342916.7; ENST00000455089.5; ENST00000275493.7; ENST00000344576.6; ENST00000454757.6
External Link	RMBase: m6A_site_757945
mod ID: M6ASITE080209		Click to Show/Hide the Full List
mod site	chr7:55165336-55165337:+		[13]
Sequence	ACGGCCCCCACTGCGTCAAGACCTGCCCGGCAGGAGTCATG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000454757.6; ENST00000455089.5; ENST00000638463.1; ENST00000342916.7; ENST00000344576.6; ENST00000275493.7
External Link	RMBase: m6A_site_757946
mod ID: M6ASITE080210		Click to Show/Hide the Full List
mod site	chr7:55165364-55165365:+		[13]
Sequence	GGCAGGAGTCATGGGAGAAAACAACACCCTGGTCTGGAAGT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000342916.7; ENST00000455089.5; ENST00000454757.6; ENST00000275493.7; ENST00000344576.6; ENST00000638463.1
External Link	RMBase: m6A_site_757947
mod ID: M6ASITE080211		Click to Show/Hide the Full List
mod site	chr7:55165424-55165425:+		[13]
Sequence	GTGCCACCTGTGCCATCCAAACTGCACCTACGGGTGAGTGG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000454757.6; ENST00000342916.7; ENST00000455089.5; ENST00000638463.1; ENST00000275493.7; ENST00000344576.6
External Link	RMBase: m6A_site_757948
mod ID: M6ASITE080212		Click to Show/Hide the Full List
mod site	chr7:55168565-55168566:+		[13]
Sequence	GACTTTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAAT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000344576.6; ENST00000342916.7; ENST00000638463.1; ENST00000455089.5; ENST00000454757.6; ENST00000275493.7
External Link	RMBase: m6A_site_757949
mod ID: M6ASITE080213		Click to Show/Hide the Full List
mod site	chr7:55170994-55170995:+		[13]
Sequence	AATATTTGCTGAGTGAATGAACAAATGAATAAATGCATAAT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	rmsk_2237903; ENST00000454757.6; ENST00000638463.1; ENST00000275493.7; ENST00000455089.5; ENST00000344576.6
External Link	RMBase: m6A_site_757950
mod ID: M6ASITE080214		Click to Show/Hide the Full List
mod site	chr7:55173986-55173987:+		[13]
Sequence	TCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGATCAAA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7; ENST00000638463.1; ENST00000454757.6; ENST00000455089.5
External Link	RMBase: m6A_site_757951
mod ID: M6ASITE080215		Click to Show/Hide the Full List
mod site	chr7:55174723-55174724:+		[13]
Sequence	CTTCTCTCTCTGTCATAGGGACTCTGGATCCCAGAAGGTGA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000638463.1; ENST00000275493.7; ENST00000454757.6; ENST00000455089.5
External Link	RMBase: m6A_site_757952
mod ID: M6ASITE080216		Click to Show/Hide the Full List
mod site	chr7:55181317-55181318:+		[13]
Sequence	CTACGTGATGGCCAGCGTGGACAACCCCCACGTGTGCCGCC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000454757.6; ENST00000455089.5; ENST00000275493.7; ENST00000638463.1
External Link	RMBase: m6A_site_757964
mod ID: M6ASITE080217		Click to Show/Hide the Full List
mod site	chr7:55181407-55181408:+		[13]
Sequence	GCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7; ENST00000638463.1; ENST00000455089.5; ENST00000454757.6
External Link	RMBase: m6A_site_757965
mod ID: M6ASITE080218		Click to Show/Hide the Full List
mod site	chr7:55181420-55181421:+		[13]
Sequence	CTCCTGGACTATGTCCGGGAACACAAAGACAATATTGGCTC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7; ENST00000638463.1; ENST00000455089.5; ENST00000454757.6
External Link	RMBase: m6A_site_757967
mod ID: M6ASITE080219		Click to Show/Hide the Full List
mod site	chr7:55181428-55181429:+		[13]
Sequence	CTATGTCCGGGAACACAAAGACAATATTGGCTCCCAGTACC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7; ENST00000455089.5; ENST00000638463.1; ENST00000454757.6
External Link	RMBase: m6A_site_757968
mod ID: M6ASITE080220		Click to Show/Hide the Full List
mod site	chr7:55191725-55191726:+		[13]
Sequence	TTCTCTGTTTCAGGGCATGAACTACTTGGAGGACCGTCGCT
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000455089.5; ENST00000275493.7; ENST00000638463.1; ENST00000454757.6
External Link	RMBase: m6A_site_757984
mod ID: M6ASITE080221		Click to Show/Hide the Full List
mod site	chr7:55191737-55191738:+		[13]
Sequence	GGGCATGAACTACTTGGAGGACCGTCGCTTGGTGCACCGCG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000638463.1; ENST00000275493.7; ENST00000454757.6; ENST00000455089.5
External Link	RMBase: m6A_site_757985
mod ID: M6ASITE080222		Click to Show/Hide the Full List
mod site	chr7:55191787-55191788:+		[13]
Sequence	CCAGGAACGTACTGGTGAAAACACCGCAGCATGTCAAGATC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000638463.1; ENST00000275493.7; ENST00000454757.6; ENST00000455089.5
External Link	RMBase: m6A_site_757986
mod ID: M6ASITE080223		Click to Show/Hide the Full List
mod site	chr7:55191828-55191829:+		[13]
Sequence	ACAGATTTTGGGCTGGCCAAACTGCTGGGTGCGGAAGAGAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7; ENST00000455089.5; ENST00000454757.6; ENST00000638463.1
External Link	RMBase: m6A_site_757987
mod ID: M6ASITE080224		Click to Show/Hide the Full List
mod site	chr7:55200387-55200388:+		[13]
Sequence	ATTCTCCAAAATGGCCCGAGACCCCCAGCGCTACCTTGTCA
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000638463.1; ENST00000275493.7; ENST00000454757.6; ENST00000455089.5; ENST00000485503.1
External Link	RMBase: m6A_site_757988
mod ID: M6ASITE080225		Click to Show/Hide the Full List
mod site	chr7:55200528-55200529:+		[13]
Sequence	GTCCCAGATCGCATTATTAAACCCTCCAGCGCATTAGAGCA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000455089.5; ENST00000638463.1; ENST00000275493.7; ENST00000485503.1; ENST00000454757.6
External Link	RMBase: m6A_site_757989
mod ID: M6ASITE080226		Click to Show/Hide the Full List
mod site	chr7:55201221-55201222:+		[13]
Sequence	GCATTTGCCAAGTCCTACAGACTCCAACTTCTACCGTGCCC
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000455089.5; ENST00000275493.7; ENST00000638463.1; ENST00000454757.6
External Link	RMBase: m6A_site_757990
mod ID: M6ASITE080227		Click to Show/Hide the Full List
mod site	chr7:55201257-55201258:+		[13]
Sequence	TGCCCTGATGGATGAAGAAGACATGGACGACGTGGTGGATG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000638463.1; ENST00000455089.5; ENST00000275493.7; ENST00000454757.6
External Link	RMBase: m6A_site_757991
mod ID: M6ASITE080228		Click to Show/Hide the Full List
mod site	chr7:55201334-55201335:+		[13]
Sequence	GCAGCCCCTCCACGTCACGGACTCCCCTCCTGAGCTCTCTG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000455089.5; ENST00000638463.1; ENST00000275493.7; ENST00000454757.6
External Link	RMBase: m6A_site_757992
mod ID: M6ASITE080229		Click to Show/Hide the Full List
mod site	chr7:55202541-55202542:+		[13]
Sequence	AAGCTGTCCCATCAAGGAAGACAGCTTCTTGCAGCGATACA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; Huh7; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000638463.1; ENST00000275493.7; ENST00000455089.5; ENST00000454757.6
External Link	RMBase: m6A_site_757993
mod ID: M6ASITE080230		Click to Show/Hide the Full List
mod site	chr7:55202568-55202569:+		[13]
Sequence	CTTGCAGCGATACAGCTCAGACCCCACAGGCGCCTTGACTG
Motif Score	2.876744048
Cell/Tissue List	HeLa; Huh7; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000275493.7; ENST00000455089.5; ENST00000638463.1; ENST00000454757.6
External Link	RMBase: m6A_site_757994
mod ID: M6ASITE080231		Click to Show/Hide the Full List
mod site	chr7:55202573-55202574:+		[16]
Sequence	AGCGATACAGCTCAGACCCCACAGGCGCCTTGACTGAGGAC
Motif Score	2.053113095
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000454757.6; ENST00000455089.5; ENST00000275493.7; ENST00000638463.1
External Link	RMBase: m6A_site_757995
mod ID: M6ASITE080232		Click to Show/Hide the Full List
mod site	chr7:55202592-55202593:+		[13]
Sequence	CACAGGCGCCTTGACTGAGGACAGCATAGACGACACCTTCC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; Huh7; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000275493.7; ENST00000455089.5; ENST00000454757.6; ENST00000638463.1
External Link	RMBase: m6A_site_757996
mod ID: M6ASITE080233		Click to Show/Hide the Full List
mod site	chr7:55202644-55202645:+		[13]
Sequence	GGTGAGTGGCTTGTCTGGAAACAGTCCTGCTCCTCAACCTC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; Huh7; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000455089.5; ENST00000454757.6; ENST00000275493.7; ENST00000638463.1
External Link	RMBase: m6A_site_757997
mod ID: M6ASITE080234		Click to Show/Hide the Full List
mod site	chr7:55202738-55202739:+		[13]
Sequence	CAGCATCTCCAGAGGGGGAAACAGTGGCAGATTTGCAGACA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000454757.6; ENST00000455089.5; ENST00000275493.7; ENST00000638463.1
External Link	RMBase: m6A_site_757998
mod ID: M6ASITE080235		Click to Show/Hide the Full List
mod site	chr7:55202756-55202757:+		[13]
Sequence	AAACAGTGGCAGATTTGCAGACACAGTGAAGGGCGTAAGGA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000455089.5; ENST00000638463.1; ENST00000275493.7; ENST00000454757.6
External Link	RMBase: m6A_site_757999
mod ID: M6ASITE080236		Click to Show/Hide the Full List
mod site	chr7:55202785-55202786:+		[13]
Sequence	AGGGCGTAAGGAGCAGATAAACACATGACCGAGCCTGCACA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000454757.6; ENST00000638463.1; ENST00000455089.5; ENST00000275493.7
External Link	RMBase: m6A_site_758000
mod ID: M6ASITE080237		Click to Show/Hide the Full List
mod site	chr7:55202891-55202892:+		[13]
Sequence	GCTTATGAAGCAAATCACGGACATACACATCTGTGTGTGTG
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000455089.5; ENST00000454757.6; ENST00000638463.1; ENST00000275493.7
External Link	RMBase: m6A_site_758001
mod ID: M6ASITE080238		Click to Show/Hide the Full List
mod site	chr7:55205264-55205265:+		[13]
Sequence	TCCACTTTCAGAATACATAAACCAGTCCGTTCCCAAAAGGC
Motif Score	2.185083333
Cell/Tissue List	HeLa; A549; MT4; Huh7; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000275493.7; ENST00000454757.6; ENST00000638463.1
External Link	RMBase: m6A_site_758002
mod ID: M6ASITE080239		Click to Show/Hide the Full List
mod site	chr7:55205330-55205331:+		[13]
Sequence	CTATCACAATCAGCCTCTGAACCCCGCGCCCAGCAGAGACC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; A549; MT4; Huh7; HEK293A-TOA; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000638463.1; ENST00000275493.7; ENST00000454757.6
External Link	RMBase: m6A_site_758003
mod ID: M6ASITE080240		Click to Show/Hide the Full List
mod site	chr7:55205348-55205349:+		[13]
Sequence	GAACCCCGCGCCCAGCAGAGACCCACACTACCAGGACCCCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; HepG2; A549; MT4; Huh7; HEK293A-TOA; iSLK; MSC; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000275493.7; ENST00000454757.6; ENST00000638463.1
External Link	RMBase: m6A_site_758004
mod ID: M6ASITE080241		Click to Show/Hide the Full List
mod site	chr7:55205363-55205364:+		[13]
Sequence	CAGAGACCCACACTACCAGGACCCCCACAGCACTGCAGTGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; HepG2; A549; MT4; Huh7; HEK293A-TOA; iSLK; MSC; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000638463.1; ENST00000454757.6; ENST00000275493.7
External Link	RMBase: m6A_site_758005
mod ID: M6ASITE080242		Click to Show/Hide the Full List
mod site	chr7:55205486-55205487:+		[13]
Sequence	CAGCCACCAAATTAGCCTGGACAACCCTGACTACCAGCAGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; fibroblasts; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000275493.7; ENST00000638463.1; ENST00000454757.6
External Link	RMBase: m6A_site_758006
mod ID: M6ASITE080243		Click to Show/Hide the Full List
mod site	chr7:55205507-55205508:+		[13]
Sequence	CAACCCTGACTACCAGCAGGACTTCTTTCCCAAGGAAGCCA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; fibroblasts; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000275493.7; ENST00000454757.6; ENST00000638463.1
External Link	RMBase: m6A_site_758007
mod ID: M6ASITE080244		Click to Show/Hide the Full List
mod site	chr7:55205616-55205617:+		[14]
Sequence	AGTGAATTTATTGGAGCATGACCACGGAGGATAGTATGAGC
Motif Score	2.839113095
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000275493.7; ENST00000638463.1; ENST00000454757.6
External Link	RMBase: m6A_site_758008
mod ID: M6ASITE080245		Click to Show/Hide the Full List
mod site	chr7:55205650-55205651:+		[13]
Sequence	TATGAGCCCTAAAAATCCAGACTCTTTCGATACCCAGGACC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESCs; fibroblasts; MT4; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000275493.7; ENST00000638463.1; ENST00000454757.6
External Link	RMBase: m6A_site_758009
mod ID: M6ASITE080246		Click to Show/Hide the Full List
mod site	chr7:55205668-55205669:+		[13]
Sequence	AGACTCTTTCGATACCCAGGACCAAGCCACAGCAGGTCCTC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; hESCs; fibroblasts; MT4; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000275493.7; ENST00000454757.6; ENST00000638463.1
External Link	RMBase: m6A_site_758010
mod ID: M6ASITE080247		Click to Show/Hide the Full List
mod site	chr7:55205676-55205677:+		[17]
Sequence	TCGATACCCAGGACCAAGCCACAGCAGGTCCTCCATCCCAA
Motif Score	2.053113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000638463.1; ENST00000454757.6; ENST00000275493.7
External Link	RMBase: m6A_site_758011
mod ID: M6ASITE080248		Click to Show/Hide the Full List
mod site	chr7:55205696-55205697:+		[18]
Sequence	ACAGCAGGTCCTCCATCCCAACAGCCATGCCCGCATTAGCT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000275493.7; ENST00000638463.1; ENST00000454757.6
External Link	RMBase: m6A_site_758012
mod ID: M6ASITE080249		Click to Show/Hide the Full List
mod site	chr7:55205722-55205723:+		[13]
Sequence	ATGCCCGCATTAGCTCTTAGACCCACAGACTGGTTTTGCAA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESCs; fibroblasts; MT4; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000454757.6; ENST00000275493.7; ENST00000638463.1
External Link	RMBase: m6A_site_758013
mod ID: M6ASITE080250		Click to Show/Hide the Full List
mod site	chr7:55205730-55205731:+		[13]
Sequence	ATTAGCTCTTAGACCCACAGACTGGTTTTGCAACGTTTACA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESCs; fibroblasts; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000638463.1; ENST00000275493.7; ENST00000454757.6
External Link	RMBase: m6A_site_758014
mod ID: M6ASITE080251		Click to Show/Hide the Full List
mod site	chr7:55205816-55205817:+		[13]
Sequence	TTGCATTCCTTTGTCTTCAAACTGTGAAGCATTTACAGAAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000638463.1; ENST00000275493.7; ENST00000454757.6
External Link	RMBase: m6A_site_758015
mod ID: M6ASITE080252		Click to Show/Hide the Full List
mod site	chr7:55206128-55206129:+		[13]
Sequence	TTCAAGGCTTCCACTGCAAAACACTAAAGATCCAAGAAGGC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000638463.1; ENST00000275493.7; ENST00000454757.6
External Link	RMBase: m6A_site_758016
mod ID: M6ASITE080253		Click to Show/Hide the Full List
mod site	chr7:55206242-55206243:+		[14]
Sequence	CCTTCCTGGGCAAAGAAGAAACGGAGGGGATGGAATTCTTC
Motif Score	2.179660714
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000454757.6; ENST00000638463.1; ENST00000275493.7
External Link	RMBase: m6A_site_758017
mod ID: M6ASITE080254		Click to Show/Hide the Full List
mod site	chr7:55206268-55206269:+		[13]
Sequence	GGGATGGAATTCTTCCTTAGACTTACTTTTGTAAAAATGTC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESCs; fibroblasts; H1299; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000454757.6; ENST00000275493.7; ENST00000638463.1
External Link	RMBase: m6A_site_758018
mod ID: M6ASITE080255		Click to Show/Hide the Full List
mod site	chr7:55206316-55206317:+		[13]
Sequence	TACTTACTCCCCACTGATGGACCAGTGGTTTCCAGTCATGA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESCs; fibroblasts; H1299; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000454757.6; ENST00000638463.1; ENST00000275493.7
External Link	RMBase: m6A_site_758019
mod ID: M6ASITE080256		Click to Show/Hide the Full List
mod site	chr7:55206344-55206345:+		[13]
Sequence	TTTCCAGTCATGAGCGTTAGACTGACTTGTTTGTCTTCCAT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESCs; fibroblasts; H1299; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000638463.1; ENST00000275493.7; ENST00000454757.6
External Link	RMBase: m6A_site_758020
mod ID: M6ASITE080257		Click to Show/Hide the Full List
mod site	chr7:55206379-55206380:+		[13]
Sequence	TTCCATTCCATTGTTTTGAAACTCAGTATGCTGCCCCTGTC
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; BGC823; U2OS; hESCs; fibroblasts; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000638463.1; ENST00000454757.6; ENST00000275493.7
External Link	RMBase: m6A_site_758021
mod ID: M6ASITE080258		Click to Show/Hide the Full List
mod site	chr7:55206430-55206431:+		[18]
Sequence	GAAATCAGCAAGAGAGGATGACACATCAAATAATAACTCGG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T; A549
Seq Type List	MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000638463.1; ENST00000275493.7; ENST00000454757.6
External Link	RMBase: m6A_site_758022
mod ID: M6ASITE080259		Click to Show/Hide the Full List
mod site	chr7:55206484-55206485:+		[13]
Sequence	TTGGATTCATCAGCATTTGGACCAATAGCCCACAGCTGAGA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; BGC823; HepG2; fibroblasts; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000638463.1; ENST00000454757.6; ENST00000275493.7
External Link	RMBase: m6A_site_758023
mod ID: M6ASITE080260		Click to Show/Hide the Full List
mod site	chr7:55206611-55206612:+		[13]
Sequence	TTTGGGGCATAGATCAGAAGACTACAAAAATGAAGCTGCTC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; A549; BGC823; HepG2; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000638463.1; ENST00000275493.7; ENST00000454757.6
External Link	RMBase: m6A_site_758024
mod ID: M6ASITE080261		Click to Show/Hide the Full List
mod site	chr7:55206770-55206771:+		[19]
Sequence	TCCAGGTCAGCTGCCCCCAAACCCCCTCCTTACGCTTTGTC
Motif Score	2.185083333
Cell/Tissue List	HEK293T; HepG2; HeLa; Huh7; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000638463.1; ENST00000275493.7; ENST00000454757.6
External Link	RMBase: m6A_site_758025
mod ID: M6ASITE080262		Click to Show/Hide the Full List
mod site	chr7:55206834-55206835:+		[16]
Sequence	AGTCATCTATTCAAGCACTTACAGCTCTGGCCACAACAGGG
Motif Score	2.07285119
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000275493.7; ENST00000454757.6; ENST00000638463.1
External Link	RMBase: m6A_site_758026
mod ID: M6ASITE080263		Click to Show/Hide the Full List
mod site	chr7:55207003-55207004:+		[18]
Sequence	CTTCCTAAAATAATTTCTCTACAATTGGAAGATTGGAAGAT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000454757.6; ENST00000638463.1; ENST00000275493.7
External Link	RMBase: m6A_site_758027
mod ID: M6ASITE080264		Click to Show/Hide the Full List
mod site	chr7:55207103-55207104:+		[13]
Sequence	TTAACAGCAGTCCTTTGTAAACAGTGTTTTAAACTCTCCTA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000638463.1; ENST00000454757.6; ENST00000275493.7
External Link	RMBase: m6A_site_758028
mod ID: M6ASITE080265		Click to Show/Hide the Full List
mod site	chr7:55207115-55207116:+		[13]
Sequence	CTTTGTAAACAGTGTTTTAAACTCTCCTAGTCAATATCCAC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000638463.1; ENST00000454757.6; ENST00000275493.7
External Link	RMBase: m6A_site_758029
mod ID: M6ASITE080266		Click to Show/Hide the Full List
mod site	chr7:55207317-55207318:+		[13]
Sequence	TTTGTCTCAATGAAAATAAAACTATATTCATTTCCACTCTA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7; ENST00000638463.1; ENST00000454757.6
External Link	RMBase: m6A_site_758030
mod ID: M6ASITE080267		Click to Show/Hide the Full List
mod site	chr7:55207409-55207410:+		[13]
Sequence	AAGATACAAAGATAAATAAAACATAGTCCCTGATTCTAAGA
Motif Score	2.20572619
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758031
mod ID: M6ASITE080268		Click to Show/Hide the Full List
mod site	chr7:55207456-55207457:+		[13]
Sequence	CAATTTAGCAAAGGAAATGGACTCATAGATGCTAACCTTAA
Motif Score	4.065041667
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758032
mod ID: M6ASITE080269		Click to Show/Hide the Full List
mod site	chr7:55207478-55207479:+		[13]
Sequence	TCATAGATGCTAACCTTAAAACAACGTGACAAATGCCAGAC
Motif Score	2.20572619
Cell/Tissue List	HeLa; A549; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758033
mod ID: M6ASITE080270		Click to Show/Hide the Full List
mod site	chr7:55207486-55207487:+		[14]
Sequence	GCTAACCTTAAAACAACGTGACAAATGCCAGACAGGACCCA
Motif Score	2.859755952
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758034
mod ID: M6ASITE080271		Click to Show/Hide the Full List
mod site	chr7:55207497-55207498:+		[13]
Sequence	AACAACGTGACAAATGCCAGACAGGACCCATCAGCCAGGCA
Motif Score	2.897386905
Cell/Tissue List	HeLa; A549; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758035
mod ID: M6ASITE080272		Click to Show/Hide the Full List
mod site	chr7:55207502-55207503:+		[13]
Sequence	CGTGACAAATGCCAGACAGGACCCATCAGCCAGGCACTGTG
Motif Score	3.622404762
Cell/Tissue List	HeLa; A549; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758036
mod ID: M6ASITE080273		Click to Show/Hide the Full List
mod site	chr7:55207561-55207562:+		[13]
Sequence	GTTGGGTCCTGCCTGAGGAGACCTGGAAGGGAGGCCTCACA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758037
mod ID: M6ASITE080274		Click to Show/Hide the Full List
mod site	chr7:55207654-55207655:+		[13]
Sequence	GGGGCACCCTGACCGAGGAAACAGCTGCCAGAGGCCTCCAC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758038
mod ID: M6ASITE080275		Click to Show/Hide the Full List
mod site	chr7:55207713-55207714:+		[13]
Sequence	GCTGAGGTCAGTCACCCTAAACAACCTGCTCCCTCTAAGCC
Motif Score	2.20572619
Cell/Tissue List	HeLa; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758039
mod ID: M6ASITE080276		Click to Show/Hide the Full List
mod site	chr7:55207828-55207829:+		[13]
Sequence	TGCACATGCTTAGTGAGAAGACTACACAACATTTCTAAGAA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758040
mod ID: M6ASITE080277		Click to Show/Hide the Full List
mod site	chr7:55207901-55207902:+		[13]
Sequence	CATTATTCATTCACCTCAGGACATGCAGAAATATTTCAGTC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758041
mod ID: M6ASITE080278		Click to Show/Hide the Full List
mod site	chr7:55207925-55207926:+		[13]
Sequence	GCAGAAATATTTCAGTCAGAACTGGGAAACAGAAGGACCTA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758042
mod ID: M6ASITE080279		Click to Show/Hide the Full List
mod site	chr7:55207933-55207934:+		[13]
Sequence	ATTTCAGTCAGAACTGGGAAACAGAAGGACCTACATTCTGC
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758043
mod ID: M6ASITE080280		Click to Show/Hide the Full List
mod site	chr7:55207941-55207942:+		[13]
Sequence	CAGAACTGGGAAACAGAAGGACCTACATTCTGCTGTCACTT
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758044
mod ID: M6ASITE080281		Click to Show/Hide the Full List
mod site	chr7:55208051-55208052:+		[13]
Sequence	TAGTATTTTTGTAGTTTGAAACAGTAACTTAATAAAAGAGC
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758045
mod ID: M6ASITE080282		Click to Show/Hide the Full List
mod site	chr7:55208336-55208337:+		[13]
Sequence	AGTCAGTACTCAAAGCTTGGACTCCATCCCTGAAGGTCTTC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; A549
Seq Type List	m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758046
mod ID: M6ASITE080283		Click to Show/Hide the Full List
mod site	chr7:55208434-55208435:+		[13]
Sequence	CCTCAGTCAGTTCCTGGAAGACCTTACCCCATGACCCCAGC
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758047
mod ID: M6ASITE080284		Click to Show/Hide the Full List
mod site	chr7:55208475-55208476:+		[13]
Sequence	TTCAGATGTGGTCTTTGGAAACAGAGGTCGAAGGAAAGTAA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758048
mod ID: M6ASITE080285		Click to Show/Hide the Full List
mod site	chr7:55208626-55208627:+		[13]
Sequence	AGAAGGGATGAGTCTTCTAAACTCTATATTCGCTGTGAGTC
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758049
mod ID: M6ASITE080286		Click to Show/Hide the Full List
mod site	chr7:55208769-55208770:+		[13]
Sequence	CCCCTGCCTCACAACTGCAGACATAAGGGGACTATGGATTG
Motif Score	2.897386905
Cell/Tissue List	HeLa; A549; HEK293T; HepG2; H1B; fibroblasts; H1299; HEK293A-TOA; iSLK; MSC; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758050
mod ID: M6ASITE080287		Click to Show/Hide the Full List
mod site	chr7:55208779-55208780:+		[13]
Sequence	ACAACTGCAGACATAAGGGGACTATGGATTGCTTAGCAGGA
Motif Score	4.065041667
Cell/Tissue List	HeLa; A549; HEK293T; HepG2; H1B; fibroblasts; H1299; HEK293A-TOA; iSLK; MSC; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758051
mod ID: M6ASITE080288		Click to Show/Hide the Full List
mod site	chr7:55208858-55208859:+		[13]
Sequence	TTCTGGTCCCAACCAGAAAGACTGTGGCTTGATTTTCTCAG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; H1B; fibroblasts; HEK293A-TOA; iSLK; MSC; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758052
mod ID: M6ASITE080289		Click to Show/Hide the Full List
mod site	chr7:55208948-55208949:+		[13]
Sequence	CATTCATCAAAGTTTCTAGAACCTCTGGCCTAAAGGAAGGG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758053
mod ID: M6ASITE080290		Click to Show/Hide the Full List
mod site	chr7:55209073-55209074:+		[13]
Sequence	GAAGCTGGTGGGTGATGGGAACTCAGCACCTCCCCTCAGGC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758054
mod ID: M6ASITE080291		Click to Show/Hide the Full List
mod site	chr7:55209146-55209147:+		[13]
Sequence	GGGGCCTGGAGTCTCTGCAGACCAATTCAACCCAAATCTCG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	rmsk_2237941; ENST00000275493.7
External Link	RMBase: m6A_site_758055
mod ID: M6ASITE080292		Click to Show/Hide the Full List
mod site	chr7:55209206-55209207:+		[13]
Sequence	AATGGGCAACCAGGGTTGAAACCCTTATTTCTAGGGTCTTC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	rmsk_2237941; ENST00000275493.7
External Link	RMBase: m6A_site_758056
mod ID: M6ASITE080293		Click to Show/Hide the Full List
mod site	chr7:55209238-55209239:+		[13]
Sequence	AGGGTCTTCAGTTGTACAAGACTGTGGGTCTGTACCAGAGC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758057
mod ID: M6ASITE080294		Click to Show/Hide the Full List
mod site	chr7:55209319-55209320:+		[13]
Sequence	TCCCATGTGCAGTGGAGAGAACAATCTGCAGTCACTGATAA
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; A549; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758058
mod ID: M6ASITE080295		Click to Show/Hide the Full List
mod site	chr7:55209347-55209348:+		[13]
Sequence	CAGTCACTGATAAGCCTGAGACTTGGCTCATTTCAAAAGCG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; A549; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758059
mod ID: M6ASITE080296		Click to Show/Hide the Full List
mod site	chr7:55209442-55209443:+		[13]
Sequence	AGCTTTGAAAACGCCCTGGGACCCTCTGCATTCTCTAAGTA
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758060
mod ID: M6ASITE080297		Click to Show/Hide the Full List
mod site	chr7:55209473-55209474:+		[13]
Sequence	TCTCTAAGTAAGTTATAGAAACCAGTCTCTTCCCTCCTTTG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758061
mod ID: M6ASITE080298		Click to Show/Hide the Full List
mod site	chr7:55209634-55209635:+		[13]
Sequence	CCTTGCCTGGGGGCTGTAAAACCTTACAGAACAGAAATCCT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758062
mod ID: M6ASITE080299		Click to Show/Hide the Full List
mod site	chr7:55209644-55209645:+		[13]
Sequence	GGGCTGTAAAACCTTACAGAACAGAAATCCTTGCCTCTTTC
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758063
mod ID: M6ASITE080300		Click to Show/Hide the Full List
mod site	chr7:55209712-55209713:+		[13]
Sequence	ACAGCTTTGTACTATTGAAGACACAGACAGGATTTTTAAAT
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758064
mod ID: M6ASITE080301		Click to Show/Hide the Full List
mod site	chr7:55209718-55209719:+		[13]
Sequence	TTGTACTATTGAAGACACAGACAGGATTTTTAAATGTAAAT
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758065
mod ID: M6ASITE080302		Click to Show/Hide the Full List
mod site	chr7:55209831-55209832:+		[13]
Sequence	AAACTCATTTTTCTACTAAAACAAACACAGTTTACTTTAGA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758066
mod ID: M6ASITE080303		Click to Show/Hide the Full List
mod site	chr7:55209855-55209856:+		[13]
Sequence	ACACAGTTTACTTTAGAGAGACTGCAATAGAATCAAAATTT
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758067
mod ID: M6ASITE080304		Click to Show/Hide the Full List
mod site	chr7:55209879-55209880:+		[13]
Sequence	CAATAGAATCAAAATTTGAAACTGAAATCTTTGTTTAAAAG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758068
mod ID: M6ASITE080305		Click to Show/Hide the Full List
mod site	chr7:55210532-55210533:+		[19]
Sequence	ATGTGCGGCCAAAGTTGAGAACTACTGGCCTAGGGATTAGC
Motif Score	3.373380952
Cell/Tissue List	HepG2; A549; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	rmsk_2237942; ENST00000275493.7
External Link	RMBase: m6A_site_758069
mod ID: M6ASITE080306		Click to Show/Hide the Full List
mod site	chr7:55210560-55210561:+		[18]
Sequence	CCTAGGGATTAGCCACAAGGACATGGACTTGGAGGCAAATT
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T; HepG2; A549; endometrial; HEC-1-A
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758070
mod ID: M6ASITE080307		Click to Show/Hide the Full List
mod site	chr7:55210566-55210567:+		[19]
Sequence	GATTAGCCACAAGGACATGGACTTGGAGGCAAATTCTGCAG
Motif Score	4.065041667
Cell/Tissue List	HepG2; A549; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758071
mod ID: M6ASITE080308		Click to Show/Hide the Full List
mod site	chr7:55210619-55210620:+		[19]
Sequence	CTCAGGCCTAGAGAGCTAAGACACAAAGACCTCCACATCTG
Motif Score	2.897386905
Cell/Tissue List	HepG2; A549; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758072
mod ID: M6ASITE080309		Click to Show/Hide the Full List
mod site	chr7:55210627-55210628:+		[19]
Sequence	TAGAGAGCTAAGACACAAAGACCTCCACATCTGTCGCTGAG
Motif Score	2.876744048
Cell/Tissue List	HepG2; A549; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758073
mod ID: M6ASITE080310		Click to Show/Hide the Full List
mod site	chr7:55210656-55210657:+		[19]
Sequence	TCTGTCGCTGAGAGTCAAGAACCTGAACAGAGTTTCCATGA
Motif Score	2.930744048
Cell/Tissue List	HepG2; A549; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758074
mod ID: M6ASITE080311		Click to Show/Hide the Full List
mod site	chr7:55210662-55210663:+		[19]
Sequence	GCTGAGAGTCAAGAACCTGAACAGAGTTTCCATGAAGGTTC
Motif Score	2.951386905
Cell/Tissue List	HepG2; A549; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758075
mod ID: M6ASITE080312		Click to Show/Hide the Full List
mod site	chr7:55210741-55210742:+		[13]
Sequence	AAAAGCAAAGGAAATATAAAACAGACACCTCTTTCCATTTC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758076
mod ID: M6ASITE080313		Click to Show/Hide the Full List
mod site	chr7:55210790-55210791:+		[13]
Sequence	TCTCTCTTTATTAAGGGTGGACTAGTAATAAAATATAATAT
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758077
mod ID: M6ASITE080314		Click to Show/Hide the Full List
mod site	chr7:55210964-55210965:+		[13]
Sequence	GTTGGATGGCTTTCATAAAAACAAGAATTCAAGAAGAGGAT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758078
mod ID: M6ASITE080315		Click to Show/Hide the Full List
mod site	chr7:55210999-55211000:+		[18]
Sequence	GAGGATTCATGCTTTAAGAAACATTTGTTATACATTCCTCA
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T; HeLa
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758079
mod ID: M6ASITE080316		Click to Show/Hide the Full List
mod site	chr7:55211041-55211042:+		[20]
Sequence	AAATTATACCTGGGATAAAAACTATGTAGCAGGCAGTGTGT
Motif Score	2.627720238
Cell/Tissue List	HEK293T; HeLa; A549
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758080
mod ID: M6ASITE080317		Click to Show/Hide the Full List
mod site	chr7:55211179-55211180:+		[21]
Sequence	CCTATCACCTAGCAGATAAAACTATGGGGAAAACTTAAATC
Motif Score	2.627720238
Cell/Tissue List	HEK293T; A549; HepG2; HeLa; Huh7; iSLK
Seq Type List	MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758081
mod ID: M6ASITE080318		Click to Show/Hide the Full List
mod site	chr7:55211191-55211192:+		[13]
Sequence	CAGATAAAACTATGGGGAAAACTTAAATCTGTGCATACATT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; Huh7; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758082
mod ID: M6ASITE080319		Click to Show/Hide the Full List
mod site	chr7:55211347-55211348:+		[18]
Sequence	GATGACTGGTATTAGAGGTGACAATGTAACCGATTAACAAC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758083
mod ID: M6ASITE080320		Click to Show/Hide the Full List
mod site	chr7:55211363-55211364:+		[18]
Sequence	GGTGACAATGTAACCGATTAACAACAGACAGCAATAACTTC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758084
mod ID: M6ASITE080321		Click to Show/Hide the Full List
mod site	chr7:55211370-55211371:+		[13]
Sequence	ATGTAACCGATTAACAACAGACAGCAATAACTTCGTTTTAG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; HepG2; A549; Huh7; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758085
mod ID: M6ASITE080322		Click to Show/Hide the Full List
mod site	chr7:55211393-55211394:+		[13]
Sequence	GCAATAACTTCGTTTTAGAAACATTCAAGCAATAGCTTTAT
Motif Score	2.20572619
Cell/Tissue List	HeLa; A549; Huh7; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000275493.7
External Link	RMBase: m6A_site_758086

Ref 1	YTHDF1 promotes intrahepatic cholangiocarcinoma progression via regulating EGFR mRNA translation. J Gastroenterol Hepatol. 2022 Jun;37(6):1156-1168. doi: 10.1111/jgh.15816. Epub 2022 Mar 12.
Ref 2	Insufficient Radiofrequency Ablation Promotes Hepatocellular Carcinoma Metastasis Through N6-Methyladenosine mRNA Methylation-Dependent Mechanism. Hepatology. 2021 Sep;74(3):1339-1356. doi: 10.1002/hep.31766.
Ref 3	METTL14 Inhibits Hepatocellular Carcinoma Metastasis Through Regulating EGFR/PI3K/AKT Signaling Pathway in an m6A-Dependent Manner. Cancer Manag Res. 2020 Dec 23;12:13173-13184. doi: 10.2147/CMAR.S286275. eCollection 2020.
Ref 4	METTL3 induces PLX4032 resistance in melanoma by promoting m(6)A-dependent EGFR translation. Cancer Lett. 2021 Dec 1;522:44-56. doi: 10.1016/j.canlet.2021.09.015. Epub 2021 Sep 13.
Ref 5	ALKBH5 inhibited autophagy of epithelial ovarian cancer through miR-7 and BCL-2. J Exp Clin Cancer Res. 2019 Apr 15;38(1):163. doi: 10.1186/s13046-019-1159-2.
Ref 6	YTHDF2 suppresses cell proliferation and growth via destabilizing the EGFR mRNA in hepatocellular carcinoma. Cancer Lett. 2019 Feb 1;442:252-261. doi: 10.1016/j.canlet.2018.11.006. Epub 2018 Nov 10.
Ref 7	YTHDF3 Induces the Translation of m(6)A-Enriched Gene Transcripts to Promote Breast Cancer Brain Metastasis. Cancer Cell. 2020 Dec 14;38(6):857-871.e7. doi: 10.1016/j.ccell.2020.10.004. Epub 2020 Oct 29.
Ref 8	Investigation of the effects of the CFTR potentiator ivacaftor on human P-glycoprotein (ABCB1). Sci Rep. 2017 Dec 13;7(1):17481. doi: 10.1038/s41598-017-17773-5.
Ref 9	Comparison of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors (statins) as inhibitors of cytochrome P450 2C8. Basic Clin Pharmacol Toxicol. 2005 Aug;97(2):104-8. doi: 10.1111/j.1742-7843.2005.pto_134.x.
Ref 10	MiR-33a suppresses proliferation of NSCLC cells via targeting METTL3 mRNA. Biochem Biophys Res Commun. 2017 Jan 22;482(4):582-589. doi: 10.1016/j.bbrc.2016.11.077. Epub 2016 Nov 14.
Ref 11	Thalidomide metabolism by the CYP2C subfamily. Clin Cancer Res. 2002 Jun;8(6):1964-73.
Ref 12	Genome-wide identification of human RNA editing sites by parallel DNA capturing and sequencing. Science. 2009 May 29;324(5931):1210-3. doi: 10.1126/science.1170995.
Ref 13	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 14	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 15	m(6)A Demethylase ALKBH5 Maintains Tumorigenicity of Glioblastoma Stem-like Cells by Sustaining FOXM1 Expression and Cell Proliferation Program. Cancer Cell. 2017 Apr 10;31(4):591-606.e6. doi: 10.1016/j.ccell.2017.02.013. Epub 2017 Mar 23.
Ref 16	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 17	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 18	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 19	Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012 Apr 29;485(7397):201-6. doi: 10.1038/nature11112.
Ref 20	N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27.
Ref 21	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map