m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00234)

Target Name	Transcription factor E2F1 (E2F1)
Synonyms	E2F-1; PBR3; Retinoblastoma-associated protein 1; RBAP-1; Retinoblastoma-binding protein 3; RBBP-3; pRB-binding protein E2F-1; RBBP3 Click to Show/Hide
Gene Name	E2F1
Chromosomal Location	20q11.22
Family	E2F/DP family
Function	Transcription activator that binds DNA cooperatively with DP proteins through the E2 recognition site, 5'-TTTC[CG]CGC-3' found in the promoter region of a number of genes whose products are involved in cell cycle regulation or in DNA replication. The DRTF1/E2F complex functions in the control of cell-cycle progression from G1 to S phase. E2F1 binds preferentially RB1 in a cell-cycle dependent manner. It can mediate both cell proliferation and TP53/p53-dependent apoptosis. Blocks adipocyte differentiation by binding to specific promoters repressing CEBPA binding to its target gene promoters. Directly activates transcription of PEG10. Positively regulates transcription of RRP1B. Click to Show/Hide
Gene ID	1869
Uniprot ID	E2F1_HUMAN
HGNC ID	HGNC:3113
KEGG ID	hsa:1869

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

E2F1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Caco-2 cell line	Homo sapiens
Treatment: shMETTL3 Caco-2 cells Control: shNTC Caco-2 cells		GSE167075
Regulation		logFC: 8.59E-01 p-value: 2.73E-57
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between E2F1 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 1.01E+00	GSE60213

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher programmed death-ligand 1 (PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The hallmarks of the Myelocytomatosis viral oncogene (MYC) targets, Transcription factor E2F1 (E2F1) targets were significantly enriched.
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	p53 signaling pathway			hsa04115
	Central carbon metabolism in cancer			hsa05230
	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3 can regulate the expression of MALAT1 through m6A, mediate the Transcription factor E2F1 (E2F1)/AGR2 axis, and promote the adriamycin resistance of breast cancer.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Responsed Drug	Doxil		Approved	Drug Info
In-vitro Model	MCF7-DoxR (Adriamycin-resistant cell line MCF7-DoxR)
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
In-vivo Model	Once the tumor volume increased to about 1 cm3, six groups of MCF7 bearing mice (n = 10 in each group) were injected with PBS (0.1 ml, caudal vein) and adriamycin (0.1 ml, 10 mg/kg), respectively. When the tumor reached 1.5 cm in any direction (defined as event-free survival analysis), 10 mice in each group were selected to measure the tumor size and weight on the 12th day after adriamycin injection.

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF1*
Cell Line	AGS cell line	Homo sapiens
Treatment: shYTHDF1 AGS Control: shNC AGS		GSE166972
Regulation		logFC: -6.62E-01 p-value: 3.39E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[1]
Response Summary	This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher programmed death-ligand 1 (PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The hallmarks of the Myelocytomatosis viral oncogene (MYC) targets, Transcription factor E2F1 (E2F1) targets were significantly enriched.
Responsed Disease	Non-small-cell lung carcinoma	ICD-11: 2C25.Y	Disease Info
Pathway Response	p53 signaling pathway		hsa04115
	Central carbon metabolism in cancer		hsa05230
	PD-L1 expression and PD-1 checkpoint pathway in cancer		hsa05235

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher programmed death-ligand 1 (PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The hallmarks of the Myelocytomatosis viral oncogene (MYC) targets, Transcription factor E2F1 (E2F1) targets were significantly enriched.
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	p53 signaling pathway			hsa04115
	Central carbon metabolism in cancer			hsa05230
	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	FTO upregulated the expression of Transcription factor E2F1 (E2F1) by inhibiting the m6A modification of E2F1. The FTO/E2F1/NELL2 axis modulated NSCLC cell viability, migration, and invasion in vitro as well as affected NSCLC tumor growth and metastasis in vivo.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Cell Process	Cell viability
	Cell migration
	Cell invasion
In-vitro Model	NCI-H460	Lung large cell carcinoma	Homo sapiens	CVCL_0459
	NCI-H23	Lung adenocarcinoma	Homo sapiens	CVCL_1547
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	16HBE14o-	Normal	Homo sapiens	CVCL_0112
In-vivo Model	The nude mice were maintained under pathogen-free conditions and kept under timed lighting conditions mandated by the committee with food and water provided ad libitum. For xenograft experiments, nude mice were injected subcutaneously with 5 × 10⁶ cells resuspended in 0.1 mL PBS. When a tumor was palpable, it was measured every 3 days.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	FTO interacts with transcripts of Transcription factor E2F1 (E2F1) and Myc, inhibition of FTO significantly impairs the translation efficiency of E2F1 and Myc.FTO plays important oncogenic role in regulating cervical cancer cells' proliferation.
Target Regulation	Up regulation
Responsed Disease	Cervical cancer		ICD-11: 2C77	Disease Info
Cell Process	Cell proliferation and migration
In-vitro Model	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	SiHa	Cervical squamous cell carcinoma	Homo sapiens	CVCL_0032

Lung cancer [ICD-11: 2C25]

Disease Info

In total 4 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher programmed death-ligand 1 (PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The hallmarks of the Myelocytomatosis viral oncogene (MYC) targets, Transcription factor E2F1 (E2F1) targets were significantly enriched.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Pathway Response	p53 signaling pathway			hsa04115
	Central carbon metabolism in cancer			hsa05230
	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Experiment 2 Reporting the m6A-centered Disease Response				[3]
Response Summary	FTO upregulated the expression of Transcription factor E2F1 (E2F1) by inhibiting the m6A modification of E2F1. The FTO/E2F1/NELL2 axis modulated NSCLC cell viability, migration, and invasion in vitro as well as affected NSCLC tumor growth and metastasis in vivo.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell viability
	Cell migration
	Cell invasion
In-vitro Model	NCI-H460	Lung large cell carcinoma	Homo sapiens	CVCL_0459
	NCI-H23	Lung adenocarcinoma	Homo sapiens	CVCL_1547
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	16HBE14o-	Normal	Homo sapiens	CVCL_0112
In-vivo Model	The nude mice were maintained under pathogen-free conditions and kept under timed lighting conditions mandated by the committee with food and water provided ad libitum. For xenograft experiments, nude mice were injected subcutaneously with 5 × 10⁶ cells resuspended in 0.1 mL PBS. When a tumor was palpable, it was measured every 3 days.
Experiment 3 Reporting the m6A-centered Disease Response				[1]
Response Summary	This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher programmed death-ligand 1 (PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The hallmarks of the Myelocytomatosis viral oncogene (MYC) targets, Transcription factor E2F1 (E2F1) targets were significantly enriched.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Pathway Response	p53 signaling pathway			hsa04115
	Central carbon metabolism in cancer			hsa05230
	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Experiment 4 Reporting the m6A-centered Disease Response				[1]
Response Summary	This study revealed that m6A methylation is closely related to the poor prognosis of non-small cell lung cancer patients via interference with the TIME, which suggests that m6A plays a role in optimizing individualized immunotherapy management and improving prognosis. The expression levels of METTL3, FTO and YTHDF1 in non-small cell lung cancer were changed. Patients in Cluster 1 had lower immunoscores, higher programmed death-ligand 1 (PD-L1) expression, and shorter overall survival compared to patients in Cluster 2. The hallmarks of the Myelocytomatosis viral oncogene (MYC) targets, Transcription factor E2F1 (E2F1) targets were significantly enriched.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Pathway Response	p53 signaling pathway			hsa04115
	Central carbon metabolism in cancer			hsa05230
	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL3 can regulate the expression of MALAT1 through m6A, mediate the Transcription factor E2F1 (E2F1)/AGR2 axis, and promote the adriamycin resistance of breast cancer.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Doxil		Approved	Drug Info
In-vitro Model	MCF7-DoxR (Adriamycin-resistant cell line MCF7-DoxR)
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
In-vivo Model	Once the tumor volume increased to about 1 cm3, six groups of MCF7 bearing mice (n = 10 in each group) were injected with PBS (0.1 ml, caudal vein) and adriamycin (0.1 ml, 10 mg/kg), respectively. When the tumor reached 1.5 cm in any direction (defined as event-free survival analysis), 10 mice in each group were selected to measure the tumor size and weight on the 12th day after adriamycin injection.

Cervical cancer [ICD-11: 2C77]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	FTO interacts with transcripts of Transcription factor E2F1 (E2F1) and Myc, inhibition of FTO significantly impairs the translation efficiency of E2F1 and Myc.FTO plays important oncogenic role in regulating cervical cancer cells' proliferation.
Responsed Disease	Cervical cancer [ICD-11: 2C77]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell proliferation and migration
In-vitro Model	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
In-vitro Model	SiHa	Cervical squamous cell carcinoma	Homo sapiens	CVCL_0032

Doxil [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[2]
Response Summary	METTL3 can regulate the expression of MALAT1 through m6A, mediate the Transcription factor E2F1 (E2F1)/AGR2 axis, and promote the adriamycin resistance of breast cancer.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
In-vitro Model	MCF7-DoxR (Adriamycin-resistant cell line MCF7-DoxR)
	MCF-7	Invasive breast carcinoma	Homo sapiens	CVCL_0031
In-vivo Model	Once the tumor volume increased to about 1 cm3, six groups of MCF7 bearing mice (n = 10 in each group) were injected with PBS (0.1 ml, caudal vein) and adriamycin (0.1 ml, 10 mg/kg), respectively. When the tumor reached 1.5 cm in any direction (defined as event-free survival analysis), 10 mice in each group were selected to measure the tumor size and weight on the 12th day after adriamycin injection.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Fat mass and obesity-associated protein (FTO)

Regulator Info

In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05238		Crosstalk Info
Epigenetic Regulator	hsa-miR-607
Regulated Target	FTO alpha-ketoglutarate dependent dioxygenase (FTO)
Crosstalk relationship	ncRNA → m6A
Disease	Non-small cell lung cancer	Disease Info
Crosstalk ID: M6ACROT05242		Crosstalk Info
Epigenetic Regulator	hsa-miR-607
Regulated Target	FTO alpha-ketoglutarate dependent dioxygenase (FTO)
Crosstalk relationship	ncRNA → m6A
Disease	Non-small cell lung cancer	Disease Info
Crosstalk ID: M6ACROT05252		Crosstalk Info
Epigenetic Regulator	hsa_circ_0072309 (Circ_LIFR)
Regulated Target	hsa-miR-607
Crosstalk relationship	ncRNA → m6A
Disease	Non-small cell lung cancer	Disease Info
Crosstalk ID: M6ACROT05256		Crosstalk Info
Epigenetic Regulator	hsa_circ_0072309 (Circ_LIFR)
Regulated Target	hsa-miR-607
Crosstalk relationship	ncRNA → m6A
Disease	Non-small cell lung cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00234)

Transcription factor E2F1 (E2F1)

5-methylcytidine (m5C)

In total 5 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002667		Click to Show/Hide the Full List
mod site	chr20:33675915-33675916:-
Sequence	AGGGGGCCAGTTCAGGGCCCCAGCTGCCCCCCAGGATGGAT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m5C_site_28691
mod ID: M5CSITE002668		Click to Show/Hide the Full List
mod site	chr20:33675916-33675917:-
Sequence	CAGGGGGCCAGTTCAGGGCCCCAGCTGCCCCCCAGGATGGA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m5C_site_28692
mod ID: M5CSITE002669		Click to Show/Hide the Full List
mod site	chr20:33675917-33675918:-
Sequence	CCAGGGGGCCAGTTCAGGGCCCCAGCTGCCCCCCAGGATGG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m5C_site_28693
mod ID: M5CSITE002670		Click to Show/Hide the Full List
mod site	chr20:33675918-33675919:-		[9]
Sequence	TCCAGGGGGCCAGTTCAGGGCCCCAGCTGCCCCCCAGGATG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m5C_site_28694
mod ID: M5CSITE002671		Click to Show/Hide the Full List
mod site	chr20:33675928-33675929:-		[9]
Sequence	GTGGGCCCTCTCCAGGGGGCCAGTTCAGGGCCCCAGCTGCC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m5C_site_28695

N6-methyladenosine (m6A)

In total 43 m6A sequence/site(s) in this target gene
mod ID: M6ASITE052199		Click to Show/Hide the Full List
mod site	chr20:33675653-33675654:-		[10]
Sequence	GTTTTGGGACTCTGTTGGGAACATTTCGGGGCGGGAGAGGC
Motif Score	2.951386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527693
mod ID: M6ASITE052200		Click to Show/Hide the Full List
mod site	chr20:33675665-33675666:-		[11]
Sequence	CGTTTGGGCCGGGTTTTGGGACTCTGTTGGGAACATTTCGG
Motif Score	4.065041667
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527694
mod ID: M6ASITE052201		Click to Show/Hide the Full List
mod site	chr20:33675819-33675820:-		[11]
Sequence	GAAGGCCTCCCCCAGCCCAGACCCTGTGGTCCCTCCTGCAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527695
mod ID: M6ASITE052202		Click to Show/Hide the Full List
mod site	chr20:33675869-33675870:-		[11]
Sequence	ATGGGAGAGGTGAGTGGGGGACCTTCACTGATGTGGGCAGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; H1B; MT4; MM6
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527696
mod ID: M6ASITE052203		Click to Show/Hide the Full List
mod site	chr20:33675974-33675975:-		[12]
Sequence	GGAGGGAGACAGACTGACTGACAGCCATGGGTGGTCAGATG
Motif Score	2.859755952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527697
mod ID: M6ASITE052204		Click to Show/Hide the Full List
mod site	chr20:33675978-33675979:-		[12]
Sequence	TGAGGGAGGGAGACAGACTGACTGACAGCCATGGGTGGTCA
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527698
mod ID: M6ASITE052205		Click to Show/Hide the Full List
mod site	chr20:33675982-33675983:-		[11]
Sequence	AAAGTGAGGGAGGGAGACAGACTGACTGACAGCCATGGGTG
Motif Score	3.319380952
Cell/Tissue List	HeLa; A549; MT4; Huh7
Seq Type List	m6A-seq; m6A-CLIP/IP; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527699
mod ID: M6ASITE052206		Click to Show/Hide the Full List
mod site	chr20:33675986-33675987:-		[11]
Sequence	TGGGAAAGTGAGGGAGGGAGACAGACTGACTGACAGCCATG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; A549; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527700
mod ID: M6ASITE052207		Click to Show/Hide the Full List
mod site	chr20:33676031-33676032:-		[11]
Sequence	TTCTGCCCCATACTGAAGGAACTGAGGCCTGGGTGATTTAT
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; A549; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527701
mod ID: M6ASITE052208		Click to Show/Hide the Full List
mod site	chr20:33676040-33676041:-		[12]
Sequence	GAGCTGTTCTTCTGCCCCATACTGAAGGAACTGAGGCCTGG
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527702
mod ID: M6ASITE052209		Click to Show/Hide the Full List
mod site	chr20:33676228-33676229:-		[12]
Sequence	TGGCTGGCTGGGCGTGTAGGACGGTGAGAGCACTTCTGTCT
Motif Score	3.616982143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527703
mod ID: M6ASITE052210		Click to Show/Hide the Full List
mod site	chr20:33676270-33676271:-		[12]
Sequence	TCCCAGAATCTGGTGCTCTGACCAGGCCAGGTGGGGAGGCT
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527704
mod ID: M6ASITE052211		Click to Show/Hide the Full List
mod site	chr20:33676347-33676348:-		[12]
Sequence	GTGCGCGTGGGGGGGCTCTAACTGCACTTTCGGCCCTTTTG
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527705
mod ID: M6ASITE052212		Click to Show/Hide the Full List
mod site	chr20:33676436-33676437:-		[12]
Sequence	GTACCGGGGAATGAAGGTGAACATACACCTCTGTGTGTGCA
Motif Score	2.951386905
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527706
mod ID: M6ASITE052213		Click to Show/Hide the Full List
mod site	chr20:33676503-33676504:-		[13]
Sequence	TGTGCATGCAGCCTACACCCACACGTGTGTACCGGGGGTGA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527707
mod ID: M6ASITE052214		Click to Show/Hide the Full List
mod site	chr20:33676509-33676510:-		[13]
Sequence	TGTGTATGTGCATGCAGCCTACACCCACACGTGTGTACCGG
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527708
mod ID: M6ASITE052215		Click to Show/Hide the Full List
mod site	chr20:33676575-33676576:-		[12]
Sequence	TCTAGCTCTGGGGTCTGGCTACCGCTAGGAGGCTGAGCAAG
Motif Score	2.05802381
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527709
mod ID: M6ASITE052216		Click to Show/Hide the Full List
mod site	chr20:33676634-33676635:-		[14]
Sequence	TCCTCCCAGCCTGTTTGGAAACATTTAATTTATACCCCTCT
Motif Score	2.20572619
Cell/Tissue List	HepG2; HEK293T; HeLa; A549; U2OS; H1A; H1B; GM12878; H1299; MM6; Jurkat; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527710
mod ID: M6ASITE052217		Click to Show/Hide the Full List
mod site	chr20:33676716-33676717:-		[11]
Sequence	TTCTGACAGGGCTTGGAGGGACCAGGGTTTCCAGAGATGCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527711
mod ID: M6ASITE052218		Click to Show/Hide the Full List
mod site	chr20:33676753-33676754:-		[11]
Sequence	CTTCGACTGTGACTTTGGGGACCTCACCCCCCTGGATTTCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527712
mod ID: M6ASITE052219		Click to Show/Hide the Full List
mod site	chr20:33676768-33676769:-		[12]
Sequence	GGGCATCAGAGACCTCTTCGACTGTGACTTTGGGGACCTCA
Motif Score	3.287565476
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527713
mod ID: M6ASITE052220		Click to Show/Hide the Full List
mod site	chr20:33676777-33676778:-		[11]
Sequence	GGAGGGCGAGGGCATCAGAGACCTCTTCGACTGTGACTTTG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; GM12878; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527714
mod ID: M6ASITE052221		Click to Show/Hide the Full List
mod site	chr20:33676816-33676817:-		[12]
Sequence	CCCACCCCACGAGGCCCTCGACTACCACTTCGGCCTCGAGG
Motif Score	3.287565476
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527715
mod ID: M6ASITE052222		Click to Show/Hide the Full List
mod site	chr20:33676876-33676877:-		[11]
Sequence	CCTGGAGCATGTGCGGGAGGACTTCTCCGGCCTCCTCCCTG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527716
mod ID: M6ASITE052223		Click to Show/Hide the Full List
mod site	chr20:33676930-33676931:-		[11]
Sequence	GCGGGCTCCCGTGGACGAGGACCGCCTGTCCCCGCTGGTGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; MM6; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527717
mod ID: M6ASITE052224		Click to Show/Hide the Full List
mod site	chr20:33677205-33677206:-		[11]
Sequence	GGTCACTTCTGAGGAGGAGAACAGGGCCACTGACTCTGCCA
Motif Score	2.951386905
Cell/Tissue List	HeLa; MT4; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527718
mod ID: M6ASITE052225		Click to Show/Hide the Full List
mod site	chr20:33677239-33677240:-		[11]
Sequence	GTGGGATCAGCCCTGGGAAGACCCCATCCCAGGAGGTCACT
Motif Score	2.876744048
Cell/Tissue List	HeLa; MT4; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527719
mod ID: M6ASITE052226		Click to Show/Hide the Full List
mod site	chr20:33677266-33677267:-		[15]
Sequence	TTTTCCTGTGCCCTGAGGAGACCGTAGGTGGGATCAGCCCT
Motif Score	2.876744048
Cell/Tissue List	HeLa; MT4; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527720
mod ID: M6ASITE052227		Click to Show/Hide the Full List
mod site	chr20:33677303-33677304:-		[13]
Sequence	CAGATCTCCCTTAAGAGCAAACAAGGCCCGATCGATGTTTT
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T; HEK293A-TOA
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527721
mod ID: M6ASITE052228		Click to Show/Hide the Full List
mod site	chr20:33677498-33677499:-		[16]
Sequence	GGACCTTCGTAGCATTGCAGACCCTGCAGAGCAGATGGTTA
Motif Score	2.876744048
Cell/Tissue List	peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527722
mod ID: M6ASITE052229		Click to Show/Hide the Full List
mod site	chr20:33677516-33677517:-		[16]
Sequence	GGCCTACGTGACGTGTCAGGACCTTCGTAGCATTGCAGACC
Motif Score	3.622404762
Cell/Tissue List	peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527723
mod ID: M6ASITE052230		Click to Show/Hide the Full List
mod site	chr20:33678215-33678216:-		[11]
Sequence	GCTGCGCCTGCTCTCCGAGGACACTGACAGCCAGCGATATC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; hESC-HEK293T; CD4T; peripheral-blood; GSC-11; HEC-1-A
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527724
mod ID: M6ASITE052231		Click to Show/Hide the Full List
mod site	chr20:33678243-33678244:-		[12]
Sequence	ACCACCTGATGAATATCTGTACTACGCAGCTGCGCCTGCTC
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527725
mod ID: M6ASITE052232		Click to Show/Hide the Full List
mod site	chr20:33678263-33678264:-		[11]
Sequence	GGAGAGCGAGCAGCAGCTGGACCACCTGATGAATATCTGTA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; CD4T; peripheral-blood; GSC-11; HEK293T; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527726
mod ID: M6ASITE052233		Click to Show/Hide the Full List
mod site	chr20:33678299-33678300:-		[11]
Sequence	GCTTGAGGGGTTGACCCAGGACCTCCGACAGCTGCAGGAGA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527727
mod ID: M6ASITE052234		Click to Show/Hide the Full List
mod site	chr20:33679766-33679767:-		[17]
Sequence	TGCCAAGAAGTCCAAGAACCACATCCAGTGGCTGTAGGTAC
Motif Score	2.053113095
Cell/Tissue List	HEK293; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527728
mod ID: M6ASITE052235		Click to Show/Hide the Full List
mod site	chr20:33679769-33679770:-		[11]
Sequence	CATTGCCAAGAAGTCCAAGAACCACATCCAGTGGCTGTAGG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; peripheral-blood; HEK293T; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527729
mod ID: M6ASITE052236		Click to Show/Hide the Full List
mod site	chr20:33679820-33679821:-		[13]
Sequence	GCAGAAGCGGCGCATCTATGACATCACCAACGTCCTTGAGG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527730
mod ID: M6ASITE052237		Click to Show/Hide the Full List
mod site	chr20:33679865-33679866:-		[11]
Sequence	TGACGGTGTCGTCGACCTGAACTGGGCTGCCGAGGTGCTGA
Motif Score	3.373380952
Cell/Tissue List	HeLa; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527731
mod ID: M6ASITE052238		Click to Show/Hide the Full List
mod site	chr20:33679938-33679939:-		[11]
Sequence	GGGAGAAGTCACGCTATGAGACCTCACTGAATCTGACCACC
Motif Score	2.876744048
Cell/Tissue List	HeLa; peripheral-blood
Seq Type List	m6A-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527732
mod ID: M6ASITE052239		Click to Show/Hide the Full List
mod site	chr20:33680391-33680392:-		[11]
Sequence	AGCGGAGGCTGGACCTGGAAACTGACCATCAGTACCTGGCC
Motif Score	2.627720238
Cell/Tissue List	HeLa; MT4; MM6; HEK293T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527733
mod ID: M6ASITE052240		Click to Show/Hide the Full List
mod site	chr20:33680399-33680400:-		[11]
Sequence	ACAGGTGAAGCGGAGGCTGGACCTGGAAACTGACCATCAGT
Motif Score	3.622404762
Cell/Tissue List	HeLa; MT4; MM6; HEK293T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527734
mod ID: M6ASITE052241		Click to Show/Hide the Full List
mod site	chr20:33686381-33686382:-		[18]
Sequence	GGCGCGTAAAAGTGGCCGGGACTTTGCAGGCAGCGGCGGCC
Motif Score	4.065041667
Cell/Tissue List	A549; HEK293A-TOA; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000343380.6
External Link	RMBase: m6A_site_527735

Ref 1	Correlation of m6A methylation with immune infiltrates and poor prognosis in non-small cell lung cancer via a comprehensive analysis of RNA expression profiles. Ann Transl Med. 2021 Sep;9(18):1465. doi: 10.21037/atm-21-4248.
Ref 2	Effect of m6A methyltransferase METTL3 -mediated MALAT1/E2F1/AGR2 axis on adriamycin resistance in breast cancer. J Biochem Mol Toxicol. 2022 Jan;36(1):e22922. doi: 10.1002/jbt.22922. Epub 2021 Dec 28.
Ref 3	m6A demethylase FTO induces NELL2 expression by inhibiting E2F1 m6A modification leading to metastasis of non-small cell lung cancer. Mol Ther Oncolytics. 2021 Apr 29;21:367-376. doi: 10.1016/j.omto.2021.04.011. eCollection 2021 Jun 25.
Ref 4	The m(6)A eraser FTO facilitates proliferation and migration of human cervical cancer cells. Cancer Cell Int. 2019 Dec 2;19:321. doi: 10.1186/s12935-019-1045-1. eCollection 2019.
Ref 5	The influence of UGT2B7, UGT1A8, MDR1, ALDH, ADH, CYP3A4 and CYP3A5 genetic polymorphisms on the pharmacokinetics of silodosin in healthy Chinese volunteers. Drug Metab Pharmacokinet. 2013;28(3):239-43. doi: 10.2133/dmpk.dmpk-12-rg-106. Epub 2012 Dec 18.
Ref 6	Advantageous Solubility-Permeability Interplay When Using Amorphous Solid Dispersion (ASD) Formulation for the BCS Class IV P-gp Substrate Rifaximin: Simultaneous Increase of Both the Solubility and the Permeability. AAPS J. 2017 May;19(3):806-813. doi: 10.1208/s12248-017-0052-1. Epub 2017 Feb 15.
Ref 7	National Cancer Institute Drug Dictionary (drug name INCB086550).
Ref 8	Effects of plant sterols on human multidrug transporters ABCB1 and ABCC1. Biochem Biophys Res Commun. 2008 May 2;369(2):363-8.
Ref 9	Transcriptome-wide profiling of multiple RNA modifications simultaneously at single-base resolution. Proc Natl Acad Sci U S A. 2019 Apr 2;116(14):6784-6789. doi: 10.1073/pnas.1817334116. Epub 2019 Mar 14.
Ref 10	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 11	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 12	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 13	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 14	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 15	N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27.
Ref 16	R-2HG Exhibits Anti-tumor Activity by Targeting FTO/m(6)A/MYC/CEBPA Signaling. Cell. 2018 Jan 11;172(1-2):90-105.e23. doi: 10.1016/j.cell.2017.11.031. Epub 2017 Dec 14.
Ref 17	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 18	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map