m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00230)

Target Name	Developmentally-regulated GTP-binding protein 1 (DRG1)
Synonyms	DRG-1; Neural precursor cell expressed developmentally down-regulated protein 3; NEDD-3; Translation factor GTPase DRG1; TRAFAC GTPase DRG1; NEDD3 Click to Show/Hide
Gene Name	DRG1
Chromosomal Location	22q12.2
Family	TRAFAC class OBG-HflX-like GTPase superfamily; OBG GTPase family
Function	Catalyzes the conversion of GTP to GDP through hydrolysis of the gamma-phosphate bond in GTP. Appears to have an intrinsic GTPase activity that is stimulated by ZC3H15/DFRP1 binding likely by increasing the affinity for the potassium ions. When hydroxylated at C-3 of 'Lys-22' by JMJD7, may bind to RNA and play a role in translation. Binds to microtubules and promotes microtubule polymerization and stability that are required for mitotic spindle assembly during prophase to anaphase transition. GTPase activity is not necessary for these microtubule-related functions. Click to Show/Hide
Gene ID	4733
Uniprot ID	DRG1_HUMAN
HGNC ID	HGNC:3029
KEGG ID	hsa:4733

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

DRG1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Pancreatic islets	Mus musculus
Treatment: Mettl3 knockout mice Control: Mettl3 flox/flox mice		GSE155612
Regulation		logFC: 6.62E-01 p-value: 3.32E-04
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between DRG1 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 1.01E+01	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	ELAVL1 knockdown impaired the stability of DRG1 mRNA, thereby reducing both the mRNA and protein levels of Developmentally-regulated GTP-binding protein 1 (DRG1). In all, DRG1 exerted tumorigenic effects in osteosarcoma, and the up-regulation of DRG1 in OS was induced by METTL3 and ELAVL1 in an m6A-dependent manner.
Target Regulation	Up regulation
Responsed Disease	Osteosarcoma		ICD-11: 2B51	Disease Info
Cell Process	Cell cycle
Cell Process	Cell apoptosis
In-vitro Model	143B	Osteosarcoma	Homo sapiens	CVCL_2270
	hFOB 1.19	Normal	Homo sapiens	CVCL_3708
	MG-63	Osteosarcoma	Homo sapiens	CVCL_0426
	SaOS-2	Osteosarcoma	Homo sapiens	CVCL_0548
	U2OS	Osteosarcoma	Homo sapiens	CVCL_0042

ELAV-like protein 1 (ELAVL1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	ELAVL1 knockdown impaired the stability of DRG1 mRNA, thereby reducing both the mRNA and protein levels of Developmentally-regulated GTP-binding protein 1 (DRG1). In all, DRG1 exerted tumorigenic effects in osteosarcoma, and the up-regulation of DRG1 in OS was induced by METTL3 and ELAVL1 in an m6A-dependent manner.
Target Regulation	Up regulation
Responsed Disease	Osteosarcoma		ICD-11: 2B51	Disease Info
Cell Process	Cell cycle
Cell Process	Cell apoptosis
In-vitro Model	143B	Osteosarcoma	Homo sapiens	CVCL_2270
	hFOB 1.19	Normal	Homo sapiens	CVCL_3708
	MG-63	Osteosarcoma	Homo sapiens	CVCL_0426
	SaOS-2	Osteosarcoma	Homo sapiens	CVCL_0548
	U2OS	Osteosarcoma	Homo sapiens	CVCL_0042

Osteosarcoma [ICD-11: 2B51]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	ELAVL1 knockdown impaired the stability of DRG1 mRNA, thereby reducing both the mRNA and protein levels of Developmentally-regulated GTP-binding protein 1 (DRG1). In all, DRG1 exerted tumorigenic effects in osteosarcoma, and the up-regulation of DRG1 in OS was induced by METTL3 and ELAVL1 in an m6A-dependent manner.
Responsed Disease	Osteosarcoma [ICD-11: 2B51]
Target Regulator	ELAV-like protein 1 (ELAVL1)		READER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell cycle
Cell Process	Cell apoptosis
In-vitro Model	143B	Osteosarcoma	Homo sapiens	CVCL_2270
	hFOB 1.19	Normal	Homo sapiens	CVCL_3708
	MG-63	Osteosarcoma	Homo sapiens	CVCL_0426
	SaOS-2	Osteosarcoma	Homo sapiens	CVCL_0548
	U2OS	Osteosarcoma	Homo sapiens	CVCL_0042
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	ELAVL1 knockdown impaired the stability of DRG1 mRNA, thereby reducing both the mRNA and protein levels of Developmentally-regulated GTP-binding protein 1 (DRG1). In all, DRG1 exerted tumorigenic effects in osteosarcoma, and the up-regulation of DRG1 in OS was induced by METTL3 and ELAVL1 in an m6A-dependent manner.
Responsed Disease	Osteosarcoma [ICD-11: 2B51]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell cycle
Cell Process	Cell apoptosis
In-vitro Model	143B	Osteosarcoma	Homo sapiens	CVCL_2270
	hFOB 1.19	Normal	Homo sapiens	CVCL_3708
	MG-63	Osteosarcoma	Homo sapiens	CVCL_0426
	SaOS-2	Osteosarcoma	Homo sapiens	CVCL_0548
	U2OS	Osteosarcoma	Homo sapiens	CVCL_0042

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00230)

Developmentally-regulated GTP-binding protein 1 (DRG1)

Adenosine-to-Inosine editing (A-to-I)

In total 10 m6A sequence/site(s) in this target gene
mod ID: A2ISITE011228		Click to Show/Hide the Full List
mod site	chr22:31403754-31403755:+		[2]
Sequence	GCCTCCCAAAATGCGGGATTACAGGTGTGAGCCACCGCGCC
Transcript ID List	ENST00000416465.5; ENST00000331457.8; ENST00000486584.1; ENST00000433341.5
External Link	RMBase: RNA-editing_site_92118
mod ID: A2ISITE011229		Click to Show/Hide the Full List
mod site	chr22:31410178-31410179:+		[2]
Sequence	GTACATAAAAAGCCCGGCCTAGGTGCAGTGGCTCATGCCTG
Transcript ID List	ENST00000416465.5; ENST00000486584.1; ENST00000331457.8; ENST00000433341.5
External Link	RMBase: RNA-editing_site_92119
mod ID: A2ISITE011230		Click to Show/Hide the Full List
mod site	chr22:31435602-31435603:+		[2]
Sequence	ACAAAAAAATTTAAAAAATTAGGTGGGCATGGTGGTGCATG
Transcript ID List	rmsk_5274036; ENST00000548143.1
External Link	RMBase: RNA-editing_site_92121
mod ID: A2ISITE011231		Click to Show/Hide the Full List
mod site	chr22:31438754-31438755:+		[3]
Sequence	TTTTTTTAAGATGGAGTCTCACTCTGTCGCCAGGCTGGACT
Transcript ID List	ENST00000548143.1
External Link	RMBase: RNA-editing_site_92123
mod ID: A2ISITE011232		Click to Show/Hide the Full List
mod site	chr22:31438796-31438797:+		[3]
Sequence	CAGTGGCGTGATCTCAGCTCACTGCAACCTCTGCCTCCCAG
Transcript ID List	ENST00000548143.1
External Link	RMBase: RNA-editing_site_92124
mod ID: A2ISITE011233		Click to Show/Hide the Full List
mod site	chr22:31505719-31505720:+		[2]
Sequence	TATAGCAAGACCCTGTCTCTACAAATAATAAAAAATAAGCT
Transcript ID List	ENST00000411518.5; ENST00000540643.5; rmsk_5274187; ENST00000432498.5; ENST00000548143.1; ENST00000465437.5; ENST00000444859.5; ENST00000400288.6; ENST00000400289.5; ENST00000443011.5; ENST00000465646.5; ENST00000382162.7
External Link	RMBase: RNA-editing_site_92127
mod ID: A2ISITE011234		Click to Show/Hide the Full List
mod site	chr22:31512176-31512177:+		[2]
Sequence	ACCAGTCTGACCAATATGGTAAAACCCCATCTCTACTAAAA
Transcript ID List	rmsk_5274207; ENST00000443011.5; ENST00000432498.5; ENST00000465437.5; ENST00000382162.7; ENST00000540643.5; ENST00000629688.1; ENST00000400288.6; ENST00000548143.1; ENST00000444859.5; ENST00000411518.5; ENST00000465646.5; ENST00000524296.5; ENST00000400289.5
External Link	RMBase: RNA-editing_site_92128
mod ID: A2ISITE011235		Click to Show/Hide the Full List
mod site	chr22:31512190-31512191:+		[2]
Sequence	TATGGTAAAACCCCATCTCTACTAAAAATACAAAATTAGCC
Transcript ID List	ENST00000443011.5; ENST00000465646.5; ENST00000400288.6; ENST00000540643.5; ENST00000524296.5; ENST00000400289.5; ENST00000465437.5; ENST00000382162.7; ENST00000444859.5; ENST00000432498.5; ENST00000411518.5; ENST00000629688.1; ENST00000548143.1; rmsk_5274207
External Link	RMBase: RNA-editing_site_92129
mod ID: A2ISITE011236		Click to Show/Hide the Full List
mod site	chr22:31522256-31522257:+		[2]
Sequence	TTTGTATTTTTGGTAGAGACAGTGTTTCACCATGTTGGCCA
Transcript ID List	ENST00000432498.5; ENST00000548143.1; ENST00000465437.5; ENST00000400289.5; ENST00000400288.6; ENST00000382162.7; ENST00000444859.5; ENST00000524296.5; ENST00000629688.1; ENST00000465646.5; ENST00000443011.5; ENST00000540643.5; ENST00000411518.5
External Link	RMBase: RNA-editing_site_92130
mod ID: A2ISITE011237		Click to Show/Hide the Full List
mod site	chr22:31525595-31525596:+		[2]
Sequence	AGGTGGTAGCATGTACTTGTAGTTGCAGCTCCTCAGGAGGC
Transcript ID List	ENST00000432498.5; ENST00000465437.5; ENST00000444859.5; ENST00000443011.5; ENST00000629688.1; ENST00000411518.5; ENST00000400289.5; ENST00000524296.5; ENST00000548143.1; rmsk_5274267; ENST00000382162.7; ENST00000400288.6; ENST00000540643.5; ENST00000465646.5
External Link	RMBase: RNA-editing_site_92131

N6-methyladenosine (m6A)

In total 41 m6A sequence/site(s) in this target gene
mod ID: M6ASITE057716		Click to Show/Hide the Full List
mod site	chr22:31399562-31399563:+		[4]
Sequence	CGCGGTGACCCCTACGCGGAACTCTCTCGCGGTAATTCGAA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000331457.8
External Link	RMBase: m6A_site_562606
mod ID: M6ASITE057717		Click to Show/Hide the Full List
mod site	chr22:31399652-31399653:+		[4]
Sequence	CCGCGGGTGTGTGAAGGGAGACAGTGTGGAGGCCACAGGGT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; A549; fibroblasts; MT4; MM6; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000416465.5; ENST00000433341.5; ENST00000486584.1; ENST00000331457.8
External Link	RMBase: m6A_site_562607
mod ID: M6ASITE057718		Click to Show/Hide the Full List
mod site	chr22:31400628-31400629:+		[5]
Sequence	CTCCCTTTTAGATGGCTCGGACTCAAAAGAACAAGGCCACA
Motif Score	4.065041667
Cell/Tissue List	HepG2; A549; MM6; HEK293A-TOA; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000331457.8; ENST00000416465.5; ENST00000486584.1; ENST00000433341.5
External Link	RMBase: m6A_site_562608
mod ID: M6ASITE057719		Click to Show/Hide the Full List
mod site	chr22:31400638-31400639:+		[5]
Sequence	GATGGCTCGGACTCAAAAGAACAAGGCCACAGCACACCACT
Motif Score	2.951386905
Cell/Tissue List	HepG2; A549; hESC-HEK293T; MM6; HEK293A-TOA; MSC; TIME; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000416465.5; ENST00000433341.5; ENST00000331457.8; ENST00000486584.1
External Link	RMBase: m6A_site_562609
mod ID: M6ASITE057720		Click to Show/Hide the Full List
mod site	chr22:31400651-31400652:+		[6]
Sequence	CAAAAGAACAAGGCCACAGCACACCACTTAGGGCTGCTTAA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000433341.5; ENST00000486584.1; ENST00000416465.5; ENST00000331457.8
External Link	RMBase: m6A_site_562610
mod ID: M6ASITE057721		Click to Show/Hide the Full List
mod site	chr22:31400699-31400700:+		[5]
Sequence	CTTGCTAAGCTTCGTCGAGAACTCATTACTCCAAAGGGTGG
Motif Score	3.373380952
Cell/Tissue List	HepG2; A549; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000486584.1; ENST00000331457.8; ENST00000416465.5; ENST00000433341.5
External Link	RMBase: m6A_site_562611
mod ID: M6ASITE057722		Click to Show/Hide the Full List
mod site	chr22:31403045-31403046:+		[7]
Sequence	TAGGTTTTGATGTGGCCAAGACAGGTGATGCTCGAATTGGA
Motif Score	2.897386905
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000486584.1; ENST00000416465.5; ENST00000331457.8; ENST00000433341.5
External Link	RMBase: m6A_site_562612
mod ID: M6ASITE057723		Click to Show/Hide the Full List
mod site	chr22:31403096-31403097:+		[6]
Sequence	TTCCATCTGTGGGGAAGTCAACACTGCTTAGTAACCTGGCA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000416465.5; ENST00000331457.8; ENST00000486584.1; ENST00000433341.5
External Link	RMBase: m6A_site_562613
mod ID: M6ASITE057724		Click to Show/Hide the Full List
mod site	chr22:31403184-31403185:+		[6]
Sequence	TGTGCCTGGTGTCATCAGATACAAAGGTGCCAAGATCCAGG
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000331457.8; ENST00000416465.5; ENST00000433341.5; ENST00000486584.1
External Link	RMBase: m6A_site_562614
mod ID: M6ASITE057725		Click to Show/Hide the Full List
mod site	chr22:31420310-31420311:+		[6]
Sequence	GATGTCCTGAAACCTTTGGGACATAAGAAGATAATTGAAAA
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000331457.8; ENST00000433341.5; ENST00000416465.5
External Link	RMBase: m6A_site_562615
mod ID: M6ASITE057726		Click to Show/Hide the Full List
mod site	chr22:31423306-31423307:+		[8]
Sequence	AGAGTGAGCTGGATGCTGAAACTGTGAAGAGCATTCTGGCT
Motif Score	2.627720238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000416465.5; ENST00000433341.5; ENST00000331457.8
External Link	RMBase: m6A_site_562616
mod ID: M6ASITE057727		Click to Show/Hide the Full List
mod site	chr22:31423331-31423332:+		[6]
Sequence	GAAGAGCATTCTGGCTGAATACAAGATTCATAATGCCGATG
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000331457.8; ENST00000433341.5
External Link	RMBase: m6A_site_562617
mod ID: M6ASITE057728		Click to Show/Hide the Full List
mod site	chr22:31426760-31426761:+		[4]
Sequence	CCTATTGGAAAAGATCTGGGACTATCTGAAACTAGTGAGAA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000469673.1; ENST00000331457.8; ENST00000548143.1
External Link	RMBase: m6A_site_562618
mod ID: M6ASITE057729		Click to Show/Hide the Full List
mod site	chr22:31426770-31426771:+		[4]
Sequence	AAGATCTGGGACTATCTGAAACTAGTGAGAATGTAAGTCTT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000469673.1; ENST00000331457.8; ENST00000548143.1
External Link	RMBase: m6A_site_562619
mod ID: M6ASITE057730		Click to Show/Hide the Full List
mod site	chr22:31427068-31427069:+		[4]
Sequence	CTCTATTCTAGTTACACCAAACCCAAAGGCCAGTTACCAGA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000548143.1; ENST00000469673.1; ENST00000331457.8
External Link	RMBase: m6A_site_562620
mod ID: M6ASITE057731		Click to Show/Hide the Full List
mod site	chr22:31427154-31427155:+		[6]
Sequence	GGATTTCTGCATGAAGATTCACAAAAATCTTATCAAAGAAT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000331457.8; ENST00000548143.1; ENST00000469673.1
External Link	RMBase: m6A_site_562621
mod ID: M6ASITE057732		Click to Show/Hide the Full List
mod site	chr22:31433898-31433899:+		[9]
Sequence	GTCTGGGGTCTCTCTGTGAAACACAATCCTCAGAAAGTGGG
Motif Score	2.20572619
Cell/Tissue List	CD34; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000469673.1; ENST00000548143.1; ENST00000331457.8
External Link	RMBase: m6A_site_562622
mod ID: M6ASITE057733		Click to Show/Hide the Full List
mod site	chr22:31433900-31433901:+		[6]
Sequence	CTGGGGTCTCTCTGTGAAACACAATCCTCAGAAAGTGGGTA
Motif Score	2.084928571
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000548143.1; ENST00000469673.1; ENST00000331457.8
External Link	RMBase: m6A_site_562623
mod ID: M6ASITE057734		Click to Show/Hide the Full List
mod site	chr22:31433924-31433925:+		[9]
Sequence	TCCTCAGAAAGTGGGTAAAGACCATACGTTGGAGGATGAGG
Motif Score	2.876744048
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000469673.1; ENST00000548143.1; ENST00000331457.8
External Link	RMBase: m6A_site_562624
mod ID: M6ASITE057735		Click to Show/Hide the Full List
mod site	chr22:31433972-31433973:+		[9]
Sequence	TCAAATTGTGAAGAAGTGAAACCTTTCCCTTTTCCCATCTG
Motif Score	2.185083333
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000331457.8; ENST00000548143.1; ENST00000469673.1
External Link	RMBase: m6A_site_562625
mod ID: M6ASITE057736		Click to Show/Hide the Full List
mod site	chr22:31434001-31434002:+		[4]
Sequence	TTTTCCCATCTGCCGGACGAACCACAACAGCGTTCCCCATG
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; MT4; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000331457.8; ENST00000548143.1; ENST00000469673.1
External Link	RMBase: m6A_site_562626
mod ID: M6ASITE057737		Click to Show/Hide the Full List
mod site	chr22:31434004-31434005:+		[6]
Sequence	TCCCATCTGCCGGACGAACCACAACAGCGTTCCCCATGATC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000469673.1; ENST00000331457.8; ENST00000548143.1
External Link	RMBase: m6A_site_562627
mod ID: M6ASITE057738		Click to Show/Hide the Full List
mod site	chr22:31434102-31434103:+		[4]
Sequence	AGGGAGATGGAGGCACCCAAACTGGAACTTCATTTGTCTTA
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HEK293T; A549; HepG2; H1B; hESCs; Huh7; peripheral-blood; HEK293A-TOA; MSC; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000469673.1; ENST00000548143.1; ENST00000331457.8
External Link	RMBase: m6A_site_562628
mod ID: M6ASITE057739		Click to Show/Hide the Full List
mod site	chr22:31434108-31434109:+		[4]
Sequence	ATGGAGGCACCCAAACTGGAACTTCATTTGTCTTACCTTGG
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HEK293T; A549; HepG2; H1A; H1B; hESCs; fibroblasts; H1299; Huh7; peripheral-blood; HEK293A-TOA; MSC; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000548143.1; ENST00000469673.1; ENST00000331457.8
External Link	RMBase: m6A_site_562629
mod ID: M6ASITE057740		Click to Show/Hide the Full List
mod site	chr22:31434147-31434148:+		[4]
Sequence	GGTGTCACCTTGTATGTCGAACTGCATAAAAGATCTGGTAG
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; H1299; MM6; Huh7; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000331457.8; ENST00000548143.1; ENST00000469673.1
External Link	RMBase: m6A_site_562630
mod ID: M6ASITE057741		Click to Show/Hide the Full List
mod site	chr22:31434179-31434180:+		[6]
Sequence	ATCTGGTAGGCTGGTCAGCTACATGCAGCTCATGTGTCATT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000331457.8; ENST00000548143.1
External Link	RMBase: m6A_site_562631
mod ID: M6ASITE057742		Click to Show/Hide the Full List
mod site	chr22:31434276-31434277:+		[4]
Sequence	TACAGAAGGGATCCTTGGGAACTTCATCTTGAGTGTGAAAT
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293T; Huh7; HEK293A-TOA; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000548143.1; ENST00000331457.8
External Link	RMBase: m6A_site_562632
mod ID: M6ASITE057743		Click to Show/Hide the Full List
mod site	chr22:31434345-31434346:+		[10]
Sequence	CTTGATGTTTACTTATGGGAACCCCTTCCAAACTAGATATG
Motif Score	2.930744048
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000331457.8; ENST00000548143.1
External Link	RMBase: m6A_site_562633
mod ID: M6ASITE057744		Click to Show/Hide the Full List
mod site	chr22:31434356-31434357:+		[10]
Sequence	CTTATGGGAACCCCTTCCAAACTAGATATGGCTTTCAGTCC
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000548143.1; ENST00000331457.8
External Link	RMBase: m6A_site_562634
mod ID: M6ASITE057745		Click to Show/Hide the Full List
mod site	chr22:31437251-31437252:+		[8]
Sequence	TTGTGGTCCTCAGCTGTTTTACTTTCAGGATGCCTTCTATA
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000548143.1
External Link	RMBase: m6A_site_562636
mod ID: M6ASITE057746		Click to Show/Hide the Full List
mod site	chr22:31438204-31438205:+		[8]
Sequence	TGAATGGACAAATATCTAGAACTCTGGTAAATTAACTTGAG
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000548143.1
External Link	RMBase: m6A_site_562639
mod ID: M6ASITE057747		Click to Show/Hide the Full List
mod site	chr22:31438218-31438219:+		[8]
Sequence	TCTAGAACTCTGGTAAATTAACTTGAGTAGCATGGGAAATA
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000548143.1
External Link	RMBase: m6A_site_562640
mod ID: M6ASITE057748		Click to Show/Hide the Full List
mod site	chr22:31454332-31454333:+		[9]
Sequence	TCAACCTTCAAGCCCTTCAGACCTGCTTCTACCTCCTCCAC
Motif Score	2.876744048
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000464523.1; ENST00000548143.1
External Link	RMBase: m6A_site_562670
mod ID: M6ASITE057749		Click to Show/Hide the Full List
mod site	chr22:31463851-31463852:+		[11]
Sequence	TCACTATCTTTCTCTAATGGACTTCCTGAGCGCCGGGAGCT
Motif Score	4.065041667
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000483736.1; ENST00000548143.1; ENST00000464523.1
External Link	RMBase: m6A_site_562691
mod ID: M6ASITE057750		Click to Show/Hide the Full List
mod site	chr22:31488780-31488781:+		[4]
Sequence	GCACAAAATTGTCACCGAGAACAGTAAGTTTTCAGAAATCT
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000465646.5; ENST00000548143.1
External Link	RMBase: m6A_site_562697
mod ID: M6ASITE057751		Click to Show/Hide the Full List
mod site	chr22:31496156-31496157:+		[4]
Sequence	CCGGAAGTGAGGGAGGGAGGACTTTCGTACGCAGCCGCCTC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000465646.5; ENST00000540643.5; ENST00000548143.1
External Link	RMBase: m6A_site_562700
mod ID: M6ASITE057752		Click to Show/Hide the Full List
mod site	chr22:31496186-31496187:+		[4]
Sequence	GCAGCCGCCTCCCAGCTGGAACCTCATCTTTAGTGCTCGGC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000540643.5; ENST00000548143.1; ENST00000465646.5
External Link	RMBase: m6A_site_562701
mod ID: M6ASITE057753		Click to Show/Hide the Full List
mod site	chr22:31508274-31508275:+		[4]
Sequence	TTAGAAGGGGAAGATAAAAGACTTTGATTCATGAAGAATCT
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000540643.5; ENST00000382162.7; ENST00000432498.5; ENST00000444859.5; ENST00000400288.6; ENST00000411518.5; ENST00000524296.5; ENST00000548143.1; ENST00000465646.5; ENST00000443011.5; ENST00000400289.5; ENST00000465437.5
External Link	RMBase: m6A_site_562702
mod ID: M6ASITE057754		Click to Show/Hide the Full List
mod site	chr22:31521236-31521237:+		[4]
Sequence	TTCTTTCTTCCCAATCAGAGACTTGCGAATGTGTGGAATGA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000444859.5; ENST00000432498.5; ENST00000629688.1; ENST00000465437.5; ENST00000548143.1; ENST00000400289.5; ENST00000465646.5; ENST00000540643.5; ENST00000524296.5; ENST00000400288.6; ENST00000411518.5; ENST00000382162.7; ENST00000443011.5
External Link	RMBase: m6A_site_562703
mod ID: M6ASITE057755		Click to Show/Hide the Full List
mod site	chr22:31528716-31528717:+		[4]
Sequence	AAGGATGGTGCAGTTAAGAAACCTTATTCTGCAAAGACACT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000444859.5; ENST00000400288.6; ENST00000382162.7; ENST00000548143.1; ENST00000465437.5; ENST00000400289.5; ENST00000432498.5; ENST00000629688.1; ENST00000524296.5; ENST00000443011.5; ENST00000540643.5; ENST00000411518.5; ENST00000465646.5
External Link	RMBase: m6A_site_562704
mod ID: M6ASITE057756		Click to Show/Hide the Full List
mod site	chr22:31528732-31528733:+		[4]
Sequence	AGAAACCTTATTCTGCAAAGACACTGTCCAACAAGAAGTCT
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000548143.1; ENST00000465437.5; ENST00000411518.5; ENST00000400288.6; ENST00000524296.5; ENST00000382162.7; ENST00000629688.1; ENST00000400289.5; ENST00000432498.5; ENST00000465646.5; ENST00000444859.5; ENST00000443011.5; ENST00000540643.5
External Link	RMBase: m6A_site_562705

Ref 1	m6A-dependent up-regulation of DRG1 by METTL3 and ELAVL1 promotes growth, migration, and colony formation in osteosarcoma. Biosci Rep. 2020 Apr 30;40(4):BSR20200282. doi: 10.1042/BSR20200282.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 7	Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012 Apr 29;485(7397):201-6. doi: 10.1038/nature11112.
Ref 8	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 9	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 10	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 11	Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat Microbiol. 2016 Feb 22;1:16011. doi: 10.1038/nmicrobiol.2016.11.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map