m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00228)

Target Name	Microprocessor complex subunit DGCR8 (DGCR8)
Synonyms	DiGeorge syndrome critical region 8; C22orf12; DGCRK6; LP4941 Click to Show/Hide
Gene Name	DGCR8
Chromosomal Location	22q11.21
Function	Component of the microprocessor complex that acts as a RNA- and heme-binding protein that is involved in the initial step of microRNA (miRNA) biogenesis. Component of the microprocessor complex that is required to process primary miRNA transcripts (pri-miRNAs) to release precursor miRNA (pre-miRNA) in the nucleus. Within the microprocessor complex, DGCR8 function as a molecular anchor necessary for the recognition of pri-miRNA at dsRNA-ssRNA junction and directs DROSHA to cleave 11 bp away form the junction to release hairpin-shaped pre-miRNAs that are subsequently cut by the cytoplasmic DICER to generate mature miRNAs. The heme-bound DGCR8 dimer binds pri-miRNAs as a cooperative trimer (of dimers) and is active in triggering pri-miRNA cleavage, whereas the heme-free DGCR8 monomer binds pri-miRNAs as a dimer and is much less active. Both double-stranded and single-stranded regions of a pri-miRNA are required for its binding. Specifically recognizes and binds N6-methyladenosine (m6A)-containing pri-miRNAs, a modification required for pri-miRNAs processing. Involved in the silencing of embryonic stem cell self-renewal (By similarity). Click to Show/Hide
Gene ID	54487
Uniprot ID	DGCR8_HUMAN
HGNC ID	HGNC:2847
KEGG ID	hsa:54487

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

DGCR8 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Liver	Mus musculus
Treatment: Mettl3 knockout liver Control: Wild type liver cells		GSE198513
Regulation		logFC: -9.09E-01 p-value: 2.99E-21
More Results	Click to View More RNA-seq Results

In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	The m(6)A mark acts as a key post-transcriptional modification that promotes the initiation of miRNA biogenesis. METTL3 depletion reduced the binding of Microprocessor complex subunit DGCR8 (DGCR8) to pri-miRNAs and resulted in the global reduction of mature miRNAs and concomitant accumulation of unprocessed pri-miRNAs.
Target Regulation	Up regulation
Cell Process	miRNA maturation
Cell Process	MicroRNAs in cancer (hsa05206)
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	HeLa	Endocervical adenocarcinoma	Homo sapiens	CVCL_0030
	HUVEC-C	Normal	Homo sapiens	CVCL_2959
	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3 could interact with Microprocessor complex subunit DGCR8 (DGCR8) protein and positively modulate pri-miR-320b maturation process in an N6-methyladenosine (m6A)-dependent manner. Therefore, our findings uncover a VEGF-C-independent mechanism of exosomal and intracellular miR-320b-mediated LN metastasis and identify miR-320b as a novel predictive marker and therapeutic target for LN metastasis in ESCC.
Target Regulation	Up regulation
Responsed Disease	Esophageal squamous cell carcinoma		ICD-11: 2B70.1	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Epithelial-mesenchymal transition
In-vitro Model	TE-1	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1759
	KYSE-30	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1351
	KYSE-150	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1348
	HET-1A	Normal	Homo sapiens	CVCL_3702
	CVCL_E307	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_E307
	Eca-109	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_6898
In-vivo Model	Luciferase-labeled KYSE150 cells (5 × 10⁶) were inoculated into the footpads of BALB/c nude mice (4-5 weeks old, 18-20 g) to establish the popliteal lymphatic metastasis model.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3 promoted cell proliferation, migration, invasion and tumorigenesis in PCa. METTL3 upregulating the level of m6A, and interacted with Microprocessor complex subunit DGCR8 (DGCR8) to recognize the m6A modification of pre-miR-182 to regulate its splicing and maturation and promote the high expression of miRNA.
Target Regulation	Up regulation
Responsed Disease	Prostate cancer		ICD-11: 2C82	Disease Info
In-vitro Model	WPMY-1	Normal	Homo sapiens	CVCL_3814
	VCaP	Prostate carcinoma	Homo sapiens	CVCL_2235
	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	LNCaP	Prostate carcinoma	Homo sapiens	CVCL_0395
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	Interleukin 1-beta (IL-1-beta) is an important inducer of cartilage degeneration that can induce an inflammatory cascade reaction in chondrocytes and inhibit the normal biological function of cells. METTL3 could regulate miR-126-5p maturation, we first confirmed that METTL3 can bind the key protein underlying pri-miRNA processing, Microprocessor complex subunit DGCR8 (DGCR8). Additionally, when METTL3 expression was inhibited, the miR-126-5p maturation process was blocked.
Target Regulation	Up regulation
Responsed Disease	Chondropathies		ICD-11: FB82	Disease Info
Cell Process	RNA mature
In-vitro Model	Cartilage cells (From the cartilage tissue samples from patients)

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[6]
Response Summary	METTL14 interacts with the microprocessor protein Microprocessor complex subunit DGCR8 (DGCR8) and positively modulates the primary microRNA 126 process in an m6 A-dependent manner. microRNA 126 inhibits the repressing effect of METTL14 in Hepatocellular carcinoma metastasis.
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Cell Process	Tumor metastasis
In-vitro Model	HCC-1664 cell line (Primary HCC cells)
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
In-vivo Model	Male athymic BALB/c nude mice (5 weeks old) were used. Subcutaneous tumor growth assays, liver metastasis model, and tail vein injection model were performed as described.Metastases were detected using the IVIS@Lumina II system (Caliper Life Sciences, Hopkinton, MA) 10 minutes after intraperitoneal injection of 4.0 mg luciferin (Gold Biotech) in 50 uL of saline.

Esophageal cancer [ICD-11: 2B70]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL3 could interact with Microprocessor complex subunit DGCR8 (DGCR8) protein and positively modulate pri-miR-320b maturation process in an N6-methyladenosine (m6A)-dependent manner. Therefore, our findings uncover a VEGF-C-independent mechanism of exosomal and intracellular miR-320b-mediated LN metastasis and identify miR-320b as a novel predictive marker and therapeutic target for LN metastasis in ESCC.
Responsed Disease	Esophageal squamous cell carcinoma [ICD-11: 2B70.1]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Epithelial-mesenchymal transition
In-vitro Model	TE-1	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1759
	KYSE-30	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1351
	KYSE-150	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_1348
	HET-1A	Normal	Homo sapiens	CVCL_3702
	CVCL_E307	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_E307
	Eca-109	Esophageal squamous cell carcinoma	Homo sapiens	CVCL_6898
In-vivo Model	Luciferase-labeled KYSE150 cells (5 × 10⁶) were inoculated into the footpads of BALB/c nude mice (4-5 weeks old, 18-20 g) to establish the popliteal lymphatic metastasis model.

Liver cancer [ICD-11: 2C12]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[6]
Response Summary	METTL14 interacts with the microprocessor protein Microprocessor complex subunit DGCR8 (DGCR8) and positively modulates the primary microRNA 126 process in an m6 A-dependent manner. microRNA 126 inhibits the repressing effect of METTL14 in Hepatocellular carcinoma metastasis.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Tumor metastasis
In-vitro Model	HCC-1664 cell line (Primary HCC cells)
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
In-vivo Model	Male athymic BALB/c nude mice (5 weeks old) were used. Subcutaneous tumor growth assays, liver metastasis model, and tail vein injection model were performed as described.Metastases were detected using the IVIS@Lumina II system (Caliper Life Sciences, Hopkinton, MA) 10 minutes after intraperitoneal injection of 4.0 mg luciferin (Gold Biotech) in 50 uL of saline.

Prostate cancer [ICD-11: 2C82]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3 promoted cell proliferation, migration, invasion and tumorigenesis in PCa. METTL3 upregulating the level of m6A, and interacted with Microprocessor complex subunit DGCR8 (DGCR8) to recognize the m6A modification of pre-miR-182 to regulate its splicing and maturation and promote the high expression of miRNA.
Responsed Disease	Prostate cancer [ICD-11: 2C82]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	WPMY-1	Normal	Homo sapiens	CVCL_3814
	VCaP	Prostate carcinoma	Homo sapiens	CVCL_2235
	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	LNCaP	Prostate carcinoma	Homo sapiens	CVCL_0395
	DU145	Prostate carcinoma	Homo sapiens	CVCL_0105

Chondropathies [ICD-11: FB82]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[4]
Response Summary	Interleukin 1-beta (IL-1-beta) is an important inducer of cartilage degeneration that can induce an inflammatory cascade reaction in chondrocytes and inhibit the normal biological function of cells. METTL3 could regulate miR-126-5p maturation, we first confirmed that METTL3 can bind the key protein underlying pri-miRNA processing, Microprocessor complex subunit DGCR8 (DGCR8). Additionally, when METTL3 expression was inhibited, the miR-126-5p maturation process was blocked.
Responsed Disease	Chondropathies [ICD-11: FB82]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	RNA mature
In-vitro Model	Cartilage cells (From the cartilage tissue samples from patients)

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03374		Crosstalk Info
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Esophageal Squamous Cell Carcinoma	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00228)

Microprocessor complex subunit DGCR8 (DGCR8)

N4-acetylcytidine (ac4C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000057		Click to Show/Hide the Full List
mod site	chr22:20107303-20107304:+		[8]
Sequence	AGTTGGAAAGCAGTTAGCCTCACAGAAGATCCTTCAGCTGC
Cell/Tissue List	H1
Seq Type List	ac4C-seq
Transcript ID List	ENST00000495826.5; ENST00000485802.1; ENST00000383024.6; ENST00000495351.1; ENST00000498171.5; ENST00000407755.1; ENST00000351989.8
External Link	RMBase: ac4C_site_1264

Adenosine-to-Inosine editing (A-to-I)

In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE011030		Click to Show/Hide the Full List
mod site	chr22:20085806-20085807:+		[9]
Sequence	TTCTAAAAGCTGTCTACATTAATGAAAAGAGCAATGTGGCC
Transcript ID List	ENST00000457069.1; ENST00000580330.1; MIMAT0017998; ENST00000383024.6; ENST00000351989.8
External Link	RMBase: RNA-editing_site_90842
mod ID: A2ISITE011031		Click to Show/Hide the Full List
mod site	chr22:20101364-20101365:+		[9]
Sequence	GGCGGGCAGATTACGAGGTAAGGACATCGAGACCATCCTGG
Transcript ID List	ENST00000407755.1; rmsk_5248496; ENST00000491892.1; ENST00000495826.5; ENST00000498171.5; ENST00000383024.6; ENST00000351989.8
External Link	RMBase: RNA-editing_site_90843

5-methylcytidine (m5C)

In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002867		Click to Show/Hide the Full List
mod site	chr22:20086786-20086787:+
Sequence	GAAATTAAAAAAAAAAAAAACAAAAACCAAAATCCCCTCTG
Cell/Tissue List	HEK293T
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000407755.1; ENST00000351989.8; rmsk_5248472; ENST00000383024.6; ENST00000495826.5
External Link	RMBase: m5C_site_30363
mod ID: M5CSITE002868		Click to Show/Hide the Full List
mod site	chr22:20107777-20107778:+
Sequence	TTGAAGGAGAGCGAGTGTGTCAGGGTAGCTCTCCCTGGTAC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000475941.1; ENST00000485802.1; ENST00000351989.8; ENST00000407755.1; ENST00000383024.6; ENST00000498171.5; ENST00000495826.5
External Link	RMBase: m5C_site_30364

N6-methyladenosine (m6A)

In total 76 m6A sequence/site(s) in this target gene
mod ID: M6ASITE056414		Click to Show/Hide the Full List
mod site	chr22:20080289-20080290:+		[10]
Sequence	CCGGCGACCGGAGAGCCTGGACAGGCTTTCCAGATGGCTGC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000383024.6; ENST00000351989.8
External Link	RMBase: m6A_site_555351
mod ID: M6ASITE056415		Click to Show/Hide the Full List
mod site	chr22:20085882-20085883:+		[10]
Sequence	ACGCGCCCGGGTCTCAGCGGACTTGTGCATGTTAGCTGTGT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; hNPCs; hESCs; fibroblasts; GM12878; CD8T; MM6; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000495826.5; ENST00000457069.1; ENST00000407755.1; ENST00000351989.8; ENST00000383024.6
External Link	RMBase: m6A_site_555352
mod ID: M6ASITE056416		Click to Show/Hide the Full List
mod site	chr22:20085926-20085927:+		[10]
Sequence	TTTATGTGAGGGCTTGTAAAACTCTGGTCTTGTAAACTAGT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; hESCs; fibroblasts; GM12878; H1299; MM6; HEK293A-TOA; iSLK; MSC; TIME; TREX; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000407755.1; ENST00000383024.6; ENST00000495826.5; ENST00000457069.1; ENST00000351989.8
External Link	RMBase: m6A_site_555353
mod ID: M6ASITE056417		Click to Show/Hide the Full List
mod site	chr22:20085941-20085942:+		[10]
Sequence	GTAAAACTCTGGTCTTGTAAACTAGTCTTAAGCGCTTTTAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; H1B; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000351989.8; ENST00000457069.1; ENST00000383024.6; ENST00000495826.5; ENST00000407755.1
External Link	RMBase: m6A_site_555354
mod ID: M6ASITE056418		Click to Show/Hide the Full List
mod site	chr22:20085969-20085970:+		[10]
Sequence	TAAGCGCTTTTAATATGGAGACAGATGAGAGCCCCTCTCCG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000383024.6; ENST00000457069.1; ENST00000351989.8; ENST00000495826.5; ENST00000407755.1
External Link	RMBase: m6A_site_555355
mod ID: M6ASITE056419		Click to Show/Hide the Full List
mod site	chr22:20086133-20086134:+		[10]
Sequence	GTTGGCTCTGGTGGTGATGGACAGTCCGAACTCCCTGCTGA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000457069.1; ENST00000408439.3; ENST00000383024.6; ENST00000351989.8; ENST00000495826.5; ENST00000407755.1
External Link	RMBase: m6A_site_555356
mod ID: M6ASITE056420		Click to Show/Hide the Full List
mod site	chr22:20086142-20086143:+		[10]
Sequence	GGTGGTGATGGACAGTCCGAACTCCCTGCTGAGGACCCCTT
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; MM6; Huh7; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407755.1; ENST00000351989.8; ENST00000457069.1; ENST00000495826.5; ENST00000383024.6
External Link	RMBase: m6A_site_555357
mod ID: M6ASITE056421		Click to Show/Hide the Full List
mod site	chr22:20086156-20086157:+		[10]
Sequence	GTCCGAACTCCCTGCTGAGGACCCCTTCAACTTCTACGGAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; MM6; Huh7; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407755.1; ENST00000495826.5; ENST00000383024.6; ENST00000457069.1; ENST00000351989.8
External Link	RMBase: m6A_site_555358
mod ID: M6ASITE056422		Click to Show/Hide the Full List
mod site	chr22:20086225-20086226:+		[10]
Sequence	TAAGGGCCGCCTCCTCATAGACCCGAACTGTAGTGGCCACA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000383024.6; ENST00000457069.1; ENST00000351989.8; ENST00000495826.5; ENST00000407755.1
External Link	RMBase: m6A_site_555359
mod ID: M6ASITE056424		Click to Show/Hide the Full List
mod site	chr22:20086231-20086232:+		[10]
Sequence	CCGCCTCCTCATAGACCCGAACTGTAGTGGCCACAGCCCGC
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407755.1; ENST00000351989.8; ENST00000383024.6; ENST00000457069.1; ENST00000495826.5
External Link	RMBase: m6A_site_555360
mod ID: M6ASITE056425		Click to Show/Hide the Full List
mod site	chr22:20086357-20086358:+		[10]
Sequence	CGAGAGCTGCAGGAGTAAGGACAGGAAGGTGCTGTACACAG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; hESCs; GM12878; MM6; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407755.1; ENST00000351989.8; ENST00000383024.6; ENST00000495826.5
External Link	RMBase: m6A_site_555361
mod ID: M6ASITE056426		Click to Show/Hide the Full List
mod site	chr22:20086471-20086472:+		[11]
Sequence	CTTTGGCGGGAGTGTTGGTGACGGGGTAGGCATAGGGGGTG
Motif Score	2.833690476
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000383024.6; ENST00000351989.8; ENST00000495826.5; ENST00000407755.1
External Link	RMBase: m6A_site_555362
mod ID: M6ASITE056427		Click to Show/Hide the Full List
mod site	chr22:20086582-20086583:+		[12]
Sequence	TGAGTTAGAAGATTTTACTGACAATTTGGAGCTAGATGAAG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000383024.6; ENST00000351989.8; ENST00000407755.1; ENST00000495826.5
External Link	RMBase: m6A_site_555363
mod ID: M6ASITE056428		Click to Show/Hide the Full List
mod site	chr22:20086645-20086646:+		[10]
Sequence	TAAAGCAATCGTTCAGAGAGACAGAGTGGATGAAGAGGCCT
Motif Score	2.897386905
Cell/Tissue List	HeLa; Huh7; peripheral-blood
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000495826.5; ENST00000383024.6; ENST00000407755.1; ENST00000351989.8
External Link	RMBase: m6A_site_555364
mod ID: M6ASITE056429		Click to Show/Hide the Full List
mod site	chr22:20086722-20086723:+		[10]
Sequence	TCTAGAGGGCTCTTAGCAAAACCCAAAGAGAGATTTGGGAA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000495826.5; ENST00000383024.6; ENST00000351989.8; ENST00000407755.1
External Link	RMBase: m6A_site_555365
mod ID: M6ASITE056430		Click to Show/Hide the Full List
mod site	chr22:20086785-20086786:+		[10]
Sequence	GGAAATTAAAAAAAAAAAAAACAAAAACCAAAATCCCCTCT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	rmsk_5248472; ENST00000351989.8; ENST00000383024.6; ENST00000495826.5; ENST00000407755.1
External Link	RMBase: m6A_site_555366
mod ID: M6ASITE056431		Click to Show/Hide the Full List
mod site	chr22:20086791-20086792:+		[10]
Sequence	TAAAAAAAAAAAAAACAAAAACCAAAATCCCCTCTGAGGTG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000495826.5; ENST00000383024.6; ENST00000351989.8; ENST00000407755.1; rmsk_5248472
External Link	RMBase: m6A_site_555367
mod ID: M6ASITE056432		Click to Show/Hide the Full List
mod site	chr22:20087145-20087146:+		[10]
Sequence	CCAGGGGCTCTGGTGTCTGAACAGCGTGTTTTGCAGGATGA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000407755.1; ENST00000495826.5; ENST00000383024.6; ENST00000351989.8; ENST00000498171.5
External Link	RMBase: m6A_site_555368
mod ID: M6ASITE056433		Click to Show/Hide the Full List
mod site	chr22:20087171-20087172:+		[12]
Sequence	TGTTTTGCAGGATGACTTTGACAACGATGTGGATGCTCTGC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000383024.6; ENST00000407755.1; ENST00000498171.5; ENST00000495826.5; ENST00000351989.8
External Link	RMBase: m6A_site_555369
mod ID: M6ASITE056435		Click to Show/Hide the Full List
mod site	chr22:20087227-20087228:+		[10]
Sequence	GTGCCCCCAAAAAGAGGCGAACAGAGGAAAAATATGGCGGA
Motif Score	2.951386905
Cell/Tissue List	HeLa; MT4; Huh7; peripheral-blood
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000383024.6; ENST00000407755.1; ENST00000351989.8; ENST00000498171.5; ENST00000495826.5
External Link	RMBase: m6A_site_555370
mod ID: M6ASITE056436		Click to Show/Hide the Full List
mod site	chr22:20087249-20087250:+		[10]
Sequence	AGAGGAAAAATATGGCGGAGACAGCGACCATCCGTCCGATG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293; MT4; Huh7; peripheral-blood
Seq Type List	m6A-seq; m6A-REF-seq; MeRIP-seq
Transcript ID List	ENST00000498171.5; ENST00000351989.8; ENST00000383024.6; ENST00000495826.5; ENST00000407755.1
External Link	RMBase: m6A_site_555371
mod ID: M6ASITE056437		Click to Show/Hide the Full List
mod site	chr22:20087275-20087276:+		[10]
Sequence	ACCATCCGTCCGATGGAGAGACAAGTGTGCAGCCGATGATG
Motif Score	2.897386905
Cell/Tissue List	HeLa; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407755.1; ENST00000351989.8; ENST00000495826.5; ENST00000498171.5; ENST00000383024.6
External Link	RMBase: m6A_site_555372
mod ID: M6ASITE056438		Click to Show/Hide the Full List
mod site	chr22:20087308-20087309:+		[10]
Sequence	CGATGATGACCAAGATTAAAACAGTGCTCAAAAGTACGTGT
Motif Score	2.20572619
Cell/Tissue List	HeLa; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407755.1; ENST00000495826.5; ENST00000498171.5; ENST00000351989.8; ENST00000383024.6
External Link	RMBase: m6A_site_555373
mod ID: M6ASITE056439		Click to Show/Hide the Full List
mod site	chr22:20089977-20089978:+		[12]
Sequence	CAATTTCACTATCCACAGAAACACGACCCTCCTCTGAGTAG
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407755.1; ENST00000498171.5; ENST00000495826.5; ENST00000383024.6; ENST00000351989.8
External Link	RMBase: m6A_site_555374
mod ID: M6ASITE056440		Click to Show/Hide the Full List
mod site	chr22:20090030-20090031:+		[10]
Sequence	GCATTATAAGAAAATGAAGGACAACGAGGAACGGGAGCAAA
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T; endometrial
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000498171.5; ENST00000407755.1; ENST00000383024.6; ENST00000351989.8; ENST00000495826.5
External Link	RMBase: m6A_site_555375
mod ID: M6ASITE056441		Click to Show/Hide the Full List
mod site	chr22:20090177-20090178:+		[10]
Sequence	GGGGCCCCCGGACGAGAAAGACCCACTAGGGGCTGAGGCAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; peripheral-blood; HEK293T; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000498171.5; ENST00000407755.1; ENST00000495826.5; ENST00000351989.8; ENST00000383024.6
External Link	RMBase: m6A_site_555376
mod ID: M6ASITE056442		Click to Show/Hide the Full List
mod site	chr22:20091505-20091506:+		[10]
Sequence	TTACTGTGAAAAAATTCAGGACTTGGGCTGAGCGGCGGCAA
Motif Score	4.065041667
Cell/Tissue List	HeLa; peripheral-blood; HEK293T; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000351989.8; ENST00000383024.6; ENST00000495826.5; ENST00000498171.5; ENST00000407755.1
External Link	RMBase: m6A_site_555377
mod ID: M6ASITE056443		Click to Show/Hide the Full List
mod site	chr22:20091622-20091623:+		[12]
Sequence	TATCAGTGCAAGATGCACCCACAAAGAAAGGTATAAGCCTC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000498171.5; ENST00000495826.5; ENST00000407755.1; ENST00000383024.6; ENST00000351989.8
External Link	RMBase: m6A_site_555378
mod ID: M6ASITE056444		Click to Show/Hide the Full List
mod site	chr22:20091919-20091920:+		[12]
Sequence	GGTCTGCATCCTGCACGAGTACATGCAGCGTGTCCTCAAGG
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407755.1; ENST00000498171.5; ENST00000495826.5; ENST00000351989.8; ENST00000383024.6
External Link	RMBase: m6A_site_555379
mod ID: M6ASITE056446		Click to Show/Hide the Full List
mod site	chr22:20094720-20094721:+		[12]
Sequence	TTTTTTTCATAGCCCGAGCTACACTGGAAATCCTCATCCCT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000351989.8; ENST00000495826.5; ENST00000407755.1; ENST00000383024.6; ENST00000498171.5; ENST00000491892.1
External Link	RMBase: m6A_site_555380
mod ID: M6ASITE056447		Click to Show/Hide the Full List
mod site	chr22:20094778-20094779:+		[13]
Sequence	CTCTGAAGAGAAGCCCAAAGACAGTGAAGAACTCGAGGTGA
Motif Score	2.897386905
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000407755.1; ENST00000491892.1; ENST00000383024.6; ENST00000498171.5; ENST00000351989.8; ENST00000495826.5
External Link	RMBase: m6A_site_555381
mod ID: M6ASITE056448		Click to Show/Hide the Full List
mod site	chr22:20106186-20106187:+		[12]
Sequence	TGTGTTGTAGTATTTTAACCACATCAGCATCGAGGACTCGC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000495826.5; ENST00000407755.1; ENST00000498171.5; ENST00000491892.1; ENST00000351989.8; ENST00000495351.1; ENST00000383024.6
External Link	RMBase: m6A_site_555382
mod ID: M6ASITE056449		Click to Show/Hide the Full List
mod site	chr22:20106608-20106609:+		[12]
Sequence	AAGAAACCATGGGATGGGTGACACGTCTATCAAGTTTGAAG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000498171.5; ENST00000495351.1; ENST00000383024.6; ENST00000351989.8; ENST00000495826.5; ENST00000485802.1; ENST00000491892.1; ENST00000407755.1
External Link	RMBase: m6A_site_555383
mod ID: M6ASITE056450		Click to Show/Hide the Full List
mod site	chr22:20106961-20106962:+		[10]
Sequence	GGAAAGGCCCTCCTCCTCGAACAGCCAGCAGAATCCTGCTG
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000485802.1; ENST00000383024.6; ENST00000491892.1; ENST00000498171.5; ENST00000495351.1; ENST00000407755.1; ENST00000495826.5; ENST00000351989.8
External Link	RMBase: m6A_site_555384
mod ID: M6ASITE056451		Click to Show/Hide the Full List
mod site	chr22:20107276-20107277:+		[14]
Sequence	CTTTCTCTGTGTAGGTAAGAACAAGAGAGTTGGAAAGCAGT
Motif Score	2.951386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000407755.1; ENST00000485802.1; ENST00000495826.5; ENST00000351989.8; ENST00000498171.5; ENST00000495351.1; ENST00000383024.6
External Link	RMBase: m6A_site_555385
mod ID: M6ASITE056452		Click to Show/Hide the Full List
mod site	chr22:20107331-20107332:+		[13]
Sequence	ATCCTTCAGCTGCTGCACCCACATGTCAAGAACTGGGGGTC
Motif Score	2.053113095
Cell/Tissue List	HEK293; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000485802.1; ENST00000495826.5; ENST00000383024.6; ENST00000351989.8; ENST00000495351.1; ENST00000407755.1; ENST00000498171.5
External Link	RMBase: m6A_site_555386
mod ID: M6ASITE056453		Click to Show/Hide the Full List
mod site	chr22:20107342-20107343:+		[15]
Sequence	GCTGCACCCACATGTCAAGAACTGGGGGTCTTTACTGCGCA
Motif Score	3.373380952
Cell/Tissue List	HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000498171.5; ENST00000495351.1; ENST00000383024.6; ENST00000351989.8; ENST00000495826.5; ENST00000485802.1; ENST00000407755.1
External Link	RMBase: m6A_site_555387
mod ID: M6ASITE056454		Click to Show/Hide the Full List
mod site	chr22:20108408-20108409:+		[16]
Sequence	GAGCTCTGGCATCCCGAGGAACCACAGCACCCTTGGGGCTG
Motif Score	2.930744048
Cell/Tissue List	HEK293T; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000351989.8; ENST00000475941.1; ENST00000498171.5; ENST00000485802.1; ENST00000495826.5; ENST00000407755.1; ENST00000383024.6
External Link	RMBase: m6A_site_555388
mod ID: M6ASITE056455		Click to Show/Hide the Full List
mod site	chr22:20108675-20108676:+		[17]
Sequence	GAAAGGCCTGGCAGCTATGGACTGCCCCTCGCTCTCTGCTG
Motif Score	4.065041667
Cell/Tissue List	HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000475941.1; ENST00000485802.1; ENST00000407755.1; ENST00000498171.5; ENST00000351989.8; ENST00000495826.5; ENST00000383024.6
External Link	RMBase: m6A_site_555389
mod ID: M6ASITE056457		Click to Show/Hide the Full List
mod site	chr22:20108892-20108893:+		[10]
Sequence	GGTGCTATACTTCCCAGGAGACATCGGACAAGAGTGTGATT
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T; U2OS; MT4; Huh7
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000351989.8; ENST00000485802.1; ENST00000495826.5; ENST00000475941.1; ENST00000407755.1; ENST00000383024.6; ENST00000498171.5
External Link	RMBase: m6A_site_555390
mod ID: M6ASITE056458		Click to Show/Hide the Full List
mod site	chr22:20108899-20108900:+		[10]
Sequence	TACTTCCCAGGAGACATCGGACAAGAGTGTGATTGAGCTGC
Motif Score	3.643047619
Cell/Tissue List	HeLa; U2OS; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000383024.6; ENST00000495826.5; ENST00000485802.1; ENST00000475941.1; ENST00000407755.1; ENST00000351989.8; ENST00000498171.5
External Link	RMBase: m6A_site_555391
mod ID: M6ASITE056459		Click to Show/Hide the Full List
mod site	chr22:20108938-20108939:+		[10]
Sequence	GCAGCAGTATGCCAAGAAGAACAAGCCCAACCTGCACATCC
Motif Score	2.951386905
Cell/Tissue List	HeLa; U2OS; MT4; Huh7; CD4T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000475941.1; ENST00000383024.6; ENST00000498171.5; ENST00000495826.5; ENST00000485802.1; ENST00000407755.1; ENST00000351989.8
External Link	RMBase: m6A_site_555392
mod ID: M6ASITE056460		Click to Show/Hide the Full List
mod site	chr22:20109066-20109067:+		[10]
Sequence	CCTGTGGCACCTGTGGAGGGACAGCAGACCCCAGGACCCGT
Motif Score	3.643047619
Cell/Tissue List	HeLa; Huh7; CD4T; peripheral-blood; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000498171.5; ENST00000351989.8; ENST00000485802.1; ENST00000495826.5; ENST00000383024.6; ENST00000475941.1; ENST00000407755.1
External Link	RMBase: m6A_site_555393
mod ID: M6ASITE056461		Click to Show/Hide the Full List
mod site	chr22:20109073-20109074:+		[10]
Sequence	CACCTGTGGAGGGACAGCAGACCCCAGGACCCGTGCCTGAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; Huh7; CD4T; peripheral-blood; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000485802.1; ENST00000498171.5; ENST00000383024.6; ENST00000475941.1; ENST00000495826.5; ENST00000407755.1; ENST00000351989.8
External Link	RMBase: m6A_site_555394
mod ID: M6ASITE056462		Click to Show/Hide the Full List
mod site	chr22:20109081-20109082:+		[10]
Sequence	GAGGGACAGCAGACCCCAGGACCCGTGCCTGAGCTGACACC
Motif Score	3.622404762
Cell/Tissue List	HeLa; Huh7; CD4T; peripheral-blood; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000383024.6; ENST00000495826.5; ENST00000351989.8; ENST00000485802.1; ENST00000407755.1; ENST00000498171.5; ENST00000475941.1
External Link	RMBase: m6A_site_555395
mod ID: M6ASITE056463		Click to Show/Hide the Full List
mod site	chr22:20110030-20110031:+		[10]
Sequence	TGTTGTTCTTTCAGGAGGAGACTCGAAAGAAGCCCAAGATG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; A549; U2OS; H1A; H1B; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000383024.6; ENST00000475941.1; ENST00000498171.5; ENST00000407755.1; ENST00000495826.5; ENST00000351989.8
External Link	RMBase: m6A_site_555396
mod ID: M6ASITE056464		Click to Show/Hide the Full List
mod site	chr22:20110160-20110161:+		[10]
Sequence	CCAGCCGCACTTCTGAGGAGACCAGCAGTCATGCATCGTGC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1B; H1A; hESCs; GM12878; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TIME; TREX; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407755.1; ENST00000475941.1; ENST00000495826.5; ENST00000498171.5; ENST00000351989.8; ENST00000383024.6
External Link	RMBase: m6A_site_555397
mod ID: M6ASITE056465		Click to Show/Hide the Full List
mod site	chr22:20110268-20110269:+		[10]
Sequence	GGAGGCTTTAGTGTACAGGGACAGCCATGGCCACACAGCAC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; CD8T; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000498171.5; ENST00000351989.8; ENST00000383024.6; ENST00000407755.1; ENST00000495826.5; ENST00000475941.1
External Link	RMBase: m6A_site_555398
mod ID: M6ASITE056466		Click to Show/Hide the Full List
mod site	chr22:20110339-20110340:+		[10]
Sequence	CTCCAGGCCTGAATGGATGGACTCAGCGACTGCACCAGTGG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000351989.8; ENST00000475941.1; ENST00000383024.6; ENST00000495826.5; ENST00000498171.5; ENST00000407755.1
External Link	RMBase: m6A_site_555399
mod ID: M6ASITE056468		Click to Show/Hide the Full List
mod site	chr22:20110376-20110377:+		[10]
Sequence	GTGGCAGCTGGTGACTGTGGACAGTGGTGGACCCTGCTTCT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000495826.5; ENST00000407755.1; ENST00000498171.5; ENST00000475941.1; ENST00000351989.8; ENST00000383024.6
External Link	RMBase: m6A_site_555400
mod ID: M6ASITE056469		Click to Show/Hide the Full List
mod site	chr22:20110386-20110387:+		[10]
Sequence	GTGACTGTGGACAGTGGTGGACCCTGCTTCTGTGCACCTGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000498171.5; ENST00000475941.1; ENST00000383024.6; ENST00000351989.8; ENST00000495826.5; ENST00000407755.1
External Link	RMBase: m6A_site_555401
mod ID: M6ASITE056470		Click to Show/Hide the Full List
mod site	chr22:20110452-20110453:+		[11]
Sequence	CATGAATTTTAGTATGTAATACGCACTGACGACACATGATG
Motif Score	2.084416667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000383024.6; ENST00000407755.1; ENST00000498171.5; ENST00000351989.8; ENST00000495826.5; ENST00000475941.1
External Link	RMBase: m6A_site_555402
mod ID: M6ASITE056471		Click to Show/Hide the Full List
mod site	chr22:20110570-20110571:+		[10]
Sequence	CCTGCAGGGCTGCTACAGGGACCTGGTCAGGAGGTGCACAT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000475941.1; ENST00000351989.8; ENST00000383024.6; ENST00000407755.1; ENST00000495826.5; ENST00000498171.5
External Link	RMBase: m6A_site_555403
mod ID: M6ASITE056472		Click to Show/Hide the Full List
mod site	chr22:20110587-20110588:+		[12]
Sequence	GGGACCTGGTCAGGAGGTGCACATGGTGCCCTGCCCTCACC
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000475941.1; ENST00000407755.1; ENST00000383024.6; ENST00000498171.5; ENST00000351989.8; ENST00000495826.5
External Link	RMBase: m6A_site_555404
mod ID: M6ASITE056473		Click to Show/Hide the Full List
mod site	chr22:20110662-20110663:+		[18]
Sequence	AAGAGAAAGGAATATTTTAAACCTTTTTGGCTTAAACAGAA
Motif Score	2.185083333
Cell/Tissue List	HeLa; A549; HEK293T; HepG2; H1A; H1B; GM12878; peripheral-blood; MSC
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000495826.5; ENST00000498171.5; ENST00000383024.6; ENST00000475941.1; ENST00000351989.8; ENST00000407755.1
External Link	RMBase: m6A_site_555405
mod ID: M6ASITE056474		Click to Show/Hide the Full List
mod site	chr22:20110677-20110678:+		[15]
Sequence	TTTAAACCTTTTTGGCTTAAACAGAATTTTAGCATCAGAAC
Motif Score	2.20572619
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000383024.6; ENST00000475941.1; ENST00000495826.5; ENST00000407755.1; ENST00000498171.5; ENST00000351989.8
External Link	RMBase: m6A_site_555406
mod ID: M6ASITE056475		Click to Show/Hide the Full List
mod site	chr22:20110696-20110697:+		[15]
Sequence	AACAGAATTTTAGCATCAGAACTAGCTTTCTGGGATTGGAG
Motif Score	3.373380952
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000383024.6; ENST00000475941.1; ENST00000407755.1; ENST00000495826.5; ENST00000498171.5; ENST00000351989.8
External Link	RMBase: m6A_site_555407
mod ID: M6ASITE056476		Click to Show/Hide the Full List
mod site	chr22:20110721-20110722:+		[15]
Sequence	CTTTCTGGGATTGGAGGCAAACCATCAAGGTGGTCCCTCTC
Motif Score	2.185083333
Cell/Tissue List	HepG2; HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000475941.1; ENST00000495826.5; ENST00000498171.5; ENST00000351989.8; ENST00000407755.1; ENST00000383024.6
External Link	RMBase: m6A_site_555408
mod ID: M6ASITE056477		Click to Show/Hide the Full List
mod site	chr22:20110750-20110751:+		[12]
Sequence	GTGGTCCCTCTCCAGTCTGGACACGATGCCAGCAAGGATGA
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T; HepG2; HeLa
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000383024.6; ENST00000495826.5; ENST00000475941.1; ENST00000498171.5; ENST00000351989.8; ENST00000407755.1
External Link	RMBase: m6A_site_555409
mod ID: M6ASITE056479		Click to Show/Hide the Full List
mod site	chr22:20110752-20110753:+		[11]
Sequence	GGTCCCTCTCCAGTCTGGACACGATGCCAGCAAGGATGACG
Motif Score	2.058863095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000351989.8; ENST00000498171.5; ENST00000407755.1; ENST00000383024.6; ENST00000475941.1; ENST00000495826.5
External Link	RMBase: m6A_site_555410
mod ID: M6ASITE056480		Click to Show/Hide the Full List
mod site	chr22:20110856-20110857:+		[11]
Sequence	CCCTAAAAGCGCCTCTTTGGACACTGAGGCCCTCTCTGCCT
Motif Score	3.643047619
Cell/Tissue List	HEK293T; hESC-HEK293T; HeLa
Seq Type List	DART-seq; MAZTER-seq; MeRIP-seq; m6A-seq
Transcript ID List	ENST00000407755.1; ENST00000351989.8; ENST00000495826.5; ENST00000498171.5; ENST00000383024.6; ENST00000475941.1
External Link	RMBase: m6A_site_555412
mod ID: M6ASITE056481		Click to Show/Hide the Full List
mod site	chr22:20110903-20110904:+		[11]
Sequence	GCCTCCGGCAACAGTTTTTTACAAAGATTTTTTGCAGTCGA
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000351989.8; ENST00000475941.1; ENST00000407755.1; ENST00000498171.5; ENST00000495826.5; ENST00000383024.6
External Link	RMBase: m6A_site_555414
mod ID: M6ASITE056482		Click to Show/Hide the Full List
mod site	chr22:20110982-20110983:+		[18]
Sequence	ATATTTTAGCATTTTGAAAGACTTTCACAGTGAGAGTAGAA
Motif Score	3.319380952
Cell/Tissue List	HEK293T; HeLa; HepG2; hNPCs; hESCs; fibroblasts; A549; GM12878; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000351989.8; ENST00000495826.5; ENST00000383024.6; ENST00000407755.1; ENST00000475941.1; ENST00000498171.5
External Link	RMBase: m6A_site_555417
mod ID: M6ASITE056483		Click to Show/Hide the Full List
mod site	chr22:20111036-20111037:+		[18]
Sequence	TCATGCATTTTAGCAAGTGGACTTGTTGAAACAGGAAGCAA
Motif Score	4.065041667
Cell/Tissue List	HEK293T; HeLa; HepG2; hESCs; fibroblasts; A549; GM12878; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000475941.1; ENST00000383024.6; ENST00000498171.5; ENST00000495826.5; ENST00000351989.8; ENST00000407755.1
External Link	RMBase: m6A_site_555418
mod ID: M6ASITE056484		Click to Show/Hide the Full List
mod site	chr22:20111046-20111047:+		[18]
Sequence	TAGCAAGTGGACTTGTTGAAACAGGAAGCAAGGGCCTTCAG
Motif Score	2.20572619
Cell/Tissue List	HEK293T; HeLa; HepG2; hESCs; fibroblasts; A549; GM12878; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000351989.8; ENST00000383024.6; ENST00000495826.5; ENST00000475941.1; ENST00000407755.1; ENST00000498171.5
External Link	RMBase: m6A_site_555419
mod ID: M6ASITE056486		Click to Show/Hide the Full List
mod site	chr22:20111251-20111252:+		[14]
Sequence	AAGGCTGGCCCTGGTGGTGGACTGGCACCTGTGCAGAGTGC
Motif Score	4.065041667
Cell/Tissue List	Huh7; peripheral-blood
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000383024.6; ENST00000498171.5; ENST00000495826.5; ENST00000407755.1; ENST00000475941.1; ENST00000351989.8
External Link	RMBase: m6A_site_555423
mod ID: M6ASITE056487		Click to Show/Hide the Full List
mod site	chr22:20111353-20111354:+		[11]
Sequence	CCATGCCCCCTACAGGCGGTACTGATGGCGCTTTTTTTTTT
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000351989.8; ENST00000498171.5; ENST00000383024.6; ENST00000407755.1; ENST00000495826.5
External Link	RMBase: m6A_site_555424
mod ID: M6ASITE056488		Click to Show/Hide the Full List
mod site	chr22:20111389-20111390:+		[14]
Sequence	TTTTTTTTTCTGTCAGGAAAACAATGTTGGCCTGTGGGCCG
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000383024.6; ENST00000495826.5; ENST00000407755.1; ENST00000498171.5; ENST00000351989.8
External Link	RMBase: m6A_site_555425
mod ID: M6ASITE056489		Click to Show/Hide the Full List
mod site	chr22:20111416-20111417:+		[12]
Sequence	TGGCCTGTGGGCCGCCCACAACATATCCTTCCCTCACTACC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407755.1; ENST00000495826.5; ENST00000498171.5; ENST00000383024.6; ENST00000351989.8
External Link	RMBase: m6A_site_555426
mod ID: M6ASITE056490		Click to Show/Hide the Full List
mod site	chr22:20111505-20111506:+		[12]
Sequence	ACTCAAATTGCTATAATTAGACACTTGCTTCTGTCTTGCCT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407755.1; ENST00000498171.5; ENST00000351989.8; ENST00000383024.6; ENST00000495826.5
External Link	RMBase: m6A_site_555427
mod ID: M6ASITE056491		Click to Show/Hide the Full List
mod site	chr22:20111594-20111595:+		[10]
Sequence	CCAGCCAGATGCGCCTGTGAACCAAAGCTTCGTGCACATGT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000351989.8; ENST00000498171.5; ENST00000495826.5; ENST00000407755.1; ENST00000383024.6
External Link	RMBase: m6A_site_555428
mod ID: M6ASITE056492		Click to Show/Hide the Full List
mod site	chr22:20111609-20111610:+		[12]
Sequence	TGTGAACCAAAGCTTCGTGCACATGTGTTCCCCTAAAGGTT
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000495826.5; ENST00000351989.8; ENST00000383024.6; ENST00000498171.5; ENST00000407755.1
External Link	RMBase: m6A_site_555429
mod ID: M6ASITE056494		Click to Show/Hide the Full List
mod site	chr22:20111686-20111687:+		[11]
Sequence	ACCACAGCAGGTGCTGCCATACTCTTGTGGTCTCTGTGCGC
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000498171.5; ENST00000407755.1; ENST00000351989.8; ENST00000495826.5; ENST00000383024.6
External Link	RMBase: m6A_site_555430
mod ID: M6ASITE056495		Click to Show/Hide the Full List
mod site	chr22:20111754-20111755:+		[12]
Sequence	AGCATGGGTATGAATCGTGCACACAGCCATGCTTCAAGGCC
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407755.1; ENST00000351989.8; ENST00000383024.6; ENST00000498171.5; ENST00000495826.5
External Link	RMBase: m6A_site_555431
mod ID: M6ASITE056496		Click to Show/Hide the Full List
mod site	chr22:20111848-20111849:+		[12]
Sequence	GGCGAGCCTTGATTGTCTGAACACATAAAGCAAACTGTCCA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T; Huh7
Seq Type List	MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000351989.8; ENST00000407755.1; ENST00000495826.5; ENST00000498171.5; ENST00000383024.6
External Link	RMBase: m6A_site_555432
mod ID: M6ASITE056497		Click to Show/Hide the Full List
mod site	chr22:20111861-20111862:+		[14]
Sequence	TGTCTGAACACATAAAGCAAACTGTCCAGAAGGGAATGGCT
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000498171.5; ENST00000383024.6; ENST00000495826.5; ENST00000407755.1; ENST00000351989.8
External Link	RMBase: m6A_site_555433

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000174		Click to Show/Hide the Full List
mod site	chr22:20110703-20110704:+		[19]
Sequence	TTTTAGCATCAGAACTAGCTTTCTGGGATTGGAGGCAAACC
Transcript ID List	ENST00000383024.6; ENST00000475941.1; ENST00000498171.5; ENST00000407755.1; ENST00000351989.8; ENST00000495826.5
External Link	RMBase: Pseudo_site_3396

Ref 1	N6-methyladenosine marks primary microRNAs for processing. Nature. 2015 Mar 26;519(7544):482-5. doi: 10.1038/nature14281. Epub 2015 Mar 18.
Ref 2	Exosomal and intracellular miR-320b promotes lymphatic metastasis in esophageal squamous cell carcinoma. Mol Ther Oncolytics. 2021 Sep 25;23:163-180. doi: 10.1016/j.omto.2021.09.003. eCollection 2021 Dec 17.
Ref 3	METTL3 promotes prostate cancer progression by regulating miR-182 maturation in m6A-dependent manner. Andrologia. 2022 Aug;54(7):1581-1591. doi: 10.1111/and.14422. Epub 2022 Apr 12.
Ref 4	METTL3 promotes IL-1Beta-induced degeneration of endplate chondrocytes by driving m6A-dependent maturation of miR-126-5p. J Cell Mol Med. 2020 Dec;24(23):14013-14025. doi: 10.1111/jcmm.16012. Epub 2020 Oct 23.
Ref 5	CD45 monoclonal antibody-mediated cytolysis of human NK and T lymphoma cells. Haematologica. 2006 Jul;91(7):886-94.
Ref 6	METTL14 suppresses the metastatic potential of hepatocellular carcinoma by modulating N(6) -methyladenosine-dependent primary MicroRNA processing. Hepatology. 2017 Feb;65(2):529-543. doi: 10.1002/hep.28885. Epub 2016 Dec 24.
Ref 7	Population pharmacokinetics of romidepsin in patients with cutaneous T-cell lymphoma and relapsed peripheral T-cell lymphoma. Clin Cancer Res. 2009 Feb 15;15(4):1496-503. doi: 10.1158/1078-0432.CCR-08-1215.
Ref 8	NAT10-mediated N4-acetylcytidine mRNA modification regulates self-renewal in human embryonic stem cells. Nucleic Acids Res. 2023 Sep 8;51(16):8514-8531. doi: 10.1093/nar/gkad628.
Ref 9	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 10	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 11	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 12	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 13	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 14	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 15	Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012 Apr 29;485(7397):201-6. doi: 10.1038/nature11112.
Ref 16	Dynamics of Human and Viral RNA Methylation during Zika Virus Infection. Cell Host Microbe. 2016 Nov 9;20(5):666-673. doi: 10.1016/j.chom.2016.10.002. Epub 2016 Oct 20.
Ref 17	The U6 snRNA m(6)A Methyltransferase METTL16 Regulates SAM Synthetase Intron Retention. Cell. 2017 May 18;169(5):824-835.e14. doi: 10.1016/j.cell.2017.05.003.
Ref 18	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 19	Chemical pulldown reveals dynamic pseudouridylation of the mammalian transcriptome. Nat Chem Biol. 2015 Aug;11(8):592-7. doi: 10.1038/nchembio.1836. Epub 2015 Jun 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map