m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00227)

Target Name	Diacylglycerol O-acyltransferase 2 (DGAT2)
Synonyms	Acyl-CoA retinol O-fatty-acyltransferase; ARAT; Retinol O-fatty-acyltransferase; Diglyceride acyltransferase 2; HMFN1045; UNQ738/PRO1433 Click to Show/Hide
Gene Name	DGAT2
Chromosomal Location	11q13.5
Family	diacylglycerol acyltransferase family
Function	Essential acyltransferase that catalyzes the terminal and only committed step in triacylglycerol synthesis by using diacylglycerol and fatty acyl CoA as substrates. Required for synthesis and storage of intracellular triglycerides. Probably plays a central role in cytosolic lipid accumulation. In liver, is primarily responsible for incorporating endogenously synthesized fatty acids into triglycerides (By similarity). Functions also as an acyl-CoA retinol acyltransferase (ARAT) (By similarity). Also able to use 1-monoalkylglycerol (1-MAkG) as an acyl acceptor for the synthesis of monoalkyl-monoacylglycerol (MAMAG). Click to Show/Hide
Gene ID	84649
Uniprot ID	DGAT2_HUMAN
HGNC ID	HGNC:16940
KEGG ID	hsa:84649

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

DGAT2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	B16-OVA cell line	Mus musculus
Treatment: shFTO B16-OVA cells Control: shNC B16-OVA cells		GSE154952
Regulation		logFC: -6.69E-01 p-value: 1.09E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Glucose Is Involved in the Dynamic Regulation of m6A in Patients With Type 2 Diabetes.high-glucose stimulation enhances FTO expression, which leads to decreased m6A, and the lower m6A induces methyltransferase upregulation; FTO then triggers the mRNA expression of FOXO1, FASN, G6PC, and Diacylglycerol O-acyltransferase 2 (DGAT2), and these four genes were correlated with glucose and lipid metabolism.
Responsed Disease	Diabetes		ICD-11: 5A10-5A14	Disease Info
Pathway Response	Metabolic pathways			hsa01100
Cell Process	Lipid metabolism
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	MOLM-13 cell line	Homo sapiens
Treatment: shMETTL3 MOLM13 cells Control: MOLM13 cells		GSE98623
Regulation		logFC: -1.53E+00 p-value: 7.36E-18
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Type 2 diabetes (T2D) is characterized by lack of insulin, insulin resistance and high blood sugar. METTL3 silence decreased the m6A methylated and total mRNA level of Fatty acid synthase (Fasn), subsequently inhibited fatty acid metabolism. The expression of Acc1, Acly, Diacylglycerol O-acyltransferase 2 (DGAT2), Ehhadh, Fasn, Foxo, Pgc1a and Sirt1, which are critical to the regulation of fatty acid synthesis and oxidation were dramatically decreased in livers of hepatocyte-specific METTL3 knockout mice.
Target Regulation	Up regulation
Responsed Disease	Type 2 diabetes mellitus		ICD-11: 5A11	Disease Info
Pathway Response	Insulin resistance			hsa04931
Cell Process	Lipid metabolism
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
In-vivo Model	Hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3^fl/fl) were generated by crossing mice with TBG-Cre Tg mice. METTL3 flox (METTL3^fl/fl) and hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3^fl/fl) were used for experiments.

Diabetes [ICD-11: 5A10-5A14]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Glucose Is Involved in the Dynamic Regulation of m6A in Patients With Type 2 Diabetes.high-glucose stimulation enhances FTO expression, which leads to decreased m6A, and the lower m6A induces methyltransferase upregulation; FTO then triggers the mRNA expression of FOXO1, FASN, G6PC, and Diacylglycerol O-acyltransferase 2 (DGAT2), and these four genes were correlated with glucose and lipid metabolism.
Responsed Disease	Diabetes [ICD-11: 5A10-5A14]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Pathway Response	Metabolic pathways			hsa01100
Cell Process	Lipid metabolism
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027

Type 2 diabetes mellitus [ICD-11: 5A11]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	Type 2 diabetes (T2D) is characterized by lack of insulin, insulin resistance and high blood sugar. METTL3 silence decreased the m6A methylated and total mRNA level of Fatty acid synthase (Fasn), subsequently inhibited fatty acid metabolism. The expression of Acc1, Acly, Diacylglycerol O-acyltransferase 2 (DGAT2), Ehhadh, Fasn, Foxo, Pgc1a and Sirt1, which are critical to the regulation of fatty acid synthesis and oxidation were dramatically decreased in livers of hepatocyte-specific METTL3 knockout mice.
Responsed Disease	Type 2 diabetes mellitus [ICD-11: 5A11]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Insulin resistance			hsa04931
Cell Process	Lipid metabolism
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
In-vivo Model	Hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3^fl/fl) were generated by crossing mice with TBG-Cre Tg mice. METTL3 flox (METTL3^fl/fl) and hepatocyte-specific METTL3 knockout mice (TBG-Cre, METTL3^fl/fl) were used for experiments.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00227)

Diacylglycerol O-acyltransferase 2 (DGAT2)

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE005120		Click to Show/Hide the Full List
mod site	chr11:75781605-75781606:+		[3]
Sequence	AGAGCTCACCACCTTGCAGCAGTCCCGGTACAGTTGCCCAG
Transcript ID List	ENST00000604733.5; ENST00000604935.5; ENST00000228027.12; ENST00000603276.5; ENST00000376262.7
External Link	RMBase: RNA-editing_site_24162

N6-methyladenosine (m6A)

In total 13 m6A sequence/site(s) in this target gene
mod ID: M6ASITE007867		Click to Show/Hide the Full List
mod site	chr11:75768997-75768998:+		[4]
Sequence	GGCGGGCTTCAGCCATGAAGACCCTCATAGCCGCCTACTCC
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000376262.7; ENST00000604935.5; ENST00000603276.5; ENST00000228027.12; ENST00000605608.1
External Link	RMBase: m6A_site_156188
mod ID: M6ASITE007868		Click to Show/Hide the Full List
mod site	chr11:75769077-75769078:+		[4]
Sequence	AGCCAGCGCTCTCACGGAGGACCTGCGCTGTCGCGCGAGGG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000603276.5; ENST00000604935.5; ENST00000228027.12; ENST00000605608.1; ENST00000604733.5; ENST00000376262.7
External Link	RMBase: m6A_site_156189
mod ID: M6ASITE007869		Click to Show/Hide the Full List
mod site	chr11:75773749-75773750:+		[4]
Sequence	CCTGCGTTTGAGGAAGTGAGACCAGGGGGATGTACACAAGA
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000604733.5; ENST00000603276.5; ENST00000604935.5; ENST00000376262.7; ENST00000605608.1; ENST00000228027.12
External Link	RMBase: m6A_site_156190
mod ID: M6ASITE007870		Click to Show/Hide the Full List
mod site	chr11:75796423-75796424:+		[5]
Sequence	GTGCCTTCTGCAACTTCAGCACAGAGGCCACAGAAGTGAGC
Motif Score	2.830589286
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000604733.5; ENST00000605099.1; ENST00000603276.5; ENST00000604935.5; ENST00000603363.5; ENST00000376262.7; ENST00000603865.1; ENST00000228027.12
External Link	RMBase: m6A_site_156191
mod ID: M6ASITE007871		Click to Show/Hide the Full List
mod site	chr11:75798270-75798271:+		[6]
Sequence	CTTTGGAGAGAATGAAGTGTACAAGCAGGTGATCTTCGAGG
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000603363.5; ENST00000376262.7; ENST00000603865.1; ENST00000604733.5; ENST00000228027.12
External Link	RMBase: m6A_site_156192
mod ID: M6ASITE007872		Click to Show/Hide the Full List
mod site	chr11:75798333-75798334:+		[6]
Sequence	CCAGAAGAAGTTCCAGAAATACATTGGTTTCGCCCCATGCA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000604733.5; ENST00000376262.7; ENST00000603865.1; ENST00000603363.5; ENST00000228027.12
External Link	RMBase: m6A_site_156193
mod ID: M6ASITE007873		Click to Show/Hide the Full List
mod site	chr11:75800463-75800464:+		[4]
Sequence	AGCTCTTCGACAAGCACAAGACCAAGTTCGGCCTCCCGGAG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000603865.1; ENST00000228027.12; ENST00000376262.7; ENST00000603363.5
External Link	RMBase: m6A_site_156194
mod ID: M6ASITE007874		Click to Show/Hide the Full List
mod site	chr11:75800484-75800485:+		[4]
Sequence	CCAAGTTCGGCCTCCCGGAGACTGAGGTCCTGGAGGTGAAC
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000376262.7; ENST00000603865.1; ENST00000603363.5; ENST00000228027.12
External Link	RMBase: m6A_site_156195
mod ID: M6ASITE007875		Click to Show/Hide the Full List
mod site	chr11:75800503-75800504:+		[4]
Sequence	GACTGAGGTCCTGGAGGTGAACTGAGCCAGCCTTCGGGGCC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000603865.1; ENST00000603363.5; ENST00000228027.12; ENST00000376262.7
External Link	RMBase: m6A_site_156196
mod ID: M6ASITE007876		Click to Show/Hide the Full List
mod site	chr11:75800538-75800539:+		[4]
Sequence	GGGGCCAATTCCCTGGAGGAACCAGCTGCAAATCACTTTTT
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000228027.12; ENST00000376262.7; ENST00000603865.1; ENST00000603363.5
External Link	RMBase: m6A_site_156197
mod ID: M6ASITE007877		Click to Show/Hide the Full List
mod site	chr11:75801081-75801082:+		[4]
Sequence	TCACTCATATCGGAGCCTGGACTGGCCTCCAGGATGAGGAT
Motif Score	4.065041667
Cell/Tissue List	HeLa; MM6; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000228027.12; ENST00000376262.7; ENST00000603363.5
External Link	RMBase: m6A_site_156200
mod ID: M6ASITE007878		Click to Show/Hide the Full List
mod site	chr11:75801134-75801135:+		[4]
Sequence	GACACCCTGCAGGGGAAAGGACTGCCCCCCATGCACCATTG
Motif Score	4.065041667
Cell/Tissue List	HeLa; MM6; HEK293A-TOA; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000376262.7; ENST00000228027.12; ENST00000603363.5
External Link	RMBase: m6A_site_156201
mod ID: M6ASITE007879		Click to Show/Hide the Full List
mod site	chr11:75801233-75801234:+		[4]
Sequence	ATGACATGGATGCAGCACAGACTCAGCCTTGGCCTGGAGCA
Motif Score	3.319380952
Cell/Tissue List	HeLa; GM12878; MM6; HEK293A-TOA; MSC; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000603363.5; ENST00000228027.12; ENST00000376262.7
External Link	RMBase: m6A_site_156203

Ref 1	Glucose Is Involved in the Dynamic Regulation of m6A in Patients With Type 2 Diabetes. J Clin Endocrinol Metab. 2019 Mar 1;104(3):665-673. doi: 10.1210/jc.2018-00619.
Ref 2	METTL3 inhibits hepatic insulin sensitivity via N6-methyladenosine modification of Fasn mRNA and promoting fatty acid metabolism. Biochem Biophys Res Commun. 2019 Oct 8;518(1):120-126. doi: 10.1016/j.bbrc.2019.08.018. Epub 2019 Aug 10.
Ref 3	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map