m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00223)

Target Name	C-X-C chemokine receptor type 4 (CXCR4)
Gene Name	CXCR4
Chromosomal Location	2q22.1
Family	G-protein coupled receptor 1 family
Function	Receptor for the C-X-C chemokine CXCL12/SDF-1 that transduces a signal by increasing intracellular calcium ion levels and enhancing MAPK1/MAPK3 activation . Involved in the AKT signaling cascade. Plays a role in regulation of cell migration, e.g. during wound healing. Acts as a receptor for extracellular ubiquitin; leading to enhanced intracellular calcium ions and reduced cellular cAMP levels. Binds bacterial lipopolysaccharide (LPS) et mediates LPS-induced inflammatory response, including TNF secretion by monocytes. Involved in hematopoiesis and in cardiac ventricular septum formation. Also plays an essential role in vascularization of the gastrointestinal tract, probably by regulating vascular branching and/or remodeling processes in endothelial cells. Involved in cerebellar development. In the CNS, could mediate hippocampal-neuron survival (By similarity). (Microbial infection) Acts as a coreceptor (CD4 being the primary receptor) for human immunodeficiency virus-1/HIV-1 X4 isolates and as a primary receptor for some HIV-2 isolates. Promotes Env-mediated fusion of the virus. Click to Show/Hide
Gene ID	7852
Uniprot ID	CXCR4_HUMAN
HGNC ID	HGNC:2561
KEGG ID	hsa:7852

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CXCR4 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF2*
Cell Line	Testis	Mus musculus
Treatment: YTHDF2 knockout mice testis Control: Mice testis		GSE147574
Regulation		logFC: 7.39E-01 p-value: 4.60E-02
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between CXCR4 and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 2.20E+00	GSE49339

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including PD-1 (PDCD1), C-X-C chemokine receptor type 4 (CXCR4), and SOX10, leading to increased RNA decay through the m6A reader YTHDF2.
Target Regulation	Down regulation
Responsed Disease	Melanoma		ICD-11: 2C30	Disease Info
Responsed Drug	PMID31239444-anti-PD1 antibody		Investigative	Drug Info
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Cell Process	mRNA decay
In-vitro Model	B16-F10	Mouse melanoma	Mus musculus	CVCL_0159
	CHL-1	Melanoma	Homo sapiens	CVCL_1122
	624-mel	Melanoma	Homo sapiens	CVCL_8054
	NHEM (Normal Human Epidermal Melanocytes)
	SK-MEL-30	Cutaneous melanoma	Homo sapiens	CVCL_0039
	WM115	Melanoma	Homo sapiens	CVCL_0040
	WM35	Melanoma	Homo sapiens	CVCL_0580
	WM3670	Melanoma	Homo sapiens	CVCL_6799
	WM793	Melanoma	Homo sapiens	CVCL_8787
In-vivo Model	When the tumors reached a volume of 80-100 mm³, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	NB4 cell line	Homo sapiens
Treatment: shFTO NB4 cells Control: shNS NB4 cells		GSE103494
Regulation		logFC: 9.72E-01 p-value: 3.86E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including PD-1 (PDCD1), C-X-C chemokine receptor type 4 (CXCR4), and SOX10, leading to increased RNA decay through the m6A reader YTHDF2.
Target Regulation	Up regulation
Responsed Disease	Melanoma		ICD-11: 2C30	Disease Info
Responsed Drug	PMID31239444-anti-PD1 antibody		Investigative	Drug Info
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Cell Process	mRNA decay
In-vitro Model	B16-F10	Mouse melanoma	Mus musculus	CVCL_0159
	CHL-1	Melanoma	Homo sapiens	CVCL_1122
	624-mel	Melanoma	Homo sapiens	CVCL_8054
	NHEM (Normal Human Epidermal Melanocytes)
	SK-MEL-30	Cutaneous melanoma	Homo sapiens	CVCL_0039
	WM115	Melanoma	Homo sapiens	CVCL_0040
	WM35	Melanoma	Homo sapiens	CVCL_0580
	WM3670	Melanoma	Homo sapiens	CVCL_6799
	WM793	Melanoma	Homo sapiens	CVCL_8787
In-vivo Model	When the tumors reached a volume of 80-100 mm³, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	BMDM	Mus musculus
Treatment: METTL14 knockout mice BMDM Control: Wild type mice BMDM		GSE153512
Regulation		logFC: 7.03E-01 p-value: 9.23E-10
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[2]
Response Summary	LNC942-METTL14-C-X-C chemokine receptor type 4 (CXCR4)/CYP1B1 signaling axis, which provides new targets and crosstalk m6A epigenetic modification mechanism for breast cancer prevention and treatment.
Target Regulation	Up regulation
Responsed Disease	Breast cancer	ICD-11: 2C60	Disease Info
Cell Process	Cell apoptosis

Melanoma [ICD-11: 2C30]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including PD-1 (PDCD1), C-X-C chemokine receptor type 4 (CXCR4), and SOX10, leading to increased RNA decay through the m6A reader YTHDF2.
Responsed Disease	Melanoma [ICD-11: 2C30]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	PMID31239444-anti-PD1 antibody		Investigative	Drug Info
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Cell Process	mRNA decay
In-vitro Model	B16-F10	Mouse melanoma	Mus musculus	CVCL_0159
	CHL-1	Melanoma	Homo sapiens	CVCL_1122
	624-mel	Melanoma	Homo sapiens	CVCL_8054
	NHEM (Normal Human Epidermal Melanocytes)
	SK-MEL-30	Cutaneous melanoma	Homo sapiens	CVCL_0039
	WM115	Melanoma	Homo sapiens	CVCL_0040
	WM35	Melanoma	Homo sapiens	CVCL_0580
	WM3670	Melanoma	Homo sapiens	CVCL_6799
	WM793	Melanoma	Homo sapiens	CVCL_8787
In-vivo Model	When the tumors reached a volume of 80-100 mm³, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including PD-1 (PDCD1), C-X-C chemokine receptor type 4 (CXCR4), and SOX10, leading to increased RNA decay through the m6A reader YTHDF2.
Responsed Disease	Melanoma [ICD-11: 2C30]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	PMID31239444-anti-PD1 antibody		Investigative	Drug Info
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Cell Process	mRNA decay
In-vitro Model	B16-F10	Mouse melanoma	Mus musculus	CVCL_0159
	CHL-1	Melanoma	Homo sapiens	CVCL_1122
	624-mel	Melanoma	Homo sapiens	CVCL_8054
	NHEM (Normal Human Epidermal Melanocytes)
	SK-MEL-30	Cutaneous melanoma	Homo sapiens	CVCL_0039
	WM115	Melanoma	Homo sapiens	CVCL_0040
	WM35	Melanoma	Homo sapiens	CVCL_0580
	WM3670	Melanoma	Homo sapiens	CVCL_6799
	WM793	Melanoma	Homo sapiens	CVCL_8787
In-vivo Model	When the tumors reached a volume of 80-100 mm³, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[2]
Response Summary	LNC942-METTL14-C-X-C chemokine receptor type 4 (CXCR4)/CYP1B1 signaling axis, which provides new targets and crosstalk m6A epigenetic modification mechanism for breast cancer prevention and treatment.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 14 (METTL14)	WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell apoptosis

PMID31239444-anti-PD1 antibody [Investigative]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including PD-1 (PDCD1), C-X-C chemokine receptor type 4 (CXCR4), and SOX10, leading to increased RNA decay through the m6A reader YTHDF2.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Melanoma		ICD-11: 2C30	Disease Info
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Cell Process	mRNA decay
In-vitro Model	B16-F10	Mouse melanoma	Mus musculus	CVCL_0159
	CHL-1	Melanoma	Homo sapiens	CVCL_1122
	624-mel	Melanoma	Homo sapiens	CVCL_8054
	NHEM (Normal Human Epidermal Melanocytes)
	SK-MEL-30	Cutaneous melanoma	Homo sapiens	CVCL_0039
	WM115	Melanoma	Homo sapiens	CVCL_0040
	WM35	Melanoma	Homo sapiens	CVCL_0580
	WM3670	Melanoma	Homo sapiens	CVCL_6799
	WM793	Melanoma	Homo sapiens	CVCL_8787
In-vivo Model	When the tumors reached a volume of 80-100 mm³, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.
Experiment 2 Reporting the m6A-centered Drug Response				[1]
Response Summary	These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including PD-1 (PDCD1), C-X-C chemokine receptor type 4 (CXCR4), and SOX10, leading to increased RNA decay through the m6A reader YTHDF2.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Melanoma		ICD-11: 2C30	Disease Info
Pathway Response	PD-L1 expression and PD-1 checkpoint pathway in cancer			hsa05235
Cell Process	mRNA decay
In-vitro Model	B16-F10	Mouse melanoma	Mus musculus	CVCL_0159
	CHL-1	Melanoma	Homo sapiens	CVCL_1122
	624-mel	Melanoma	Homo sapiens	CVCL_8054
	NHEM (Normal Human Epidermal Melanocytes)
	SK-MEL-30	Cutaneous melanoma	Homo sapiens	CVCL_0039
	WM115	Melanoma	Homo sapiens	CVCL_0040
	WM35	Melanoma	Homo sapiens	CVCL_0580
	WM3670	Melanoma	Homo sapiens	CVCL_6799
	WM793	Melanoma	Homo sapiens	CVCL_8787
In-vivo Model	When the tumors reached a volume of 80-100 mm³, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

DNA modification

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02204		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Crosstalk ID: M6ACROT02228		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info
Crosstalk ID: M6ACROT02252		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	DNA modification → m6A
Disease	Breast cancer	Disease Info

Non-coding RNA

m6A Regulator: Methyltransferase-like 14 (METTL14)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05173		Crosstalk Info
Epigenetic Regulator	hsa_circ_0125169 (Circ_METTL14(11)S)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	ncRNA → m6A
Disease	Inflammatory response	Disease Info
Crosstalk ID: M6ACROT05352		Crosstalk Info
Epigenetic Regulator	Long intergenic non-protein coding RNA 942 (LINC00942)
Regulated Target	Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship	ncRNA → m6A
Disease	Breast cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00223)

C-X-C chemokine receptor type 4 (CXCR4)

N6-methyladenosine (m6A)

In total 30 m6A sequence/site(s) in this target gene
mod ID: M6ASITE047624		Click to Show/Hide the Full List
mod site	chr2:136114352-136114353:-		[6]
Sequence	TTAATAAAAGTACATGTTAAACTTACTTAGTGTTATGTTCT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409817.1; ENST00000241393.3
External Link	RMBase: m6A_site_494530
mod ID: M6ASITE047625		Click to Show/Hide the Full List
mod site	chr2:136114473-136114474:-		[7]
Sequence	ATTTTGCTGTAGAAGATGGCACTTATAACCAAAGCCCAAAG
Motif Score	3.252583333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000241393.3; ENST00000409817.1
External Link	RMBase: m6A_site_494531
mod ID: M6ASITE047626		Click to Show/Hide the Full List
mod site	chr2:136114603-136114604:-		[8]
Sequence	ACTGTAGAAAAGGGAACTGAACATTCCAGAGCGTGTAGTGA
Motif Score	2.951386905
Cell/Tissue List	CD34; kidney; hESC-HEK293T; HeLa
Seq Type List	m6A-seq; m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000409817.1; ENST00000241393.3
External Link	RMBase: m6A_site_494532
mod ID: M6ASITE047627		Click to Show/Hide the Full List
mod site	chr2:136114608-136114609:-		[8]
Sequence	GTAGGACTGTAGAAAAGGGAACTGAACATTCCAGAGCGTGT
Motif Score	3.373380952
Cell/Tissue List	CD34; HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000241393.3; ENST00000409817.1
External Link	RMBase: m6A_site_494533
mod ID: M6ASITE047628		Click to Show/Hide the Full List
mod site	chr2:136114623-136114624:-		[8]
Sequence	GCTGTATGTCTCGTGGTAGGACTGTAGAAAAGGGAACTGAA
Motif Score	4.065041667
Cell/Tissue List	CD34; HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000241393.3; ENST00000409817.1
External Link	RMBase: m6A_site_494534
mod ID: M6ASITE047629		Click to Show/Hide the Full List
mod site	chr2:136114665-136114666:-		[8]
Sequence	TTGATGTGTGTCTAGGCAGGACCTGTGGCCAAGTTCTTAGT
Motif Score	3.622404762
Cell/Tissue List	CD34; HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000466288.1; ENST00000409817.1; ENST00000241393.3
External Link	RMBase: m6A_site_494535
mod ID: M6ASITE047630		Click to Show/Hide the Full List
mod site	chr2:136114794-136114795:-		[8]
Sequence	ACATTTTTCAGATATAAAAGACTGACCAATATTGTACAGTT
Motif Score	3.319380952
Cell/Tissue List	CD34; HEK293T; HeLa; GM12878; CD8T
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000466288.1; ENST00000409817.1; ENST00000241393.3
External Link	RMBase: m6A_site_494536
mod ID: M6ASITE047631		Click to Show/Hide the Full List
mod site	chr2:136114831-136114832:-		[9]
Sequence	TTTTTTTTATACGATAAATAACTTTTTTTTAAGTTACACAT
Motif Score	2.590089286
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000241393.3; ENST00000466288.1; ENST00000409817.1
External Link	RMBase: m6A_site_494537
mod ID: M6ASITE047632		Click to Show/Hide the Full List
mod site	chr2:136114853-136114854:-		[6]
Sequence	AGCTAACACAGATGTAAAAGACTTTTTTTTATACGATAAAT
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HEK293T; A549; HepG2; GM12878; LCLs; CD8T; Huh7; Jurkat; TIME
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000241393.3; ENST00000466288.1; ENST00000409817.1
External Link	RMBase: m6A_site_494538
mod ID: M6ASITE047633		Click to Show/Hide the Full List
mod site	chr2:136114868-136114869:-		[10]
Sequence	TCAAGTTTTCACTCCAGCTAACACAGATGTAAAAGACTTTT
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000241393.3; ENST00000409817.1; ENST00000466288.1
External Link	RMBase: m6A_site_494539
mod ID: M6ASITE047634		Click to Show/Hide the Full List
mod site	chr2:136114919-136114920:-		[6]
Sequence	TCCAAAGGAAAGCGAGGTGGACATTCATCTGTTTCCACTGA
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HEK293T; A549; hESC-HEK293T; HepG2; hNPCs; GM12878; LCLs; Huh7; Jurkat; TIME; AML
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000409817.1; ENST00000466288.1; ENST00000241393.3
External Link	RMBase: m6A_site_494540
mod ID: M6ASITE047635		Click to Show/Hide the Full List
mod site	chr2:136114996-136114997:-		[6]
Sequence	TCCTTGGAGCCAAATTTAAAACCTCTGCCCAGCACGCACTC
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HEK293T; HepG2; hNPCs; GM12878; LCLs; Huh7; Jurkat; HEK293A-TOA; TIME; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000466288.1; ENST00000409817.1; ENST00000241393.3
External Link	RMBase: m6A_site_494541
mod ID: M6ASITE047636		Click to Show/Hide the Full List
mod site	chr2:136115034-136115035:-		[6]
Sequence	TTTCTTCCACTGTTGTCTGAACCCCATCCTCTATGCTTTCC
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; HEK293T; HepG2; hNPCs; GM12878; LCLs; Huh7; HEK293A-TOA; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000466288.1; ENST00000409817.1; ENST00000241393.3
External Link	RMBase: m6A_site_494542
mod ID: M6ASITE047637		Click to Show/Hide the Full List
mod site	chr2:136115094-136115095:-		[6]
Sequence	GCAAGGGTGTGAGTTTGAGAACACTGTGCACAAGTGGATTT
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HEK293T; hESC-HEK293T; HepG2; GM12878; LCLs; CD8T; Huh7; TIME
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000241393.3; ENST00000409817.1; ENST00000466288.1
External Link	RMBase: m6A_site_494543
mod ID: M6ASITE047638		Click to Show/Hide the Full List
mod site	chr2:136115160-136115161:-		[10]
Sequence	CGCCTGTTGGCTGCCTTACTACATTGGGATCAGCATCGACT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000466288.1; ENST00000241393.3; ENST00000409817.1
External Link	RMBase: m6A_site_494544
mod ID: M6ASITE047639		Click to Show/Hide the Full List
mod site	chr2:136115209-136115210:-		[6]
Sequence	AGAAGCGCAAGGCCCTCAAGACCACAGTCATCCTCATCCTG
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HEK293T; HepG2; GM12878; LCLs; Huh7; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000241393.3; ENST00000409817.1; ENST00000466288.1
External Link	RMBase: m6A_site_494545
mod ID: M6ASITE047640		Click to Show/Hide the Full List
mod site	chr2:136115246-136115247:-		[10]
Sequence	ATTATCATCTCCAAGCTGTCACACTCCAAGGGCCACCAGAA
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000241393.3; ENST00000466288.1; ENST00000409817.1
External Link	RMBase: m6A_site_494546
mod ID: M6ASITE047641		Click to Show/Hide the Full List
mod site	chr2:136115349-136115350:-		[9]
Sequence	TGACCGCTTCTACCCCAATGACTTGTGGGTGGTTGTGTTCC
Motif Score	3.28175
Cell/Tissue List	CD8T; AML
Seq Type List	m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000409817.1; ENST00000466288.1; ENST00000241393.3
External Link	RMBase: m6A_site_494547
mod ID: M6ASITE047642		Click to Show/Hide the Full List
mod site	chr2:136115529-136115530:-		[6]
Sequence	CCTGGCCTTCATCAGTCTGGACCGCTACCTGGCCATCGTCC
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HEK293T; A549; HepG2; H1A; H1B; hESCs; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000466288.1; ENST00000241393.3; ENST00000409817.1
External Link	RMBase: m6A_site_494548
mod ID: M6ASITE047643		Click to Show/Hide the Full List
mod site	chr2:136115610-136115611:-		[6]
Sequence	GGCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCC
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hNPCs; hESCs; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000241393.3; ENST00000466288.1; ENST00000409817.1
External Link	RMBase: m6A_site_494549
mod ID: M6ASITE047644		Click to Show/Hide the Full List
mod site	chr2:136115625-136115626:-		[6]
Sequence	GGCAGTTGATGCCGTGGCAAACTGGTACTTTGGGAACTTCC
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; H1A; H1B; hNPCs; hESCs; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000241393.3; ENST00000409817.1; ENST00000466288.1
External Link	RMBase: m6A_site_494550
mod ID: M6ASITE047645		Click to Show/Hide the Full List
mod site	chr2:136115706-136115707:-		[6]
Sequence	GAAACTGAGAAGCATGACGGACAAGTACAGGCTGCACCTGT
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HEK293T; A549; hESC-HEK293T; HepG2; H1B; H1A; hNPCs; hESCs; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000409817.1; ENST00000466288.1; ENST00000241393.3
External Link	RMBase: m6A_site_494551
mod ID: M6ASITE047646		Click to Show/Hide the Full List
mod site	chr2:136115723-136115724:-		[6]
Sequence	GTCATGGGTTACCAGAAGAAACTGAGAAGCATGACGGACAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HEK293T; A549; HepG2; H1A; H1B; hNPCs; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; TIME; TREX; endometrial; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000409817.1; ENST00000241393.3; ENST00000466288.1
External Link	RMBase: m6A_site_494552
mod ID: M6ASITE047647		Click to Show/Hide the Full List
mod site	chr2:136115849-136115850:-		[6]
Sequence	GACTATGACTCCATGAAGGAACCCTGTTTCCGTGAAGAAAA
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; HEK293T; A549; HepG2; hNPCs; GM12878; LCLs; MT4; MM6; Huh7; Jurkat; CD4T; HEK293A-TOA; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000241393.3; ENST00000409817.1; ENST00000466288.1
External Link	RMBase: m6A_site_494553
mod ID: M6ASITE047648		Click to Show/Hide the Full List
mod site	chr2:136115868-136115869:-		[6]
Sequence	CGAGGAAATGGGCTCAGGGGACTATGACTCCATGAAGGAAC
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HEK293T; A549; HepG2; hNPCs; GM12878; LCLs; CD8T; MT4; MM6; Jurkat; CD4T; HEK293A-TOA; TIME; TREX; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000409817.1; ENST00000466288.1; ENST00000241393.3
External Link	RMBase: m6A_site_494554
mod ID: M6ASITE047649		Click to Show/Hide the Full List
mod site	chr2:136115892-136115893:-		[10]
Sequence	GATATACACTTCAGATAACTACACCGAGGAAATGGGCTCAG
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000466288.1; ENST00000241393.3; ENST00000409817.1
External Link	RMBase: m6A_site_494555
mod ID: M6ASITE047650		Click to Show/Hide the Full List
mod site	chr2:136117687-136117688:-		[6]
Sequence	CGCGCTGCCTCGGGACTCAGACCACCGGTCTCTTCCTTGGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; GM12878; MT4; MM6; Jurkat; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000466288.1; ENST00000241393.3
External Link	RMBase: m6A_site_494556
mod ID: M6ASITE047651		Click to Show/Hide the Full List
mod site	chr2:136117693-136117694:-		[6]
Sequence	GGCGTGCGCGCTGCCTCGGGACTCAGACCACCGGTCTCTTC
Motif Score	4.065041667
Cell/Tissue List	HeLa; GM12878; MT4; MM6; Jurkat; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000466288.1; ENST00000241393.3
External Link	RMBase: m6A_site_494557
mod ID: M6ASITE047652		Click to Show/Hide the Full List
mod site	chr2:136118072-136118073:-		[6]
Sequence	GTAGCCACCGCATCTGGAGAACCAGCGGTTACCATGGAGGG
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; HepG2; GM12878; MT4; MM6; Jurkat; CD4T; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000241393.3
External Link	RMBase: m6A_site_494558
mod ID: M6ASITE047653		Click to Show/Hide the Full List
mod site	chr2:136118153-136118154:-		[6]
Sequence	AAGTCCGGCCGCGGCCAGAAACTTCAGTTTGTTGGCTGCGG
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HepG2; GM12878; MT4; MM6; Jurkat; CD4T; peripheral-blood; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000241393.3
External Link	RMBase: m6A_site_494559

Ref 1	m(6)A mRNA demethylase FTO regulates melanoma tumorigenicity and response to anti-PD-1 blockade. Nat Commun. 2019 Jun 25;10(1):2782. doi: 10.1038/s41467-019-10669-0.
Ref 2	LNC942 promoting METTL14-mediated m(6)A methylation in breast cancer cell proliferation and progression. Oncogene. 2020 Jul;39(31):5358-5372. doi: 10.1038/s41388-020-1338-9. Epub 2020 Jun 23.
Ref 3	Mammalian drug efflux transporters of the ATP binding cassette (ABC) family in multidrug resistance: A review of the past decade. Cancer Lett. 2016 Jan 1;370(1):153-64. doi: 10.1016/j.canlet.2015.10.010. Epub 2015 Oct 20.
Ref 4	A common CYP1B1 polymorphism is associated with 2-OHE1/16-OHE1 urinary estrone ratio. Clin Chem Lab Med. 2005;43(7):702-6. doi: 10.1515/CCLM.2005.119.
Ref 5	Tamibarotene: a candidate retinoid drug for Alzheimer's disease. Biol Pharm Bull. 2012;35(8):1206-12. doi: 10.1248/bpb.b12-00314.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 8	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 9	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 10	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map