m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00219)
Target Name Copine-5 (CPNE5)
Synonyms
Copine V; KIAA1599
    Click to Show/Hide
Gene Name CPNE5
Chromosomal Location 6p21.2
Family copine family
Function
Probable calcium-dependent phospholipid-binding protein that may play a role in calcium-mediated intracellular processes (By similarity). Plays a role in dendrite formation by melanocytes.
    Click to Show/Hide
Gene ID 57699
Uniprot ID
CPNE5_HUMAN
HGNC ID
HGNC:2318
KEGG ID
hsa:57699
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
CPNE5 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
RNA-binding motif protein 15 (RBM15) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary RBM15-mediated m6A modification of TMBIM6 mRNA enhanced TMBIM6 stability through IGF2BP3-dependent. Laryngeal squamous cell cancer cells were transfected with shRBM15 lentivirus for 48h, and the qRT-PCR data indicated that the mRNA levels of Copine-5 (CPNE5), TMBIM6, and ATAD3A decreased after RBM15 knockdown.
Target Regulation Up regulation
Responsed Disease Laryngeal cancer ICD-11: 2C23
 Disease Info 
Cell Process RNA stability
Cell apoptosis
In-vitro Model AMC-HN-8 Laryngeal squamous cell carcinoma Homo sapiens CVCL_5966
NHBEC (Normal human bronchial epithelial cell)
Tu 177 Laryngeal squamous cell carcinoma Homo sapiens CVCL_4913
Tu 212 Head and neck squamous cell carcinoma Homo sapiens CVCL_4915
In-vivo Model For tumor growth studies, whether in vivo RBM15 knockdown/overexpression experiments or in vivo rescue experiments, each group included six mice. Each mouse was injected with 100 uL of lentivirus-transfected tumor cells.
Laryngeal cancer [ICD-11: 2C23]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary RBM15-mediated m6A modification of TMBIM6 mRNA enhanced TMBIM6 stability through IGF2BP3-dependent. Laryngeal squamous cell cancer cells were transfected with shRBM15 lentivirus for 48h, and the qRT-PCR data indicated that the mRNA levels of Copine-5 (CPNE5), TMBIM6, and ATAD3A decreased after RBM15 knockdown.
Responsed Disease Laryngeal cancer [ICD-11: 2C23]
Target Regulator RNA-binding motif protein 15 (RBM15) WRITER
 Regulator Info 
Target Regulation Up regulation
Cell Process RNA stability
Cell apoptosis
In-vitro Model AMC-HN-8 Laryngeal squamous cell carcinoma Homo sapiens CVCL_5966
NHBEC (Normal human bronchial epithelial cell)
Tu 177 Laryngeal squamous cell carcinoma Homo sapiens CVCL_4913
Tu 212 Head and neck squamous cell carcinoma Homo sapiens CVCL_4915
In-vivo Model For tumor growth studies, whether in vivo RBM15 knockdown/overexpression experiments or in vivo rescue experiments, each group included six mice. Each mouse was injected with 100 uL of lentivirus-transfected tumor cells.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00219)
Copine-5 (CPNE5)
Adenosine-to-Inosine editing (A-to-I)
In total 4 m6A sequence/site(s) in this target gene
mod ID: A2ISITE001442 Click to Show/Hide the Full List
mod site chr6:36749133-36749134:- [2]
Sequence AGACCAGGTTGGCCAATATAATGAGACCCCATCTCTGCAAA
Transcript ID List ENST00000493411.2; ENST00000393189.2; ENST00000459703.5; ENST00000633929.1; rmsk_1919820; ENST00000244751.7
External Link RMBase: RNA-editing_site_115782
mod ID: A2ISITE001443 Click to Show/Hide the Full List
mod site chr6:36749153-36749154:- [2]
Sequence TACTTTTGCCCAGGAGTTCAAGACCAGGTTGGCCAATATAA
Transcript ID List ENST00000493411.2; ENST00000244751.7; ENST00000459703.5; rmsk_1919820; ENST00000633929.1; ENST00000393189.2
External Link RMBase: RNA-editing_site_115783
mod ID: A2ISITE001444 Click to Show/Hide the Full List
mod site chr6:36749643-36749644:- [2]
Sequence TTTATTTTTGAGGTCTCACTATGTTGCTCAGGCTGGCCTTG
Transcript ID List ENST00000493411.2; ENST00000459703.5; ENST00000393189.2; ENST00000633929.1; ENST00000244751.7
External Link RMBase: RNA-editing_site_115784
mod ID: A2ISITE001445 Click to Show/Hide the Full List
mod site chr6:36774259-36774260:- [2]
Sequence CTCCTGAATATAGTTGGGACTACAGGCACCTACCACCACGC
Transcript ID List ENST00000633136.1; ENST00000244751.7
External Link RMBase: RNA-editing_site_115785
N6-methyladenosine (m6A)
In total 16 m6A sequence/site(s) in this target gene
mod ID: M6ASITE074910 Click to Show/Hide the Full List
mod site chr6:36741627-36741628:- [3]
Sequence CCCTTTCTGGTGCCTCTCGAACTCAGTACGATGCAAGTTCT
Motif Score 3.373380952
Cell/Tissue List LCLs; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000244751.7; ENST00000459703.5; ENST00000393189.2
External Link RMBase: m6A_site_715247
mod ID: M6ASITE074911 Click to Show/Hide the Full List
mod site chr6:36741653-36741654:- [4]
Sequence TGAAGTGGAGGCTGCTCAGCACAGAGCCCTTTCTGGTGCCT
Motif Score 2.830589286
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000459703.5; ENST00000393189.2; ENST00000244751.7
External Link RMBase: m6A_site_715248
mod ID: M6ASITE074912 Click to Show/Hide the Full List
mod site chr6:36741695-36741696:- [3]
Sequence ATGGGGTGCTGTAATCATGGACCGTAGGCCATGTGATGGGC
Motif Score 3.622404762
Cell/Tissue List LCLs; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000244751.7; ENST00000393189.2; ENST00000459703.5
External Link RMBase: m6A_site_715249
mod ID: M6ASITE074913 Click to Show/Hide the Full List
mod site chr6:36741720-36741721:- [3]
Sequence ATGCGCTGGGAGCCCCGGGGACCCCATGGGGTGCTGTAATC
Motif Score 3.622404762
Cell/Tissue List LCLs; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000244751.7; ENST00000459703.5; ENST00000393189.2
External Link RMBase: m6A_site_715250
mod ID: M6ASITE074914 Click to Show/Hide the Full List
mod site chr6:36741747-36741748:- [4]
Sequence ACATGTGCACCCTCCCAGGGACACTGGATGCGCTGGGAGCC
Motif Score 3.643047619
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000244751.7; ENST00000459703.5; ENST00000393189.2
External Link RMBase: m6A_site_715251
mod ID: M6ASITE074915 Click to Show/Hide the Full List
mod site chr6:36756207-36756208:- [5]
Sequence GTCTCTGCAGCCGGGTGTAGACATTCTGAGCCCCAAGCTAG
Motif Score 2.897386905
Cell/Tissue List GM12878; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000459703.5; ENST00000633929.1; ENST00000493411.2; ENST00000634222.1; ENST00000244751.7; ENST00000393189.2
External Link RMBase: m6A_site_715252
mod ID: M6ASITE074916 Click to Show/Hide the Full List
mod site chr6:36756290-36756291:- [5]
Sequence GTTTTTCCTGCAGGTGGTAAACCCGAAAAAGAAAATGAAGA
Motif Score 2.185083333
Cell/Tissue List GM12878; LCLs; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000634222.1; ENST00000459703.5; ENST00000393189.2; ENST00000493411.2; ENST00000633136.1; ENST00000633929.1; ENST00000244751.7
External Link RMBase: m6A_site_715253
mod ID: M6ASITE074917 Click to Show/Hide the Full List
mod site chr6:36757303-36757304:- [5]
Sequence GGGAAATGAGTTCACCAGAAACCAACAGGCAGCACAGGAGG
Motif Score 2.185083333
Cell/Tissue List GM12878; LCLs; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000459703.5; ENST00000633136.1; ENST00000634222.1; ENST00000493411.2; ENST00000633929.1; ENST00000393189.2; ENST00000244751.7
External Link RMBase: m6A_site_715254
mod ID: M6ASITE074918 Click to Show/Hide the Full List
mod site chr6:36757333-36757334:- [5]
Sequence CGGCCTCTGTGGGAACAAAGACAGGGAAAGGGGAAATGAGT
Motif Score 2.897386905
Cell/Tissue List GM12878; LCLs; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000633136.1; ENST00000459703.5; ENST00000493411.2; ENST00000634222.1; ENST00000393189.2; ENST00000244751.7; ENST00000633929.1
External Link RMBase: m6A_site_715255
mod ID: M6ASITE074919 Click to Show/Hide the Full List
mod site chr6:36757339-36757340:- [5]
Sequence AGCTGACGGCCTCTGTGGGAACAAAGACAGGGAAAGGGGAA
Motif Score 2.951386905
Cell/Tissue List GM12878; LCLs; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000633929.1; ENST00000244751.7; ENST00000634222.1; ENST00000459703.5; ENST00000493411.2; ENST00000633136.1; ENST00000393189.2
External Link RMBase: m6A_site_715256
mod ID: M6ASITE074920 Click to Show/Hide the Full List
mod site chr6:36757374-36757375:- [5]
Sequence TACTCACCCAGACAGAAGAGACCACGGTAAAGATCAGCTGA
Motif Score 2.876744048
Cell/Tissue List GM12878; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000459703.5; ENST00000493411.2; ENST00000393189.2; ENST00000633929.1; ENST00000634222.1; ENST00000244751.7; ENST00000633136.1
External Link RMBase: m6A_site_715257
mod ID: M6ASITE074921 Click to Show/Hide the Full List
mod site chr6:36757383-36757384:- [5]
Sequence AGATAGCAATACTCACCCAGACAGAAGAGACCACGGTAAAG
Motif Score 2.897386905
Cell/Tissue List GM12878; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000634222.1; ENST00000393189.2; ENST00000633136.1; ENST00000244751.7; ENST00000633929.1
External Link RMBase: m6A_site_715258
mod ID: M6ASITE074922 Click to Show/Hide the Full List
mod site chr6:36775006-36775007:- [5]
Sequence CCCTAAATCCAGTCTGGCAAACTTTCTCCATTCCCGTGAGA
Motif Score 2.627720238
Cell/Tissue List GM12878; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000633136.1; ENST00000244751.7
External Link RMBase: m6A_site_715275
mod ID: M6ASITE074923 Click to Show/Hide the Full List
mod site chr6:36775029-36775030:- [5]
Sequence CAAGACCGAGGTCATGAAGAACACCCTAAATCCAGTCTGGC
Motif Score 2.951386905
Cell/Tissue List GM12878; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000633136.1; ENST00000244751.7
External Link RMBase: m6A_site_715276
mod ID: M6ASITE074924 Click to Show/Hide the Full List
mod site chr6:36775045-36775046:- [5]
Sequence GGTTCACCATTTGCCACAAGACCGAGGTCATGAAGAACACC
Motif Score 2.876744048
Cell/Tissue List GM12878; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000244751.7; ENST00000633136.1
External Link RMBase: m6A_site_715277
mod ID: M6ASITE074925 Click to Show/Hide the Full List
mod site chr6:36778919-36778920:- [5]
Sequence GTTCTGTGCCAACAAGCTGGACAAGAAAGATTTCTTTGGGA
Motif Score 3.643047619
Cell/Tissue List GM12878; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000244751.7; ENST00000633280.1; ENST00000633136.1
External Link RMBase: m6A_site_715278