General Information of the m6A Target Gene (ID: M6ATAR00188)
Target Name Ubiquitin-like-conjugating enzyme ATG3 (ATG3)
Synonyms
Autophagy-related protein 3; APG3-like; hApg3; Protein PC3-96; APG3; APG3L
    Click to Show/Hide
Gene Name ATG3
Chromosomal Location 3q13.2
Family ATG3 family
Function
E2 conjugating enzyme required for the cytoplasm to vacuole transport (Cvt), autophagy, and mitochondrial homeostasis. Responsible for the E2-like covalent binding of phosphatidylethanolamine to the C-terminal Gly of ATG8-like proteins (GABARAP, GABARAPL1, GABARAPL2 or MAP1LC3A). The ATG12-ATG5 conjugate plays a role of an E3 and promotes the transfer of ATG8-like proteins from ATG3 to phosphatidylethanolamine (PE). This step is required for the membrane association of ATG8-like proteins. The formation of the ATG8-phosphatidylethanolamine conjugates is essential for autophagy and for the cytoplasm to vacuole transport (Cvt). Preferred substrate is MAP1LC3A. Also acts as an autocatalytic E2-like enzyme, catalyzing the conjugation of ATG12 to itself, ATG12 conjugation to ATG3 playing a role in mitochondrial homeostasis but not in autophagy. ATG7 (E1-like enzyme) facilitates this reaction by forming an E1-E2 complex with ATG3. Promotes primary ciliogenesis by removing OFD1 from centriolar satellites via the autophagic pathway.
    Click to Show/Hide
Gene ID 64422
Uniprot ID
ATG3_HUMAN
HGNC ID
HGNC:20962
KEGG ID
hsa:64422
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ATG3 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line Liver Mus musculus
Treatment: Mettl3-deficient liver
Control: Wild type liver cells
GSE197800
Regulation
logFC: -1.62E+00
p-value: 2.55E-18
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including Ubiquitin-like-conjugating enzyme ATG3 (ATG3), ATG5, ATG7, ATG12, and ATG16L1.
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
Responsed Drug Sorafenib Approved
Pathway Response FoxO signaling pathway hsa04068
Autophagy hsa04140
Cell Process Cell autophagy
YTH domain-containing family protein 1 (YTHDF1) [READER]
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including Ubiquitin-like-conjugating enzyme ATG3 (ATG3), ATG5, ATG7, ATG12, and ATG16L1.
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
Responsed Drug Sorafenib Approved
Pathway Response FoxO signaling pathway hsa04068
Autophagy hsa04140
Cell Process Cell autophagy
Liver cancer [ICD-11: 2C12]
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including Ubiquitin-like-conjugating enzyme ATG3 (ATG3), ATG5, ATG7, ATG12, and ATG16L1.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Responsed Drug Sorafenib Approved
Pathway Response FoxO signaling pathway hsa04068
Autophagy hsa04140
Cell Process Cell autophagy
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including Ubiquitin-like-conjugating enzyme ATG3 (ATG3), ATG5, ATG7, ATG12, and ATG16L1.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
Target Regulation Up regulation
Responsed Drug Sorafenib Approved
Pathway Response FoxO signaling pathway hsa04068
Autophagy hsa04140
Cell Process Cell autophagy
Sorafenib [Approved]
In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including Ubiquitin-like-conjugating enzyme ATG3 (ATG3), ATG5, ATG7, ATG12, and ATG16L1.
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
Pathway Response FoxO signaling pathway hsa04068
Autophagy hsa04140
Cell Process Cell autophagy
Experiment 2 Reporting the m6A-centered Drug Response [1]
Response Summary METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including Ubiquitin-like-conjugating enzyme ATG3 (ATG3), ATG5, ATG7, ATG12, and ATG16L1.
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
Pathway Response FoxO signaling pathway hsa04068
Autophagy hsa04140
Cell Process Cell autophagy
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00188)
Ubiquitin-like-conjugating enzyme ATG3 (ATG3)
N4-acetylcytidine (ac4C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000072 Click to Show/Hide the Full List
mod site chr3:112561595-112561596:-
Sequence GCAGCGAGGACATTTTCTGACTCCCTGGCCCCTGACACGGC
Cell/Tissue List DLD1
Seq Type List acRIP-seq
Transcript ID List ENST00000492886.5; ENST00000465980.1; ENST00000283290.9; ENST00000488910.1; ENST00000496423.1; ENST00000495756.5; ENST00000402314.6
External Link RMBase: ac4C_site_1387
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE012014 Click to Show/Hide the Full List
mod site chr3:112556149-112556150:- [2]
Sequence TAAAGATCCTATTCTGCCTTAGGTTTTATTACCTCAAATGC
Transcript ID List ENST00000492886.5; rmsk_1062181; ENST00000283290.9; ENST00000465980.1; ENST00000496423.1; ENST00000402314.6; ENST00000495756.5
External Link RMBase: RNA-editing_site_98645
5-methylcytidine (m5C)
In total 6 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003134 Click to Show/Hide the Full List
mod site chr3:112561531-112561532:- [3]
Sequence GCCGGCCGCTACTCCGGCCCCAGGATGCAGAATGTGATTAA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000492886.5; ENST00000488910.1; ENST00000283290.9; ENST00000496423.1; ENST00000465980.1; ENST00000495756.5; ENST00000402314.6
External Link RMBase: m5C_site_32691
mod ID: M5CSITE003135 Click to Show/Hide the Full List
mod site chr3:112561532-112561533:- [3]
Sequence GGCCGGCCGCTACTCCGGCCCCAGGATGCAGAATGTGATTA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000495756.5; ENST00000283290.9; ENST00000402314.6; ENST00000492886.5; ENST00000488910.1; ENST00000465980.1; ENST00000496423.1
External Link RMBase: m5C_site_32692
mod ID: M5CSITE003136 Click to Show/Hide the Full List
mod site chr3:112561533-112561534:- [3]
Sequence GGGCCGGCCGCTACTCCGGCCCCAGGATGCAGAATGTGATT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000488910.1; ENST00000402314.6; ENST00000496423.1; ENST00000465980.1; ENST00000283290.9; ENST00000492886.5; ENST00000495756.5
External Link RMBase: m5C_site_32693
mod ID: M5CSITE003137 Click to Show/Hide the Full List
mod site chr3:112561534-112561535:- [3]
Sequence GGGGCCGGCCGCTACTCCGGCCCCAGGATGCAGAATGTGAT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000492886.5; ENST00000496423.1; ENST00000402314.6; ENST00000465980.1; ENST00000283290.9; ENST00000488910.1; ENST00000495756.5
External Link RMBase: m5C_site_32694
mod ID: M5CSITE003138 Click to Show/Hide the Full List
mod site chr3:112561549-112561550:- [3]
Sequence TTTCCATCCCGTCGCGGGGCCGGCCGCTACTCCGGCCCCAG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000465980.1; ENST00000283290.9; ENST00000492886.5; ENST00000488910.1; ENST00000402314.6; ENST00000496423.1; ENST00000495756.5
External Link RMBase: m5C_site_32695
mod ID: M5CSITE003139 Click to Show/Hide the Full List
mod site chr3:112561550-112561551:- [3]
Sequence CTTTCCATCCCGTCGCGGGGCCGGCCGCTACTCCGGCCCCA
Seq Type List Bisulfite-seq
Transcript ID List ENST00000492886.5; ENST00000496423.1; ENST00000402314.6; ENST00000488910.1; ENST00000283290.9; ENST00000495756.5; ENST00000465980.1
External Link RMBase: m5C_site_32696
N6-methyladenosine (m6A)
In total 28 m6A sequence/site(s) in this target gene
mod ID: M6ASITE062126 Click to Show/Hide the Full List
mod site chr3:112532586-112532587:- [4]
Sequence TACAGTTTCTCTAATAAGGGACTTATATGTTTATGCATTAA
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000402314.6; ENST00000283290.9; ENST00000494571.1
External Link RMBase: m6A_site_602907
mod ID: M6ASITE062127 Click to Show/Hide the Full List
mod site chr3:112532706-112532707:- [5]
Sequence ATGACTACACAAGACACTTCACAATGTAATGAAGAGAGCAT
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000283290.9; ENST00000402314.6; ENST00000494571.1
External Link RMBase: m6A_site_602908
mod ID: M6ASITE062128 Click to Show/Hide the Full List
mod site chr3:112532713-112532714:- [4]
Sequence ATAGAATATGACTACACAAGACACTTCACAATGTAATGAAG
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000402314.6; ENST00000494571.1; ENST00000283290.9
External Link RMBase: m6A_site_602909
mod ID: M6ASITE062129 Click to Show/Hide the Full List
mod site chr3:112532720-112532721:- [6]
Sequence TCCAACAATAGAATATGACTACACAAGACACTTCACAATGT
Motif Score 2.078666667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000402314.6; ENST00000283290.9; ENST00000494571.1
External Link RMBase: m6A_site_602910
mod ID: M6ASITE062130 Click to Show/Hide the Full List
mod site chr3:112532752-112532753:- [6]
Sequence CTTATTTTCTTGAAATTTGTACAAGCTGTCATTCCAACAAT
Motif Score 2.856142857
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000402314.6; ENST00000494571.1; ENST00000283290.9
External Link RMBase: m6A_site_602911
mod ID: M6ASITE062131 Click to Show/Hide the Full List
mod site chr3:112534305-112534306:- [6]
Sequence TGATGAAGAAAATCATTGAGACTGTTGCAGAAGGAGGGGGA
Motif Score 3.319380952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000283290.9; ENST00000494571.1; ENST00000402314.6
External Link RMBase: m6A_site_602912
mod ID: M6ASITE062132 Click to Show/Hide the Full List
mod site chr3:112536538-112536539:- [4]
Sequence GTCAGGATCATGTGAAGAAAACAGTGACCATTGAAAATCAC
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000495756.5; ENST00000283290.9; ENST00000402314.6; ENST00000494571.1
External Link RMBase: m6A_site_602913
mod ID: M6ASITE062133 Click to Show/Hide the Full List
mod site chr3:112536564-112536565:- [4]
Sequence AGTTGAGCACATGTATGAAGACATCAGTCAGGATCATGTGA
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000402314.6; ENST00000283290.9; ENST00000495756.5; ENST00000494571.1
External Link RMBase: m6A_site_602914
mod ID: M6ASITE062134 Click to Show/Hide the Full List
mod site chr3:112537766-112537767:- [4]
Sequence CTTATGATAAATATTACCAGACTCCACGATTATGGTTGTTT
Motif Score 3.319380952
Cell/Tissue List HeLa; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000496423.1; ENST00000467275.1; ENST00000283290.9; ENST00000402314.6; ENST00000495756.5
External Link RMBase: m6A_site_602915
mod ID: M6ASITE062135 Click to Show/Hide the Full List
mod site chr3:112537792-112537793:- [6]
Sequence AACCAGAACTTATGACCTTTACATCACTTATGATAAATATT
Motif Score 2.07285119
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000402314.6; ENST00000495756.5; ENST00000496423.1; ENST00000467275.1; ENST00000283290.9
External Link RMBase: m6A_site_602916
mod ID: M6ASITE062136 Click to Show/Hide the Full List
mod site chr3:112537798-112537799:- [6]
Sequence TTTGCAAACCAGAACTTATGACCTTTACATCACTTATGATA
Motif Score 2.839113095
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000283290.9; ENST00000467275.1; ENST00000496423.1; ENST00000402314.6; ENST00000495756.5
External Link RMBase: m6A_site_602917
mod ID: M6ASITE062137 Click to Show/Hide the Full List
mod site chr3:112537805-112537806:- [4]
Sequence ATGCTATTTTGCAAACCAGAACTTATGACCTTTACATCACT
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; Huh7
Seq Type List m6A-seq; DART-seq; MeRIP-seq
Transcript ID List ENST00000467275.1; ENST00000496423.1; ENST00000283290.9; ENST00000495756.5; ENST00000402314.6
External Link RMBase: m6A_site_602918
mod ID: M6ASITE062138 Click to Show/Hide the Full List
mod site chr3:112537811-112537812:- [4]
Sequence GTGAAGATGCTATTTTGCAAACCAGAACTTATGACCTTTAC
Motif Score 2.185083333
Cell/Tissue List HeLa; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000283290.9; ENST00000467275.1; ENST00000496423.1; ENST00000495756.5; ENST00000402314.6
External Link RMBase: m6A_site_602919
mod ID: M6ASITE062139 Click to Show/Hide the Full List
mod site chr3:112537844-112537845:- [4]
Sequence TAGAAGCTTGTAAAGCCAAAACTGATGCTGGCGGTGAAGAT
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; LCLs; Huh7
Seq Type List m6A-seq; DART-seq; MeRIP-seq
Transcript ID List ENST00000496423.1; ENST00000283290.9; ENST00000402314.6; ENST00000467275.1; ENST00000495756.5
External Link RMBase: m6A_site_602920
mod ID: M6ASITE062140 Click to Show/Hide the Full List
mod site chr3:112537877-112537878:- [5]
Sequence ATTTTCAGGCTACCCTAGATACAAGGAAAATAGTAGAAGCT
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000283290.9; ENST00000467275.1; ENST00000402314.6; ENST00000495756.5; ENST00000496423.1
External Link RMBase: m6A_site_602921
mod ID: M6ASITE062141 Click to Show/Hide the Full List
mod site chr3:112538153-112538154:- [4]
Sequence AAGAGAGTGGATTGTTGGAAACAGATGAGGTTTGTAAATTG
Motif Score 2.20572619
Cell/Tissue List HeLa; LCLs; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000467275.1; ENST00000496423.1; ENST00000283290.9; ENST00000495756.5; ENST00000402314.6; ENST00000492886.5
External Link RMBase: m6A_site_602922
mod ID: M6ASITE062142 Click to Show/Hide the Full List
mod site chr3:112538213-112538214:- [4]
Sequence GGGAATTTTCTTGAACTTGAACTTGATTAATCTTTTGTTGT
Motif Score 3.373380952
Cell/Tissue List HeLa; hNPCs; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000402314.6; ENST00000492886.5; ENST00000495756.5; ENST00000496423.1; ENST00000283290.9; ENST00000467275.1
External Link RMBase: m6A_site_602923
mod ID: M6ASITE062143 Click to Show/Hide the Full List
mod site chr3:112538219-112538220:- [4]
Sequence GGTTTAGGGAATTTTCTTGAACTTGAACTTGATTAATCTTT
Motif Score 3.373380952
Cell/Tissue List HeLa; hNPCs; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000283290.9; ENST00000402314.6; ENST00000496423.1; ENST00000467275.1; ENST00000495756.5; ENST00000492886.5
External Link RMBase: m6A_site_602924
mod ID: M6ASITE062144 Click to Show/Hide the Full List
mod site chr3:112538280-112538281:- [4]
Sequence CACTTAAAAACAAAGGCAAAACCCCAGTTTTTGAATGATAC
Motif Score 2.185083333
Cell/Tissue List HeLa; hNPCs; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000495756.5; ENST00000283290.9; ENST00000496423.1; ENST00000402314.6; ENST00000467275.1; ENST00000492886.5
External Link RMBase: m6A_site_602925
mod ID: M6ASITE062145 Click to Show/Hide the Full List
mod site chr3:112538291-112538292:- [4]
Sequence TTCAATATCTTCACTTAAAAACAAAGGCAAAACCCCAGTTT
Motif Score 2.20572619
Cell/Tissue List HeLa; hNPCs; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000495756.5; ENST00000492886.5; ENST00000496423.1; ENST00000467275.1; ENST00000283290.9; ENST00000402314.6
External Link RMBase: m6A_site_602926
mod ID: M6ASITE062146 Click to Show/Hide the Full List
mod site chr3:112541882-112541883:- [5]
Sequence AATATAATTAATTTCAAAGGACAATATAAGGCTTCAAGATT
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000495756.5; ENST00000492886.5; ENST00000496423.1; ENST00000283290.9; ENST00000402314.6
External Link RMBase: m6A_site_602927
mod ID: M6ASITE062147 Click to Show/Hide the Full List
mod site chr3:112548547-112548548:- [5]
Sequence GTGATGGCGGATGGGTAGATACATATCACAACACAGGTAAG
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000402314.6; ENST00000465980.1; ENST00000495756.5; ENST00000283290.9; ENST00000492886.5; ENST00000496423.1
External Link RMBase: m6A_site_602928
mod ID: M6ASITE062148 Click to Show/Hide the Full List
mod site chr3:112548617-112548618:- [4]
Sequence CCGTGCTATAAGCGGTGCAAACAGATGGAATATTCAGATGA
Motif Score 2.20572619
Cell/Tissue List HeLa; LCLs; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000465980.1; ENST00000495756.5; ENST00000283290.9; ENST00000492886.5; ENST00000496423.1; ENST00000402314.6
External Link RMBase: m6A_site_602929
mod ID: M6ASITE062149 Click to Show/Hide the Full List
mod site chr3:112550213-112550214:- [4]
Sequence GCATACCTACCAACAGGCAAACAATTTTTGGTAACCAAAAA
Motif Score 2.20572619
Cell/Tissue List HeLa; LCLs; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000496423.1; ENST00000495756.5; ENST00000402314.6; ENST00000492886.5; ENST00000283290.9; ENST00000465980.1
External Link RMBase: m6A_site_602930
mod ID: M6ASITE062150 Click to Show/Hide the Full List
mod site chr3:112553289-112553290:- [5]
Sequence ACCTAGTCCACCACTGTCCAACATGGCAATGGTAAGTAATA
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000465980.1; ENST00000283290.9; ENST00000492886.5; ENST00000496423.1; ENST00000495756.5; ENST00000402314.6
External Link RMBase: m6A_site_602931
mod ID: M6ASITE062151 Click to Show/Hide the Full List
mod site chr3:112561581-112561582:- [5]
Sequence TTCTGACTCCCTGGCCCCTGACACGGCTGCACTTTCCATCC
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000283290.9; ENST00000402314.6; ENST00000488910.1; ENST00000496423.1; ENST00000492886.5; ENST00000465980.1; ENST00000495756.5
External Link RMBase: m6A_site_602932
mod ID: M6ASITE062152 Click to Show/Hide the Full List
mod site chr3:112561606-112561607:- [4]
Sequence GCGAGTCGGTGGCAGCGAGGACATTTTCTGACTCCCTGGCC
Motif Score 3.643047619
Cell/Tissue List HeLa; A549; H1A; H1B; MM6; GSC-11; HEK293T; TREX; iSLK; MSC; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000488910.1; ENST00000495756.5; ENST00000283290.9; ENST00000465980.1; ENST00000402314.6; ENST00000496423.1; ENST00000492886.5
External Link RMBase: m6A_site_602933
mod ID: M6ASITE062153 Click to Show/Hide the Full List
mod site chr3:112561869-112561870:- [4]
Sequence GCGAGTGAAGCAAAGCGAGGACAGACAGCTCGCAGAGGGCG
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; A549; HEK293T; H1A; H1B; hESCs; fibroblasts; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000492886.5; ENST00000402314.6; ENST00000495756.5; ENST00000283290.9
External Link RMBase: m6A_site_602937