m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00180)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
TFAP2C
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | Embryonic stem cells | Mus musculus |
|
Treatment: METTL3-/- mESCs
Control: Wild type ESCs
|
GSE147849 | |
| Regulation |
![]() ![]() |
logFC: 1.20E+00 p-value: 4.47E-08 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between TFAP2C and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 2.28E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL3 potentiates resistance to cisplatin through m6A modification of Transcription factor AP-2 gamma (TFAP2C) in seminoma. Enhanced stability of TFAP2C mRNA promoted seminoma cell survival under cisplatin treatment burden probably through up-regulation of DNA repair-related genes. IGF2BP1 binds to TFAP2C and enhances TFAP2C mRNA stability. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Testicular cancer | ICD-11: 2C80 | ||
| Responsed Drug | Cisplatin | Approved | ||
| Pathway Response | Nucleotide excision repair | hsa03420 | ||
| Cell Process | DNA repair | |||
| In-vitro Model | TCam-2 | Testicular seminoma | Homo sapiens | CVCL_T012 |
| In-vivo Model | Male mice were subcutaneously injected with tumour cells near the limbs to establish xenografts (1 × 106/mouse, 0.2 mL for each injection site; METTL3-overexpressing TCam-2/CDDP cells were inoculated once at the initial time and IGF2BP1-inhibited TCam-2/CDDP cells were inoculated every 3 days). | |||
Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]
| Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP1 | ||
| Cell Line | A549 cell line | Homo sapiens |
|
Treatment: IGF2BP1 knockout A549 cells
Control: Wild type A549 cells
|
GSE146546 | |
| Regulation |
![]() ![]() |
logFC: 6.39E-01 p-value: 1.76E-04 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL3 potentiates resistance to cisplatin through m6A modification of Transcription factor AP-2 gamma (TFAP2C) in seminoma. Enhanced stability of TFAP2C mRNA promoted seminoma cell survival under cisplatin treatment burden probably through up-regulation of DNA repair-related genes. IGF2BP1 binds to TFAP2C and enhances TFAP2C mRNA stability. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Testicular cancer | ICD-11: 2C80 | ||
| Responsed Drug | Cisplatin | Approved | ||
| Pathway Response | Nucleotide excision repair | hsa03420 | ||
| Cell Process | DNA repair | |||
| In-vitro Model | TCam-2 | Testicular seminoma | Homo sapiens | CVCL_T012 |
| In-vivo Model | Male mice were subcutaneously injected with tumour cells near the limbs to establish xenografts (1 × 106/mouse, 0.2 mL for each injection site; METTL3-overexpressing TCam-2/CDDP cells were inoculated once at the initial time and IGF2BP1-inhibited TCam-2/CDDP cells were inoculated every 3 days). | |||
Testicular cancer [ICD-11: 2C80]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL3 potentiates resistance to cisplatin through m6A modification of Transcription factor AP-2 gamma (TFAP2C) in seminoma. Enhanced stability of TFAP2C mRNA promoted seminoma cell survival under cisplatin treatment burden probably through up-regulation of DNA repair-related genes. IGF2BP1 binds to TFAP2C and enhances TFAP2C mRNA stability. | |||
| Responsed Disease | Testicular cancer [ICD-11: 2C80] | |||
| Target Regulator | Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) | READER | ||
| Target Regulation | Up regulation | |||
| Responsed Drug | Cisplatin | Approved | ||
| Pathway Response | Nucleotide excision repair | hsa03420 | ||
| Cell Process | DNA repair | |||
| In-vitro Model | TCam-2 | Testicular seminoma | Homo sapiens | CVCL_T012 |
| In-vivo Model | Male mice were subcutaneously injected with tumour cells near the limbs to establish xenografts (1 × 106/mouse, 0.2 mL for each injection site; METTL3-overexpressing TCam-2/CDDP cells were inoculated once at the initial time and IGF2BP1-inhibited TCam-2/CDDP cells were inoculated every 3 days). | |||
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL3 potentiates resistance to cisplatin through m6A modification of Transcription factor AP-2 gamma (TFAP2C) in seminoma. Enhanced stability of TFAP2C mRNA promoted seminoma cell survival under cisplatin treatment burden probably through up-regulation of DNA repair-related genes. IGF2BP1 binds to TFAP2C and enhances TFAP2C mRNA stability. | |||
| Responsed Disease | Testicular cancer [ICD-11: 2C80] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Responsed Drug | Cisplatin | Approved | ||
| Pathway Response | Nucleotide excision repair | hsa03420 | ||
| Cell Process | DNA repair | |||
| In-vitro Model | TCam-2 | Testicular seminoma | Homo sapiens | CVCL_T012 |
| In-vivo Model | Male mice were subcutaneously injected with tumour cells near the limbs to establish xenografts (1 × 106/mouse, 0.2 mL for each injection site; METTL3-overexpressing TCam-2/CDDP cells were inoculated once at the initial time and IGF2BP1-inhibited TCam-2/CDDP cells were inoculated every 3 days). | |||
Cisplatin
[Approved]
| In total 2 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | METTL3 potentiates resistance to cisplatin through m6A modification of Transcription factor AP-2 gamma (TFAP2C) in seminoma. Enhanced stability of TFAP2C mRNA promoted seminoma cell survival under cisplatin treatment burden probably through up-regulation of DNA repair-related genes. IGF2BP1 binds to TFAP2C and enhances TFAP2C mRNA stability. | |||
| Target Regulator | Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) | READER | ||
| Target Regulation | Up regulation | |||
| Responsed Disease | Testicular cancer | ICD-11: 2C80 | ||
| Pathway Response | Nucleotide excision repair | hsa03420 | ||
| Cell Process | DNA repair | |||
| In-vitro Model | TCam-2 | Testicular seminoma | Homo sapiens | CVCL_T012 |
| In-vivo Model | Male mice were subcutaneously injected with tumour cells near the limbs to establish xenografts (1 × 106/mouse, 0.2 mL for each injection site; METTL3-overexpressing TCam-2/CDDP cells were inoculated once at the initial time and IGF2BP1-inhibited TCam-2/CDDP cells were inoculated every 3 days). | |||
| Experiment 2 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | METTL3 potentiates resistance to cisplatin through m6A modification of Transcription factor AP-2 gamma (TFAP2C) in seminoma. Enhanced stability of TFAP2C mRNA promoted seminoma cell survival under cisplatin treatment burden probably through up-regulation of DNA repair-related genes. IGF2BP1 binds to TFAP2C and enhances TFAP2C mRNA stability. | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Responsed Disease | Testicular cancer | ICD-11: 2C80 | ||
| Pathway Response | Nucleotide excision repair | hsa03420 | ||
| Cell Process | DNA repair | |||
| In-vitro Model | TCam-2 | Testicular seminoma | Homo sapiens | CVCL_T012 |
| In-vivo Model | Male mice were subcutaneously injected with tumour cells near the limbs to establish xenografts (1 × 106/mouse, 0.2 mL for each injection site; METTL3-overexpressing TCam-2/CDDP cells were inoculated once at the initial time and IGF2BP1-inhibited TCam-2/CDDP cells were inoculated every 3 days). | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00180)
| In total 6 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE002729 | Click to Show/Hide the Full List | ||
| mod site | chr20:56631557-56631558:+ | [2] | |
| Sequence | CTCTCCGGGCTGGAGGCGGGCGCGGTGAGCGCCCGCAGGGA | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m5C_site_29307 | ||
| mod ID: M5CSITE002730 | Click to Show/Hide the Full List | ||
| mod site | chr20:56631559-56631560:+ | [2] | |
| Sequence | CTCCGGGCTGGAGGCGGGCGCGGTGAGCGCCCGCAGGGATG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m5C_site_29308 | ||
| mod ID: M5CSITE002731 | Click to Show/Hide the Full List | ||
| mod site | chr20:56631566-56631567:+ | ||
| Sequence | CTGGAGGCGGGCGCGGTGAGCGCCCGCAGGGATGCCTACCG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m5C_site_29309 | ||
| mod ID: M5CSITE002732 | Click to Show/Hide the Full List | ||
| mod site | chr20:56631568-56631569:+ | [2] | |
| Sequence | GGAGGCGGGCGCGGTGAGCGCCCGCAGGGATGCCTACCGCC | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m5C_site_29310 | ||
| mod ID: M5CSITE002733 | Click to Show/Hide the Full List | ||
| mod site | chr20:56631569-56631570:+ | ||
| Sequence | GAGGCGGGCGCGGTGAGCGCCCGCAGGGATGCCTACCGCCG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m5C_site_29311 | ||
| mod ID: M5CSITE002734 | Click to Show/Hide the Full List | ||
| mod site | chr20:56631570-56631571:+ | [2] | |
| Sequence | AGGCGGGCGCGGTGAGCGCCCGCAGGGATGCCTACCGCCGC | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m5C_site_29312 | ||
N6-methyladenosine (m6A)
| In total 37 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE053764 | Click to Show/Hide the Full List | ||
| mod site | chr20:56629308-56629309:+ | [3] | |
| Sequence | GTCCCCCGGCTATCGCCAGGACACACTGTTCGGGCGCGGCT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; A549; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537841 | ||
| mod ID: M6ASITE053765 | Click to Show/Hide the Full List | ||
| mod site | chr20:56629412-56629413:+ | [3] | |
| Sequence | ATGCGTGTCCAGTGACCCGGACAGCAAGGCCCGCGCGCGGC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; A549; HEK293A-TOA; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537842 | ||
| mod ID: M6ASITE053766 | Click to Show/Hide the Full List | ||
| mod site | chr20:56629584-56629585:+ | [3] | |
| Sequence | TAATGTCAAGTACGAAGAGGACTGCGAGGTGAGCTGGGGCT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; A549 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537843 | ||
| mod ID: M6ASITE053767 | Click to Show/Hide the Full List | ||
| mod site | chr20:56630273-56630274:+ | [3] | |
| Sequence | GCGCGGAGCTCGGGCTACGGACTCGCGGGAGTTCACTGCGC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; A549 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3; ENST00000416606.1 | ||
| External Link | RMBase: m6A_site_537844 | ||
| mod ID: M6ASITE053768 | Click to Show/Hide the Full List | ||
| mod site | chr20:56631646-56631647:+ | [3] | |
| Sequence | TGCCGCGGGCCTGGCCGAGAACCTGGGGCTCCACGACATGC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537845 | ||
| mod ID: M6ASITE053769 | Click to Show/Hide the Full List | ||
| mod site | chr20:56631840-56631841:+ | [3] | |
| Sequence | ACCTGTTGCTGCACGATCAGACAGTCATTCGCAAAGGTAAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537846 | ||
| mod ID: M6ASITE053770 | Click to Show/Hide the Full List | ||
| mod site | chr20:56633373-56633374:+ | [4] | |
| Sequence | TCCCATTTCCATGACCAAGAACCCTCTGAACCTCCCCTGTC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537847 | ||
| mod ID: M6ASITE053771 | Click to Show/Hide the Full List | ||
| mod site | chr20:56633382-56633383:+ | [4] | |
| Sequence | CATGACCAAGAACCCTCTGAACCTCCCCTGTCAGAAGGAGC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537848 | ||
| mod ID: M6ASITE053772 | Click to Show/Hide the Full List | ||
| mod site | chr20:56634193-56634194:+ | [3] | |
| Sequence | GTCCTTGCGGGAGAAGTTGGACAAGATTGGGTTGAATCTTC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537849 | ||
| mod ID: M6ASITE053773 | Click to Show/Hide the Full List | ||
| mod site | chr20:56634252-56634253:+ | [5] | |
| Sequence | CCGCTCATGTGACTCTCCTGACATCCTTAGTAGAAGGTCAG | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537850 | ||
| mod ID: M6ASITE053774 | Click to Show/Hide the Full List | ||
| mod site | chr20:56636633-56636634:+ | [3] | |
| Sequence | AGCTGTTCATTTGGCTAGGGACTTTGCCTATGTCTGTGAAG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537851 | ||
| mod ID: M6ASITE053775 | Click to Show/Hide the Full List | ||
| mod site | chr20:56636670-56636671:+ | [3] | |
| Sequence | GAAGCCGAATTTCCTAGTAAACCAGTGGCAGAATATTTAAC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537852 | ||
| mod ID: M6ASITE053776 | Click to Show/Hide the Full List | ||
| mod site | chr20:56636735-56636736:+ | [3] | |
| Sequence | TGAGATGGCAGCTAGGAAGAACATGCTATTGGCGGCCCAGT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537853 | ||
| mod ID: M6ASITE053777 | Click to Show/Hide the Full List | ||
| mod site | chr20:56637751-56637752:+ | [3] | |
| Sequence | CTGTGTAAAGAATTCACAGAACTTCTCAGCCAAGACCGGAC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; hNPCs; A549; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537854 | ||
| mod ID: M6ASITE053778 | Click to Show/Hide the Full List | ||
| mod site | chr20:56637765-56637766:+ | [3] | |
| Sequence | CACAGAACTTCTCAGCCAAGACCGGACACCCCATGGGACCA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293T; hNPCs; A549; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537855 | ||
| mod ID: M6ASITE053779 | Click to Show/Hide the Full List | ||
| mod site | chr20:56637770-56637771:+ | [3] | |
| Sequence | AACTTCTCAGCCAAGACCGGACACCCCATGGGACCAGCAGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T; hNPCs; A549; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537856 | ||
| mod ID: M6ASITE053780 | Click to Show/Hide the Full List | ||
| mod site | chr20:56637782-56637783:+ | [3] | |
| Sequence | AAGACCGGACACCCCATGGGACCAGCAGGCTCGCCCCAGTC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293T; hNPCs; A549; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537857 | ||
| mod ID: M6ASITE053781 | Click to Show/Hide the Full List | ||
| mod site | chr20:56637813-56637814:+ | [3] | |
| Sequence | CGCCCCAGTCTTGGAGACGAACATACAGAACTGCTTGTCTC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; hNPCs; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537858 | ||
| mod ID: M6ASITE053782 | Click to Show/Hide the Full List | ||
| mod site | chr20:56637822-56637823:+ | [3] | |
| Sequence | CTTGGAGACGAACATACAGAACTGCTTGTCTCATTTCAGCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; hNPCs; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537859 | ||
| mod ID: M6ASITE053783 | Click to Show/Hide the Full List | ||
| mod site | chr20:56637900-56637901:+ | [3] | |
| Sequence | CGCGGTGTCTGCCCTGCAGAACTACATCAAAGAAGCCCTGA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; hNPCs; hESCs; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537860 | ||
| mod ID: M6ASITE053784 | Click to Show/Hide the Full List | ||
| mod site | chr20:56637930-56637931:+ | [3] | |
| Sequence | AGAAGCCCTGATTGTCATAGACAAATCCTACATGAACCCTG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537861 | ||
| mod ID: M6ASITE053785 | Click to Show/Hide the Full List | ||
| mod site | chr20:56637945-56637946:+ | [3] | |
| Sequence | CATAGACAAATCCTACATGAACCCTGGAGACCAGAGTCCAG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537862 | ||
| mod ID: M6ASITE053786 | Click to Show/Hide the Full List | ||
| mod site | chr20:56637954-56637955:+ | [3] | |
| Sequence | ATCCTACATGAACCCTGGAGACCAGAGTCCAGCTGATTCTA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1B; H1A; hNPCs; hESCs; MM6; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537863 | ||
| mod ID: M6ASITE053787 | Click to Show/Hide the Full List | ||
| mod site | chr20:56637980-56637981:+ | [3] | |
| Sequence | GTCCAGCTGATTCTAACAAAACCCTGGAGAAAATGGAGAAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; MM6; HEK293A-TOA; MSC; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537864 | ||
| mod ID: M6ASITE053788 | Click to Show/Hide the Full List | ||
| mod site | chr20:56638000-56638001:+ | [3] | |
| Sequence | ACCCTGGAGAAAATGGAGAAACACAGGAAATAAAATTGGAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; MM6; HEK293A-TOA; MSC; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537865 | ||
| mod ID: M6ASITE053789 | Click to Show/Hide the Full List | ||
| mod site | chr20:56638050-56638051:+ | [3] | |
| Sequence | GTTAGGAGAGTAGGGAAGGAACAGGACTGCAAAAATCCTTC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; hESC-HEK293T; HepG2; H1A; H1B; hNPCs; hESCs; MM6; HEK293A-TOA; MSC; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537866 | ||
| mod ID: M6ASITE053790 | Click to Show/Hide the Full List | ||
| mod site | chr20:56638055-56638056:+ | [3] | |
| Sequence | GAGAGTAGGGAAGGAACAGGACTGCAAAAATCCTTCTCCAC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; MM6; HEK293A-TOA; MSC; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537867 | ||
| mod ID: M6ASITE053791 | Click to Show/Hide the Full List | ||
| mod site | chr20:56638083-56638084:+ | [3] | |
| Sequence | AATCCTTCTCCACCGCACAGACTGGGAACCCCTCCTGGCCT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; MM6; HEK293A-TOA; MSC; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537868 | ||
| mod ID: M6ASITE053792 | Click to Show/Hide the Full List | ||
| mod site | chr20:56638090-56638091:+ | [3] | |
| Sequence | CTCCACCGCACAGACTGGGAACCCCTCCTGGCCTGGGGGAA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; MM6; HEK293A-TOA; MSC; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537869 | ||
| mod ID: M6ASITE053793 | Click to Show/Hide the Full List | ||
| mod site | chr20:56638173-56638174:+ | [3] | |
| Sequence | TCTGCATCACCCGCCCCTGGACTTCTTAGTTGTTTCTCTAG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; HEK293A-TOA; MSC; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537870 | ||
| mod ID: M6ASITE053794 | Click to Show/Hide the Full List | ||
| mod site | chr20:56638218-56638219:+ | [3] | |
| Sequence | GAGCTATCTCCTAACTTTGGACCTATTATCAGAAGGTGACA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; H1B; HEK293A-TOA; MSC; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537871 | ||
| mod ID: M6ASITE053795 | Click to Show/Hide the Full List | ||
| mod site | chr20:56638236-56638237:+ | [5] | |
| Sequence | GGACCTATTATCAGAAGGTGACAAGTACTGGCTCTTTATTC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537872 | ||
| mod ID: M6ASITE053796 | Click to Show/Hide the Full List | ||
| mod site | chr20:56638277-56638278:+ | [3] | |
| Sequence | ATTAAGCTTTTTTTTTTTGAACCCCATTCTTTCCTTCTCTG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HEK293A-TOA; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537873 | ||
| mod ID: M6ASITE053797 | Click to Show/Hide the Full List | ||
| mod site | chr20:56638332-56638333:+ | [5] | |
| Sequence | AGTTTTAGAATCTTTTAAATACATTCCCTGGGCCAACAGAC | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537874 | ||
| mod ID: M6ASITE053798 | Click to Show/Hide the Full List | ||
| mod site | chr20:56639095-56639096:+ | [3] | |
| Sequence | GAAGATTCTATTTAATTGAAACTCTCTGTTCAGAAAGCAAT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537875 | ||
| mod ID: M6ASITE053799 | Click to Show/Hide the Full List | ||
| mod site | chr20:56639143-56639144:+ | [3] | |
| Sequence | TCTCGTTCCTGTTGGGCTGAACCCTAAGGTGAGTGTGCAGT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537876 | ||
| mod ID: M6ASITE053800 | Click to Show/Hide the Full List | ||
| mod site | chr20:56639200-56639201:+ | [3] | |
| Sequence | AAATGGAGATTTGGAATTGAACTCTCTGCCTGTAAATGTTC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000201031.3 | ||
| External Link | RMBase: m6A_site_537877 | ||
References



