m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00171)

Target Name	Meltrin-beta (ADAM19)
Synonyms	ADAM 19; Disintegrin and metalloproteinase domain-containing protein 19; Metalloprotease and disintegrin dendritic antigen marker; MADDAM; MLTNB; FKSG34 Click to Show/Hide
Gene Name	ADAM19
Chromosomal Location	5q33.3
Function	Participates in the proteolytic processing of beta-type neuregulin isoforms which are involved in neurogenesis and synaptogenesis, suggesting a regulatory role in glial cell. Also cleaves alpha-2 macroglobulin. May be involved in osteoblast differentiation and/or osteoblast activity in bone (By similarity). Click to Show/Hide
Gene ID	8728
Uniprot ID	ADA19_HUMAN
HGNC ID	HGNC:197
KEGG ID	hsa:8728

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ADAM19 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	MDA-MB-231	Homo sapiens
Treatment: siMETTL14 MDA-MB-231 cells Control: MDA-MB-231 cells		GSE81164
Regulation		logFC: -1.69E+00 p-value: 2.38E-31
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Knockdown of METTL3 or METTL14 induced changes in mRNA m6A enrichment and altered mRNA expression of genes (e.g., Meltrin-beta (ADAM19)) with critical biological functions in GSCs. Treatment with MA2, a chemical inhibitor of FTO, dramatically suppressed GSC-induced tumorigenesis and prolonged lifespan in GSC-grafted animals.
Target Regulation	Down regulation
Responsed Disease	Glioblastoma		ICD-11: 2A00.00	Disease Info
Responsed Drug	Ethyl ester form of meclofenamic acid		Approved	Drug Info
Cell Process	Cells growth
	Cells self-renewal
	Tumorigenesis
	MicroRNAs in cancer (hsa05206)
In-vitro Model	GSC	Glioma	Epinephelus akaara	CVCL_M752
In-vivo Model	2 × 10⁵ dissociated cells in 2 uL PBS were injected into the following site (anteroposterior [AP] +0.6 mm, mediolateral [ML] +1.6 mm, and dorsoventricular [DV] 2.6 mm) with a rate of 1 uL/min.

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	HUVEC cell line	Homo sapiens
Treatment: shMETTL3 HUVEC cells Control: shScramble HUVEC cells		GSE157544
Regulation		logFC: -7.06E-01 p-value: 4.35E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Knockdown of METTL3 or METTL14 induced changes in mRNA m6A enrichment and altered mRNA expression of genes (e.g., Meltrin-beta (ADAM19)) with critical biological functions in GSCs. Treatment with MA2, a chemical inhibitor of FTO, dramatically suppressed GSC-induced tumorigenesis and prolonged lifespan in GSC-grafted animals.
Target Regulation	Down regulation
Responsed Disease	Glioblastoma		ICD-11: 2A00.00	Disease Info
Responsed Drug	Ethyl ester form of meclofenamic acid		Approved	Drug Info
Cell Process	Cells growth
	Cells self-renewal
	Tumorigenesis
	MicroRNAs in cancer (hsa05206)
In-vitro Model	GSC	Glioma	Epinephelus akaara	CVCL_M752
In-vivo Model	2 × 10⁵ dissociated cells in 2 uL PBS were injected into the following site (anteroposterior [AP] +0.6 mm, mediolateral [ML] +1.6 mm, and dorsoventricular [DV] 2.6 mm) with a rate of 1 uL/min.

Brain cancer [ICD-11: 2A00]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Knockdown of METTL3 or METTL14 induced changes in mRNA m6A enrichment and altered mRNA expression of genes (e.g., Meltrin-beta (ADAM19)) with critical biological functions in GSCs. Treatment with MA2, a chemical inhibitor of FTO, dramatically suppressed GSC-induced tumorigenesis and prolonged lifespan in GSC-grafted animals.
Responsed Disease	Glioblastoma [ICD-11: 2A00.00]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Ethyl ester form of meclofenamic acid		Approved	Drug Info
Cell Process	Cells growth
	Cells self-renewal
	Tumorigenesis
	MicroRNAs in cancer (hsa05206)
In-vitro Model	GSC	Glioma	Epinephelus akaara	CVCL_M752
In-vivo Model	2 × 10⁵ dissociated cells in 2 uL PBS were injected into the following site (anteroposterior [AP] +0.6 mm, mediolateral [ML] +1.6 mm, and dorsoventricular [DV] 2.6 mm) with a rate of 1 uL/min.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	Knockdown of METTL3 or METTL14 induced changes in mRNA m6A enrichment and altered mRNA expression of genes (e.g., Meltrin-beta (ADAM19)) with critical biological functions in GSCs. Treatment with MA2, a chemical inhibitor of FTO, dramatically suppressed GSC-induced tumorigenesis and prolonged lifespan in GSC-grafted animals.
Responsed Disease	Glioblastoma [ICD-11: 2A00.00]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Ethyl ester form of meclofenamic acid		Approved	Drug Info
Cell Process	Cells growth
	Cells self-renewal
	Tumorigenesis
	MicroRNAs in cancer (hsa05206)
In-vitro Model	GSC	Glioma	Epinephelus akaara	CVCL_M752
In-vivo Model	2 × 10⁵ dissociated cells in 2 uL PBS were injected into the following site (anteroposterior [AP] +0.6 mm, mediolateral [ML] +1.6 mm, and dorsoventricular [DV] 2.6 mm) with a rate of 1 uL/min.

Solid tumour/cancer [ICD-11: 2A00-2F9Z]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response		[]
Response Summary	In this review, we discuss the specific roles of m6A "writers", "erasers", and "readers" in normal physiology and how their altered expression promotes tumorigenesis. We also describe the potential of exploiting the aberrant expression of these enzymes for cancer diagnosis, prognosis, and the development of novel therapies. The abnormal expression of m6A regulatory enzymes affects m6A abundance and consequently dysregulates the expression of tumor suppressor genes and oncogenes, including MYC, SOCS2, Meltrin-beta (ADAM19), and PTEN.
Responsed Disease	Solid tumour/cancer [ICD-11: 2A00-2F9Z]

Ethyl ester form of meclofenamic acid [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	Knockdown of METTL3 or METTL14 induced changes in mRNA m6A enrichment and altered mRNA expression of genes (e.g., Meltrin-beta (ADAM19)) with critical biological functions in GSCs. Treatment with MA2, a chemical inhibitor of FTO, dramatically suppressed GSC-induced tumorigenesis and prolonged lifespan in GSC-grafted animals.
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Glioblastoma		ICD-11: 2A00.00	Disease Info
Cell Process	Cells growth
	Cells self-renewal
	Tumorigenesis
	MicroRNAs in cancer (hsa05206)
In-vitro Model	GSC	Glioma	Epinephelus akaara	CVCL_M752
In-vivo Model	2 × 10⁵ dissociated cells in 2 uL PBS were injected into the following site (anteroposterior [AP] +0.6 mm, mediolateral [ML] +1.6 mm, and dorsoventricular [DV] 2.6 mm) with a rate of 1 uL/min.
Experiment 2 Reporting the m6A-centered Drug Response				[1]
Response Summary	Knockdown of METTL3 or METTL14 induced changes in mRNA m6A enrichment and altered mRNA expression of genes (e.g., Meltrin-beta (ADAM19)) with critical biological functions in GSCs. Treatment with MA2, a chemical inhibitor of FTO, dramatically suppressed GSC-induced tumorigenesis and prolonged lifespan in GSC-grafted animals.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Glioblastoma		ICD-11: 2A00.00	Disease Info
Cell Process	Cells growth
	Cells self-renewal
	Tumorigenesis
	MicroRNAs in cancer (hsa05206)
In-vitro Model	GSC	Glioma	Epinephelus akaara	CVCL_M752
In-vivo Model	2 × 10⁵ dissociated cells in 2 uL PBS were injected into the following site (anteroposterior [AP] +0.6 mm, mediolateral [ML] +1.6 mm, and dorsoventricular [DV] 2.6 mm) with a rate of 1 uL/min.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03299		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Brain cancer	Disease Info
Drug	Ethyl ester form of meclofenamic acid	Drug Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00171)

Meltrin-beta (ADAM19)

Adenosine-to-Inosine editing (A-to-I)

In total 41 m6A sequence/site(s) in this target gene
mod ID: A2ISITE001259		Click to Show/Hide the Full List
mod site	chr5:157477749-157477750:-		[2]
Sequence	CCCTGCCTACTTCCTAATTTATTCTTATTTGACAGAGGGTA
Transcript ID List	ENST00000257527.8; ENST00000517951.5; rmsk_1799868; ENST00000517374.5
External Link	RMBase: RNA-editing_site_113303
mod ID: A2ISITE001260		Click to Show/Hide the Full List
mod site	chr5:157477776-157477777:-		[3]
Sequence	CCTTTCCAATCTTTATTGGAAGTCTCTCCCTGCCTACTTCC
Transcript ID List	ENST00000257527.8; ENST00000517374.5; rmsk_1799868; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113304
mod ID: A2ISITE001261		Click to Show/Hide the Full List
mod site	chr5:157477822-157477823:-		[3]
Sequence	TCCCTTCCCCCTGAAGCAATAGCCCCTCCCCACCTCCTGCA
Transcript ID List	ENST00000517951.5; rmsk_1799868; ENST00000257527.8; ENST00000517374.5
External Link	RMBase: RNA-editing_site_113305
mod ID: A2ISITE001262		Click to Show/Hide the Full List
mod site	chr5:157477824-157477825:-		[3]
Sequence	AGTCCCTTCCCCCTGAAGCAATAGCCCCTCCCCACCTCCTG
Transcript ID List	ENST00000517951.5; rmsk_1799868; ENST00000517374.5; ENST00000257527.8
External Link	RMBase: RNA-editing_site_113306
mod ID: A2ISITE001263		Click to Show/Hide the Full List
mod site	chr5:157477844-157477845:-		[3]
Sequence	GTGTTTTTTTGTATTGCCATAGTCCCTTCCCCCTGAAGCAA
Transcript ID List	ENST00000517951.5; ENST00000517374.5; rmsk_1799868; ENST00000257527.8
External Link	RMBase: RNA-editing_site_113307
mod ID: A2ISITE001264		Click to Show/Hide the Full List
mod site	chr5:157477909-157477910:-		[2]
Sequence	TTCTGCCCCAGCTCTGAGACACTTGCAGATCTTAAGGTCTG
Transcript ID List	ENST00000257527.8; ENST00000517374.5; ENST00000517951.5; rmsk_1799868
External Link	RMBase: RNA-editing_site_113308
mod ID: A2ISITE001265		Click to Show/Hide the Full List
mod site	chr5:157477913-157477914:-		[3]
Sequence	CTTTTTCTGCCCCAGCTCTGAGACACTTGCAGATCTTAAGG
Transcript ID List	ENST00000517951.5; rmsk_1799868; ENST00000257527.8; ENST00000517374.5
External Link	RMBase: RNA-editing_site_113309
mod ID: A2ISITE001266		Click to Show/Hide the Full List
mod site	chr5:157477920-157477921:-		[2]
Sequence	GTAAAGCCTTTTTCTGCCCCAGCTCTGAGACACTTGCAGAT
Transcript ID List	ENST00000257527.8; ENST00000517374.5; rmsk_1799868; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113310
mod ID: A2ISITE001267		Click to Show/Hide the Full List
mod site	chr5:157477936-157477937:-		[2]
Sequence	ACTTCTCCCTATAAAAGTAAAGCCTTTTTCTGCCCCAGCTC
Transcript ID List	ENST00000257527.8; rmsk_1799868; ENST00000517374.5; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113311
mod ID: A2ISITE001268		Click to Show/Hide the Full List
mod site	chr5:157477938-157477939:-		[2]
Sequence	TGACTTCTCCCTATAAAAGTAAAGCCTTTTTCTGCCCCAGC
Transcript ID List	ENST00000257527.8; rmsk_1799868; ENST00000517374.5; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113312
mod ID: A2ISITE001269		Click to Show/Hide the Full List
mod site	chr5:157477941-157477942:-		[3]
Sequence	TGCTGACTTCTCCCTATAAAAGTAAAGCCTTTTTCTGCCCC
Transcript ID List	rmsk_1799868; ENST00000517951.5; ENST00000517374.5; ENST00000257527.8
External Link	RMBase: RNA-editing_site_113313
mod ID: A2ISITE001270		Click to Show/Hide the Full List
mod site	chr5:157477942-157477943:-		[2]
Sequence	TTGCTGACTTCTCCCTATAAAAGTAAAGCCTTTTTCTGCCC
Transcript ID List	ENST00000517374.5; ENST00000257527.8; ENST00000517951.5; rmsk_1799868
External Link	RMBase: RNA-editing_site_113314
mod ID: A2ISITE001271		Click to Show/Hide the Full List
mod site	chr5:157477943-157477944:-		[2]
Sequence	CTTGCTGACTTCTCCCTATAAAAGTAAAGCCTTTTTCTGCC
Transcript ID List	ENST00000517374.5; ENST00000257527.8; ENST00000517951.5; rmsk_1799868
External Link	RMBase: RNA-editing_site_113315
mod ID: A2ISITE001272		Click to Show/Hide the Full List
mod site	chr5:157477946-157477947:-		[2]
Sequence	AGCCTTGCTGACTTCTCCCTATAAAAGTAAAGCCTTTTTCT
Transcript ID List	ENST00000257527.8; rmsk_1799868; ENST00000517374.5; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113316
mod ID: A2ISITE001273		Click to Show/Hide the Full List
mod site	chr5:157477956-157477957:-		[3]
Sequence	GATTCCTTTCAGCCTTGCTGACTTCTCCCTATAAAAGTAAA
Transcript ID List	rmsk_1799868; ENST00000517951.5; ENST00000257527.8; ENST00000517374.5
External Link	RMBase: RNA-editing_site_113317
mod ID: A2ISITE001274		Click to Show/Hide the Full List
mod site	chr5:157477966-157477967:-		[3]
Sequence	GCTAGCCATAGATTCCTTTCAGCCTTGCTGACTTCTCCCTA
Transcript ID List	ENST00000257527.8; rmsk_1799868; ENST00000517374.5; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113318
mod ID: A2ISITE001275		Click to Show/Hide the Full List
mod site	chr5:157478364-157478365:-		[2]
Sequence	ACTTTTCTTTTATTGGAAGAAGTAAACATGGCTAGAAAGAA
Transcript ID List	ENST00000257527.8; ENST00000517374.5; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113319
mod ID: A2ISITE001276		Click to Show/Hide the Full List
mod site	chr5:157478373-157478374:-		[3]
Sequence	CAGAAAAGGACTTTTCTTTTATTGGAAGAAGTAAACATGGC
Transcript ID List	ENST00000517374.5; ENST00000257527.8; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113320
mod ID: A2ISITE001277		Click to Show/Hide the Full List
mod site	chr5:157478387-157478388:-		[3]
Sequence	TCTCAAAGCCCAGGCAGAAAAGGACTTTTCTTTTATTGGAA
Transcript ID List	ENST00000517374.5; ENST00000517951.5; ENST00000257527.8
External Link	RMBase: RNA-editing_site_113321
mod ID: A2ISITE001278		Click to Show/Hide the Full List
mod site	chr5:157478388-157478389:-		[3]
Sequence	GTCTCAAAGCCCAGGCAGAAAAGGACTTTTCTTTTATTGGA
Transcript ID List	ENST00000257527.8; ENST00000517951.5; ENST00000517374.5
External Link	RMBase: RNA-editing_site_113322
mod ID: A2ISITE001279		Click to Show/Hide the Full List
mod site	chr5:157478389-157478390:-		[3]
Sequence	CGTCTCAAAGCCCAGGCAGAAAAGGACTTTTCTTTTATTGG
Transcript ID List	ENST00000257527.8; ENST00000517374.5; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113323
mod ID: A2ISITE001280		Click to Show/Hide the Full List
mod site	chr5:157478396-157478397:-		[3]
Sequence	CTGCAAGCGTCTCAAAGCCCAGGCAGAAAAGGACTTTTCTT
Transcript ID List	ENST00000517951.5; ENST00000517374.5; ENST00000257527.8
External Link	RMBase: RNA-editing_site_113324
mod ID: A2ISITE001281		Click to Show/Hide the Full List
mod site	chr5:157478402-157478403:-		[2]
Sequence	CAAGATCTGCAAGCGTCTCAAAGCCCAGGCAGAAAAGGACT
Transcript ID List	ENST00000257527.8; ENST00000517374.5; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113325
mod ID: A2ISITE001282		Click to Show/Hide the Full List
mod site	chr5:157478411-157478412:-		[2]
Sequence	GACCGATGGCAAGATCTGCAAGCGTCTCAAAGCCCAGGCAG
Transcript ID List	ENST00000517951.5; ENST00000517374.5; ENST00000257527.8
External Link	RMBase: RNA-editing_site_113326
mod ID: A2ISITE001283		Click to Show/Hide the Full List
mod site	chr5:157478420-157478421:-		[2]
Sequence	GCTCAGACCGACCGATGGCAAGATCTGCAAGCGTCTCAAAG
Transcript ID List	ENST00000257527.8; ENST00000517374.5; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113327
mod ID: A2ISITE001284		Click to Show/Hide the Full List
mod site	chr5:157478436-157478437:-		[2]
Sequence	TGGGAATAGTGAAAAGGCTCAGACCGACCGATGGCAAGATC
Transcript ID List	ENST00000517951.5; ENST00000517374.5; ENST00000257527.8
External Link	RMBase: RNA-editing_site_113328
mod ID: A2ISITE001285		Click to Show/Hide the Full List
mod site	chr5:157478484-157478485:-		[2]
Sequence	TGCAGAAGGGGAAAGGGAATATTGCAAAAGGGAGAGGAAGG
Transcript ID List	ENST00000257527.8; ENST00000517374.5; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113329
mod ID: A2ISITE001286		Click to Show/Hide the Full List
mod site	chr5:157478491-157478492:-		[2]
Sequence	GCACGATTGCAGAAGGGGAAAGGGAATATTGCAAAAGGGAG
Transcript ID List	ENST00000257527.8; ENST00000517374.5; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113330
mod ID: A2ISITE001287		Click to Show/Hide the Full List
mod site	chr5:157478546-157478547:-		[2]
Sequence	GAGGTGTCAAATACAAATAAATCTGGGCTTAGGGAAGGAGA
Transcript ID List	ENST00000257527.8; ENST00000517374.5; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113331
mod ID: A2ISITE001288		Click to Show/Hide the Full List
mod site	chr5:157478547-157478548:-		[3]
Sequence	TGAGGTGTCAAATACAAATAAATCTGGGCTTAGGGAAGGAG
Transcript ID List	ENST00000257527.8; ENST00000517374.5; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113332
mod ID: A2ISITE001289		Click to Show/Hide the Full List
mod site	chr5:157478548-157478549:-		[4]
Sequence	TTGAGGTGTCAAATACAAATAAATCTGGGCTTAGGGAAGGA
Transcript ID List	ENST00000517374.5; ENST00000257527.8; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113333
mod ID: A2ISITE001290		Click to Show/Hide the Full List
mod site	chr5:157478550-157478551:-		[2]
Sequence	TTTTGAGGTGTCAAATACAAATAAATCTGGGCTTAGGGAAG
Transcript ID List	ENST00000257527.8; ENST00000517951.5; ENST00000517374.5
External Link	RMBase: RNA-editing_site_113334
mod ID: A2ISITE001291		Click to Show/Hide the Full List
mod site	chr5:157478551-157478552:-		[3]
Sequence	GTTTTGAGGTGTCAAATACAAATAAATCTGGGCTTAGGGAA
Transcript ID List	ENST00000517951.5; ENST00000257527.8; ENST00000517374.5
External Link	RMBase: RNA-editing_site_113335
mod ID: A2ISITE001292		Click to Show/Hide the Full List
mod site	chr5:157478552-157478553:-		[4]
Sequence	TGTTTTGAGGTGTCAAATACAAATAAATCTGGGCTTAGGGA
Transcript ID List	ENST00000517374.5; ENST00000517951.5; ENST00000257527.8
External Link	RMBase: RNA-editing_site_113336
mod ID: A2ISITE001293		Click to Show/Hide the Full List
mod site	chr5:157478556-157478557:-		[4]
Sequence	ATGCTGTTTTGAGGTGTCAAATACAAATAAATCTGGGCTTA
Transcript ID List	ENST00000257527.8; ENST00000517374.5; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113337
mod ID: A2ISITE001294		Click to Show/Hide the Full List
mod site	chr5:157478557-157478558:-		[3]
Sequence	TATGCTGTTTTGAGGTGTCAAATACAAATAAATCTGGGCTT
Transcript ID List	ENST00000517951.5; ENST00000517374.5; ENST00000257527.8
External Link	RMBase: RNA-editing_site_113338
mod ID: A2ISITE001295		Click to Show/Hide the Full List
mod site	chr5:157478558-157478559:-		[4]
Sequence	GTATGCTGTTTTGAGGTGTCAAATACAAATAAATCTGGGCT
Transcript ID List	ENST00000517951.5; ENST00000257527.8; ENST00000517374.5
External Link	RMBase: RNA-editing_site_113339
mod ID: A2ISITE001296		Click to Show/Hide the Full List
mod site	chr5:157504655-157504656:-		[2]
Sequence	AGGGCCTGTTTATGATTCTTAGAGAATGGTGTTTCAATGTC
Transcript ID List	ENST00000517951.5; ENST00000257527.8; ENST00000517905.1
External Link	RMBase: RNA-editing_site_113340
mod ID: A2ISITE001297		Click to Show/Hide the Full List
mod site	chr5:157505006-157505007:-		[2]
Sequence	TCTGCCTTAGCCTCCCGAGTAGCTGGGAATACAGGCGCCTG
Transcript ID List	ENST00000517905.1; ENST00000257527.8; ENST00000517951.5
External Link	RMBase: RNA-editing_site_113341
mod ID: A2ISITE001298		Click to Show/Hide the Full List
mod site	chr5:157510539-157510540:-		[2]
Sequence	CAATAGACATGAGGGATCTCACCGATGTGATGAAAATATTC
Transcript ID List	ENST00000517951.5; rmsk_1799935; ENST00000517905.1; ENST00000257527.8
External Link	RMBase: RNA-editing_site_113342
mod ID: A2ISITE001299		Click to Show/Hide the Full List
mod site	chr5:157556397-157556398:-		[2]
Sequence	GGTGAAACCTGGTCTCTACTAAAAATACAAAAATTAGCTGG
Transcript ID List	ENST00000517951.5; ENST00000517905.1; rmsk_1800051; ENST00000257527.8
External Link	RMBase: RNA-editing_site_113343

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003685		Click to Show/Hide the Full List
mod site	chr5:157479497-157479498:-
Sequence	AAAGCACCTGGAGATGTTTGCTGGGAGATAGACTCCCACTC
Cell/Tissue List	lung; spleen; testis; T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000517374.5; ENST00000257527.8; ENST00000517951.5
External Link	RMBase: m5C_site_36257

N6-methyladenosine (m6A)

In total 21 m6A sequence/site(s) in this target gene
mod ID: M6ASITE072576		Click to Show/Hide the Full List
mod site	chr5:157477449-157477450:-		[5]
Sequence	TTTTATTTGGGAGATTGTTCACGGAAAACAGATCTTCTTCT
Motif Score	2.021232143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000257527.8; ENST00000517951.5; ENST00000517374.5
External Link	RMBase: m6A_site_695525
mod ID: M6ASITE072577		Click to Show/Hide the Full List
mod site	chr5:157480659-157480660:-		[6]
Sequence	ACTGGCAGCTTCTCCTCCAGACTCCTAGCCCCGAGGTGCTG
Motif Score	3.319380952
Cell/Tissue List	CD4T; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000257527.8; ENST00000517951.5; ENST00000517374.5
External Link	RMBase: m6A_site_695526
mod ID: M6ASITE072578		Click to Show/Hide the Full List
mod site	chr5:157480758-157480759:-		[7]
Sequence	TTCCTTGGAAGCCCAGAGGGACTATGATCTGATGGCCTCTA
Motif Score	4.065041667
Cell/Tissue List	H1A; H1B; fibroblasts; A549; GM12878; CD4T; GSC-11; HEK293A-TOA; iSLK; TIME; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000257527.8; ENST00000517951.5; ENST00000517374.5
External Link	RMBase: m6A_site_695527
mod ID: M6ASITE072579		Click to Show/Hide the Full List
mod site	chr5:157480826-157480827:-		[7]
Sequence	CCTCCCACCCTCCTCCAGGAACCTCCACATCTCCAAAAATC
Motif Score	2.930744048
Cell/Tissue List	H1B; H1A; fibroblasts; A549; GM12878; CD4T; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000517374.5; ENST00000257527.8; ENST00000517951.5
External Link	RMBase: m6A_site_695528
mod ID: M6ASITE072580		Click to Show/Hide the Full List
mod site	chr5:157480880-157480881:-		[7]
Sequence	AGAGGACCCATGGCCATGGAACCCTGAAGAAGCATGTCTGG
Motif Score	2.930744048
Cell/Tissue List	H1A; H1B; fibroblasts; A549; GM12878; CD4T; GSC-11; HEK293T; HEK293A-TOA; iSLK; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000257527.8; ENST00000517951.5; ENST00000517374.5
External Link	RMBase: m6A_site_695529
mod ID: M6ASITE072581		Click to Show/Hide the Full List
mod site	chr5:157480895-157480896:-		[7]
Sequence	CTCTCTGGACACTGCAGAGGACCCATGGCCATGGAACCCTG
Motif Score	3.622404762
Cell/Tissue List	H1A; H1B; fibroblasts; A549; GM12878; CD4T; GSC-11; HEK293T; HEK293A-TOA; iSLK; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000517951.5; ENST00000257527.8; ENST00000517374.5
External Link	RMBase: m6A_site_695530
mod ID: M6ASITE072582		Click to Show/Hide the Full List
mod site	chr5:157480907-157480908:-		[7]
Sequence	CCTTTCCTTGAGCTCTCTGGACACTGCAGAGGACCCATGGC
Motif Score	3.643047619
Cell/Tissue List	H1A; H1B; fibroblasts; A549; GM12878; CD4T; GSC-11; HEK293T; HEK293A-TOA; iSLK; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000517951.5; ENST00000257527.8; ENST00000517374.5
External Link	RMBase: m6A_site_695531
mod ID: M6ASITE072583		Click to Show/Hide the Full List
mod site	chr5:157480947-157480948:-		[7]
Sequence	TGATTAGCTCGAAAATCTAGACCTGTCCAAGGGGCTTCTCC
Motif Score	2.876744048
Cell/Tissue List	H1B; fibroblasts; A549; GM12878; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000257527.8; ENST00000517951.5; ENST00000517374.5
External Link	RMBase: m6A_site_695532
mod ID: M6ASITE072584		Click to Show/Hide the Full List
mod site	chr5:157491703-157491704:-		[8]
Sequence	GGTCTGTAACAACAACCAGAACTGCCACTGCCTGCCGGGCT
Motif Score	3.373380952
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000517905.1; ENST00000517951.5; ENST00000517374.5; ENST00000257527.8
External Link	RMBase: m6A_site_695533
mod ID: M6ASITE072585		Click to Show/Hide the Full List
mod site	chr5:157491869-157491870:-		[8]
Sequence	GGAACACCTCCTTCTTTGAAACTGAAGGCTGTGGGAAGAAG
Motif Score	2.627720238
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000517905.1; ENST00000517951.5; ENST00000517374.5; ENST00000257527.8
External Link	RMBase: m6A_site_695534
mod ID: M6ASITE072586		Click to Show/Hide the Full List
mod site	chr5:157491886-157491887:-		[8]
Sequence	CTTTGAGGGGCAGTGCAGGAACACCTCCTTCTTTGAAACTG
Motif Score	2.951386905
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000257527.8; ENST00000517951.5; ENST00000517374.5; ENST00000517905.1
External Link	RMBase: m6A_site_695535
mod ID: M6ASITE072587		Click to Show/Hide the Full List
mod site	chr5:157492992-157492993:-		[8]
Sequence	CAGGGCTGGTGATGACTGGAACCAAGTGTGGCTACAACCAT
Motif Score	2.930744048
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000517374.5; ENST00000517951.5; ENST00000517905.1; ENST00000257527.8
External Link	RMBase: m6A_site_695536
mod ID: M6ASITE072588		Click to Show/Hide the Full List
mod site	chr5:157493015-157493016:-		[8]
Sequence	GGAGGAGGGTGACATGCTGGACCCAGGGCTGGTGATGACTG
Motif Score	3.622404762
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000257527.8; ENST00000517951.5; ENST00000517374.5; ENST00000517905.1
External Link	RMBase: m6A_site_695537
mod ID: M6ASITE072589		Click to Show/Hide the Full List
mod site	chr5:157494706-157494707:-		[8]
Sequence	GGAAAGGACATGAATGGTGAACACAGGAAGTGCAACATGAG
Motif Score	2.951386905
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000257527.8; ENST00000517905.1; ENST00000517951.5; ENST00000517374.5
External Link	RMBase: m6A_site_695538
mod ID: M6ASITE072590		Click to Show/Hide the Full List
mod site	chr5:157494719-157494720:-		[8]
Sequence	CTTTGGAAACTGTGGAAAGGACATGAATGGTGAACACAGGA
Motif Score	3.643047619
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000257527.8; ENST00000517951.5; ENST00000517374.5; ENST00000517905.1
External Link	RMBase: m6A_site_695539
mod ID: M6ASITE072591		Click to Show/Hide the Full List
mod site	chr5:157494731-157494732:-		[8]
Sequence	GGCAGGAGACACCTTTGGAAACTGTGGAAAGGACATGAATG
Motif Score	2.627720238
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000517951.5; ENST00000517374.5; ENST00000517905.1; ENST00000257527.8
External Link	RMBase: m6A_site_695540
mod ID: M6ASITE072592		Click to Show/Hide the Full List
mod site	chr5:157570879-157570880:-		[9]
Sequence	GAAAAGGTAAGACTCAAAAGACCTCATTTACACTGGCAGGA
Motif Score	2.876744048
Cell/Tissue List	GSC-11; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000517951.5; ENST00000517905.1; ENST00000257527.8; ENST00000519752.1
External Link	RMBase: m6A_site_695541
mod ID: M6ASITE072593		Click to Show/Hide the Full List
mod site	chr5:157570888-157570889:-		[10]
Sequence	CCCGTGAGAGAAAAGGTAAGACTCAAAAGACCTCATTTACA
Motif Score	3.319380952
Cell/Tissue List	U2OS; GSC-11; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000517951.5; ENST00000257527.8; ENST00000519752.1; ENST00000517905.1
External Link	RMBase: m6A_site_695542
mod ID: M6ASITE072594		Click to Show/Hide the Full List
mod site	chr5:157570920-157570921:-		[10]
Sequence	TTATCATACCTCAGTGGAAGACTTCAGAAAGCCCCGTGAGA
Motif Score	3.319380952
Cell/Tissue List	U2OS; GSC-11; HEK293T; iSLK; MSC; GSCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000257527.8; ENST00000519752.1; ENST00000517951.5; ENST00000517905.1
External Link	RMBase: m6A_site_695543
mod ID: M6ASITE072595		Click to Show/Hide the Full List
mod site	chr5:157570942-157570943:-		[10]
Sequence	AGCCCCAAGCTGCAGCATGAACTTATCATACCTCAGTGGAA
Motif Score	3.373380952
Cell/Tissue List	U2OS; GSC-11; HEK293T; iSLK; MSC; GSCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000517951.5; ENST00000519752.1; ENST00000517905.1; ENST00000257527.8
External Link	RMBase: m6A_site_695544
mod ID: M6ASITE072596		Click to Show/Hide the Full List
mod site	chr5:157575605-157575606:-		[10]
Sequence	CGGCGCGGGAGCCTGGATGGACAAGTAAGTGGCCAGGCGCG
Motif Score	3.643047619
Cell/Tissue List	U2OS; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; GSCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000257527.8; ENST00000517905.1; ENST00000517951.5; ENST00000519752.1
External Link	RMBase: m6A_site_695545

Ref 1	m(6)A RNA Methylation Regulates the Self-Renewal and Tumorigenesis of Glioblastoma Stem Cells. Cell Rep. 2017 Mar 14;18(11):2622-2634. doi: 10.1016/j.celrep.2017.02.059.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	Widespread RNA editing of embedded alu elements in the human transcriptome. Genome Res. 2004 Sep;14(9):1719-25. doi: 10.1101/gr.2855504.
Ref 4	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 5	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 6	N(6)-methyladenosine of HIV-1 RNA regulates viral infection and HIV-1 Gag protein expression. Elife. 2016 Jul 2;5:e15528. doi: 10.7554/eLife.15528.
Ref 7	m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell. 2014 Dec 4;15(6):707-19. doi: 10.1016/j.stem.2014.09.019. Epub 2014 Oct 16.
Ref 8	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 9	m(6)A Demethylase ALKBH5 Maintains Tumorigenicity of Glioblastoma Stem-like Cells by Sustaining FOXM1 Expression and Cell Proliferation Program. Cancer Cell. 2017 Apr 10;31(4):591-606.e6. doi: 10.1016/j.ccell.2017.02.013. Epub 2017 Mar 23.
Ref 10	RNA-methylation-dependent RNA processing controls the speed of the circadian clock. Cell. 2013 Nov 7;155(4):793-806. doi: 10.1016/j.cell.2013.10.026.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map