m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00165)

Target Name	ATP-binding cassette sub-family C member 9 (ABCC9)
Synonyms	Sulfonylurea receptor 2; SUR2 Click to Show/Hide
Gene Name	ABCC9
Chromosomal Location	12p12.1
Family	ABC transporter superfamily; ABCC family; Conjugate transporter (TC 3;A;1;208) subfamily
Function	Subunit of ATP-sensitive potassium channels (KATP). Can form cardiac and smooth muscle-type KATP channels with KCNJ11. KCNJ11 forms the channel pore while ABCC9 is required for activation and regulation. Click to Show/Hide
Gene ID	10060
Uniprot ID	ABCC9_HUMAN
HGNC ID	HGNC:60
KEGG ID	hsa:10060

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ABCC9 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	ARPE-19 cell line	Homo sapiens
Treatment: shMETTL3 ARPE-19 cells Control: shControl ARPE-19 cells		GSE202017
Regulation		logFC: -1.97E+00 p-value: 5.10E-08
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between ABCC9 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 6.69E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	TRIM11 regulates nasopharyngeal carcinoma drug resistance by positively modulating the Daple/beta-catenin/ATP-binding cassette sub-family C member 9 (ABCC9) signaling pathway. TRIM11 enhanced the multidrug resistance in NPC by inhibiting apoptosis in vitro and promoting cisplatin (DDP) resistance in vivo. METTL3-mediated m6A modification caused the upregulation of TRIM11 via IGF2BP2 in NPC drug-resistant cells.
Target Regulation	Down regulation
Responsed Disease	Nasopharyngeal carcinoma		ICD-11: 2B6B	Disease Info
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	ABC transporters			hsa02010
	Wnt signaling pathway			hsa04310
	Ubiquitin mediated proteolysis			hsa04120
Cell Process	Ubiquitination degradation
In-vitro Model	CNE-1	Normal	Homo sapiens	CVCL_6888
	CNE-2	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6889
In-vivo Model	A total of 2 × 10⁶ cells was mixed with 0.2 ml PBS (pH 7.4) and 30% (v/v) Matrigel matrix (BD Biosciences).

Nasopharyngeal carcinoma [ICD-11: 2B6B]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	TRIM11 regulates nasopharyngeal carcinoma drug resistance by positively modulating the Daple/beta-catenin/ATP-binding cassette sub-family C member 9 (ABCC9) signaling pathway. TRIM11 enhanced the multidrug resistance in NPC by inhibiting apoptosis in vitro and promoting cisplatin (DDP) resistance in vivo. METTL3-mediated m6A modification caused the upregulation of TRIM11 via IGF2BP2 in NPC drug-resistant cells.
Responsed Disease	Nasopharyngeal carcinoma [ICD-11: 2B6B]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Cisplatin		Approved	Drug Info
Pathway Response	ABC transporters			hsa02010
	Wnt signaling pathway			hsa04310
	Ubiquitin mediated proteolysis			hsa04120
Cell Process	Ubiquitination degradation
In-vitro Model	CNE-1	Normal	Homo sapiens	CVCL_6888
	CNE-2	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6889
In-vivo Model	A total of 2 × 10⁶ cells was mixed with 0.2 ml PBS (pH 7.4) and 30% (v/v) Matrigel matrix (BD Biosciences).

Cisplatin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	TRIM11 regulates nasopharyngeal carcinoma drug resistance by positively modulating the Daple/beta-catenin/ATP-binding cassette sub-family C member 9 (ABCC9) signaling pathway. TRIM11 enhanced the multidrug resistance in NPC by inhibiting apoptosis in vitro and promoting cisplatin (DDP) resistance in vivo. METTL3-mediated m6A modification caused the upregulation of TRIM11 via IGF2BP2 in NPC drug-resistant cells.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Nasopharyngeal carcinoma		ICD-11: 2B6B	Disease Info
Pathway Response	ABC transporters			hsa02010
	Wnt signaling pathway			hsa04310
	Ubiquitin mediated proteolysis			hsa04120
Cell Process	Ubiquitination degradation
In-vitro Model	CNE-1	Normal	Homo sapiens	CVCL_6888
	CNE-2	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6889
In-vivo Model	A total of 2 × 10⁶ cells was mixed with 0.2 ml PBS (pH 7.4) and 30% (v/v) Matrigel matrix (BD Biosciences).

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00165)

ATP-binding cassette sub-family C member 9 (ABCC9)

N6-methyladenosine (m6A)

In total 9 m6A sequence/site(s) in this target gene
mod ID: M6ASITE010937		Click to Show/Hide the Full List
mod site	chr12:21806032-21806033:-		[2]
Sequence	TTTTGCAAAAAGTAGTAATGACAGCCTTTGCAGACCGGACC
Motif Score	2.859755952
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000261201.8; ENST00000544039.5; ENST00000261200.8
External Link	RMBase: m6A_site_179387
mod ID: M6ASITE010938		Click to Show/Hide the Full List
mod site	chr12:21845624-21845625:-		[2]
Sequence	GACATCGGAGTACAGTATAAACAATACTGGAAAAGCTGATC
Motif Score	2.20572619
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000261201.8; ENST00000261200.8; ENST00000544039.5
External Link	RMBase: m6A_site_179388
mod ID: M6ASITE010939		Click to Show/Hide the Full List
mod site	chr12:21845649-21845650:-		[2]
Sequence	CTATAGACTATTGGCTGGCCACATGGACATCGGAGTACAGT
Motif Score	2.053113095
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000544039.5; ENST00000261200.8; ENST00000261201.8
External Link	RMBase: m6A_site_179389
mod ID: M6ASITE010940		Click to Show/Hide the Full List
mod site	chr12:21845757-21845758:-		[3]
Sequence	GGACTAAAATGCCATGGAAAACCTGCTGGCGCTACCTGACA
Motif Score	2.185083333
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000261200.8; ENST00000544039.5; ENST00000261201.8
External Link	RMBase: m6A_site_179390
mod ID: M6ASITE010941		Click to Show/Hide the Full List
mod site	chr12:21845775-21845776:-		[3]
Sequence	CCACTGTAATGAGGCTCAGGACTAAAATGCCATGGAAAACC
Motif Score	4.065041667
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000261201.8; ENST00000261200.8; ENST00000544039.5
External Link	RMBase: m6A_site_179391
mod ID: M6ASITE010942		Click to Show/Hide the Full List
mod site	chr12:21848209-21848210:-		[3]
Sequence	AAACTACTTTAGAGAGGAAAACTCTCCGACGGGCCATGTAT
Motif Score	2.627720238
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000261200.8; ENST00000544039.5; ENST00000261201.8
External Link	RMBase: m6A_site_179392
mod ID: M6ASITE010943		Click to Show/Hide the Full List
mod site	chr12:21848227-21848228:-		[3]
Sequence	AGGATATGGAAGCTGACCAAACTACTTTAGAGAGGAAAACT
Motif Score	2.627720238
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000261201.8; ENST00000544039.5; ENST00000261200.8
External Link	RMBase: m6A_site_179393
mod ID: M6ASITE010944		Click to Show/Hide the Full List
mod site	chr12:21942410-21942411:-		[4]
Sequence	CACAGGAACGGAGTCTTCGGACCCTCCCAGGTTTCGGCCCC
Motif Score	3.622404762
Cell/Tissue List	MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000636888.1
External Link	RMBase: m6A_site_179394
mod ID: M6ASITE010945		Click to Show/Hide the Full List
mod site	chr12:21942466-21942467:-		[4]
Sequence	ATTTCCCTGCGCCGCTGCAGACAGCTCCAGGGTAAAGTTGT
Motif Score	2.897386905
Cell/Tissue List	MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000636888.1
External Link	RMBase: m6A_site_179395

Ref 1	TRIM11 facilitates chemoresistance in nasopharyngeal carcinoma by activating the Beta-catenin/ABCC9 axis via p62-selective autophagic degradation of Daple. Oncogenesis. 2020 May 7;9(5):45. doi: 10.1038/s41389-020-0229-9.
Ref 2	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 3	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 4	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map