General Information of the m6A Target Gene (ID: M6ATAR00163)
Target Name AMPK subunit alpha-1 (AMPK/PRKAA1)
Synonyms
AMPK subunit alpha-1; Acetyl-CoA carboxylase kinase; ACACA kinase; Hydroxymethylglutaryl-CoA reductase kinase; HMGCR kinase; Tau-protein kinase PRKAA1; AMPK1
    Click to Show/Hide
Gene Name PRKAA1
Chromosomal Location 5p13.1
Family protein kinase superfamily; CAMK Ser/Thr protein kinase family; SNF1 subfamily
Function
Catalytic subunit of AMP-activated protein kinase (AMPK), an energy sensor protein kinase that plays a key role in regulating cellular energy metabolism . In response to reduction of intracellular ATP levels, AMPK activates energy-producing pathways and inhibits energy-consuming processes: inhibits protein, carbohydrate and lipid biosynthesis, as well as cell growth and proliferation. AMPK acts via direct phosphorylation of metabolic enzymes, and by longer-term effects via phosphorylation of transcription regulators. Regulates lipid synthesis by phosphorylating and inactivating lipid metabolic enzymes such as ACACA, ACACB, GYS1, HMGCR and LIPE; regulates fatty acid and cholesterol synthesis by phosphorylating acetyl-CoA carboxylase (ACACA and ACACB) and hormone-sensitive lipase (LIPE) enzymes, respectively (By similarity). Promotes lipolysis of lipid droplets by mediating phosphorylation of isoform 1 of CHKA (CHKalpha2). Regulates insulin-signaling and glycolysis by phosphorylating IRS1, PFKFB2 and PFKFB3 (By similarity). AMPK stimulates glucose uptake in muscle by increasing the translocation of the glucose transporter SLC2A4/GLUT4 to the plasma membrane, possibly by mediating phosphorylation of TBC1D4/AS160 (By similarity). Regulates transcription and chromatin structure by phosphorylating transcription regulators involved in energy metabolism such as CRTC2/TORC2, FOXO3, histone H2B, HDAC5, MEF2C, MLXIPL/ChREBP, EP300, HNF4A, p53/TP53, SREBF1, SREBF2 and PPARGC1A. Acts as a key regulator of glucose homeostasis in liver by phosphorylating CRTC2/TORC2, leading to CRTC2/TORC2 sequestration in the cytoplasm (By similarity). In response to stress, phosphorylates 'Ser-36' of histone H2B (H2BS36ph), leading to promote transcription (By similarity). Acts as a key regulator of cell growth and proliferation by phosphorylating TSC2, RPTOR and ATG1/ULK1: in response to nutrient limitation, negatively regulates the mTORC1 complex by phosphorylating RPTOR component of the mTORC1 complex and by phosphorylating and activating TSC2. In response to nutrient limitation, promotes autophagy by phosphorylating and activating ATG1/ULK1. In that process also activates WDR45/WIPI4. Phosphorylates CASP6, thereby preventing its autoprocessing and subsequent activation. In response to nutrient limitation, phosphorylates transcription factor FOXO3 promoting FOXO3 mitochondrial import (By similarity). Also acts as a regulator of cellular polarity by remodeling the actin cytoskeleton; probably by indirectly activating myosin. AMPK also acts as a regulator of circadian rhythm by mediating phosphorylation of CRY1, leading to destabilize it (By similarity). May regulate the Wnt signaling pathway by phosphorylating CTNNB1, leading to stabilize it (By similarity). Also has tau-protein kinase activity: in response to amyloid beta A4 protein (APP) exposure, activated by CAMKK2, leading to phosphorylation of MAPT/TAU; however the relevance of such data remains unclear in vivo (By similarity). Also phosphorylates CFTR, EEF2K, KLC1, NOS3 and SLC12A1.
    Click to Show/Hide
Gene ID 5562
Uniprot ID
AAPK1_HUMAN
HGNC ID
HGNC:9376
KEGG ID
hsa:5562
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
PRKAA1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line Caco-2 cell line Homo sapiens
Treatment: shMETTL3 Caco-2 cells
Control: shNTC Caco-2 cells
GSE167075
Regulation
logFC: 7.94E-01
p-value: 1.12E-47
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary m6A driven machinery in virus-induced vascular endothelium damage and highlight the significance of vitamin D3 in the intervention of HCMV-induced atherosclerosis. METTL3 methylates mitochondrial calcium uniporter (MCU), the main contributor to HCMV-induced apoptosis of vascular endothelial cells, at three m6A residues in the 3'-UTR. Vitamin D3 downregulated the METTL3 by inhibiting the activation of AMPK subunit alpha-1 (AMPK/PRKAA1), thereby inhibiting the m6A modification of MCU and cell apoptosis.
Target Regulation Down regulation
Responsed Disease Atherosclerosis ICD-11: BD40.Z
Pathway Response AMPK signaling pathway hsa04152
Cell Process Cell apoptosis
In-vitro Model hTERT-RPE1 Normal Homo sapiens CVCL_4388
iHAEC Normal Homo sapiens CVCL_C0EQ
Wilms tumor 1-associating protein (WTAP) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by WTAP
Cell Line mice hepatocyte Mus musculus
Treatment: Wtap Hknockout mice hepatocyte
Control: Wtap flox/flox mice hepatocyte
GSE168850
Regulation
logFC: 6.89E-01
p-value: 3.35E-03
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary WTAP/LKB1/AMPK subunit alpha-1 (AMPK/PRKAA1) axis in hepatocellular carcinoma cells acted as a key regulator, linking m6A with autophagy. WTAP-mediated m6A modification plays an important role in the regulation of autophagy in hepatocellular carcinoma cells, which provides a promising target for the treatment of hepatocellular carcinoma.
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
Pathway Response AMPK signaling pathway hsa04152
Autophagy hsa04140
Cell Process Cell autophagy
In-vitro Model BEL-7402 Endocervical adenocarcinoma Homo sapiens CVCL_5492
BEL-7404 Endocervical adenocarcinoma Homo sapiens CVCL_6568
HEK293T Normal Homo sapiens CVCL_0063
L-02 Endocervical adenocarcinoma Homo sapiens CVCL_6926
SMMC-7721 Endocervical adenocarcinoma Homo sapiens CVCL_0534
Liver cancer [ICD-11: 2C12]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary WTAP/LKB1/AMPK subunit alpha-1 (AMPK/PRKAA1) axis in hepatocellular carcinoma cells acted as a key regulator, linking m6A with autophagy. WTAP-mediated m6A modification plays an important role in the regulation of autophagy in hepatocellular carcinoma cells, which provides a promising target for the treatment of hepatocellular carcinoma.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator Wilms tumor 1-associating protein (WTAP) WRITER
Target Regulation Up regulation
Pathway Response AMPK signaling pathway hsa04152
Autophagy hsa04140
Cell Process Cell autophagy
In-vitro Model BEL-7402 Endocervical adenocarcinoma Homo sapiens CVCL_5492
BEL-7404 Endocervical adenocarcinoma Homo sapiens CVCL_6568
HEK293T Normal Homo sapiens CVCL_0063
L-02 Endocervical adenocarcinoma Homo sapiens CVCL_6926
SMMC-7721 Endocervical adenocarcinoma Homo sapiens CVCL_0534
Atherosclerosis [ICD-11: BD40]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary m6A driven machinery in virus-induced vascular endothelium damage and highlight the significance of vitamin D3 in the intervention of HCMV-induced atherosclerosis. METTL3 methylates mitochondrial calcium uniporter (MCU), the main contributor to HCMV-induced apoptosis of vascular endothelial cells, at three m6A residues in the 3'-UTR. Vitamin D3 downregulated the METTL3 by inhibiting the activation of AMPK subunit alpha-1 (AMPK/PRKAA1), thereby inhibiting the m6A modification of MCU and cell apoptosis.
Responsed Disease Atherosclerosis [ICD-11: BD40.Z]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Down regulation
Pathway Response AMPK signaling pathway hsa04152
Cell Process Cell apoptosis
In-vitro Model hTERT-RPE1 Normal Homo sapiens CVCL_4388
iHAEC Normal Homo sapiens CVCL_C0EQ
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00163)
AMPK subunit alpha-1 (AMPK/PRKAA1)
5-methylcytidine (m5C)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003406 Click to Show/Hide the Full List
mod site chr5:40765057-40765058:-
Sequence CAGGATCCTTTGGCAGTTGCCTACCATCTCATAATAGATAA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000354209.7; ENST00000397128.6; ENST00000506652.5; ENST00000505783.5
External Link RMBase: m5C_site_34889
mod ID: M5CSITE003408 Click to Show/Hide the Full List
mod site chr5:40765099-40765100:-
Sequence TCAGAAGAGGAAGTTCTCAGCTGTCTTTACAACAGAAATCA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000505783.5; ENST00000354209.7; ENST00000506652.5; ENST00000397128.6
External Link RMBase: m5C_site_34890
N6-methyladenosine (m6A)
In total 71 m6A sequence/site(s) in this target gene
mod ID: M6ASITE068947 Click to Show/Hide the Full List
mod site chr5:40759991-40759992:- [3]
Sequence TTGCCAGAAATGTACTGTATACATAGTTTTAAGTATAACAG
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666690
mod ID: M6ASITE068948 Click to Show/Hide the Full List
mod site chr5:40760036-40760037:- [4]
Sequence CATATTTTTACTTTGTCTTGACAACTGAAAGATGTATAAGG
Motif Score 2.859755952
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666691
mod ID: M6ASITE068949 Click to Show/Hide the Full List
mod site chr5:40760068-40760069:- [4]
Sequence AGCAGTTTATATTTTTTGTGACTTTATGCAACCATATTTTT
Motif Score 3.28175
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666692
mod ID: M6ASITE068950 Click to Show/Hide the Full List
mod site chr5:40760222-40760223:- [3]
Sequence AAGCTAGGATATTTGAAATGACAACCTTTGGTTAAGTGTGT
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666693
mod ID: M6ASITE068951 Click to Show/Hide the Full List
mod site chr5:40760265-40760266:- [4]
Sequence ATAGTATGATAAATGCACAGACAATTGCAGTAAATTCTTTT
Motif Score 2.897386905
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666694
mod ID: M6ASITE068952 Click to Show/Hide the Full List
mod site chr5:40760498-40760499:- [5]
Sequence GTTCCTGATGTTAACAGAAGACTGTATTTTTAAAGTTACAA
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666695
mod ID: M6ASITE068953 Click to Show/Hide the Full List
mod site chr5:40760545-40760546:- [4]
Sequence CTTTAGGGGATTCTAATTTTACTTAGGGTCTCTAAGTGCAG
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666696
mod ID: M6ASITE068954 Click to Show/Hide the Full List
mod site chr5:40760593-40760594:- [5]
Sequence CATTTAAATATGAGTTCAAAACTGTATTTACTTTTTATGTG
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666697
mod ID: M6ASITE068955 Click to Show/Hide the Full List
mod site chr5:40760631-40760632:- [3]
Sequence ACTTCTAATTTGAAAGCTGTACAAAGTAATAGAAGTTCCAT
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666698
mod ID: M6ASITE068956 Click to Show/Hide the Full List
mod site chr5:40760777-40760778:- [5]
Sequence ATGTAACCAGATGATAATGAACTCAAATGTCATGATAGCTT
Motif Score 3.373380952
Cell/Tissue List HeLa; A549; HEK293A-TOA; NB4
Seq Type List m6A-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666699
mod ID: M6ASITE068957 Click to Show/Hide the Full List
mod site chr5:40760810-40760811:- [6]
Sequence TAGGATTATTTTTGGCAAATACAGTGAGCACTTATGTAACC
Motif Score 2.110482143
Cell/Tissue List kidney; liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666700
mod ID: M6ASITE068958 Click to Show/Hide the Full List
mod site chr5:40761066-40761067:- [4]
Sequence TTAAATTACTTTTTAAAGATACTGGATTTTCCTAAGATTTC
Motif Score 2.53247619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666701
mod ID: M6ASITE068959 Click to Show/Hide the Full List
mod site chr5:40761195-40761196:- [3]
Sequence CTAGGATCCAATTAAAGTTTACATATGACACTTGGTTATAA
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666702
mod ID: M6ASITE068960 Click to Show/Hide the Full List
mod site chr5:40761216-40761217:- [5]
Sequence TTTATAGCTGATTATTTCAAACTAGGATCCAATTAAAGTTT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666703
mod ID: M6ASITE068961 Click to Show/Hide the Full List
mod site chr5:40761336-40761337:- [4]
Sequence AGTATCTCCTACAGATAATGACATTCTCCTAAAAATCCGTA
Motif Score 2.859755952
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666704
mod ID: M6ASITE068962 Click to Show/Hide the Full List
mod site chr5:40761384-40761385:- [5]
Sequence GAACCATTTGGATGTTACAGACATACTTATCACCGTGAAAA
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666705
mod ID: M6ASITE068963 Click to Show/Hide the Full List
mod site chr5:40761402-40761403:- [5]
Sequence ATATGCTTTTTTCCCCCTGAACCATTTGGATGTTACAGACA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666706
mod ID: M6ASITE068964 Click to Show/Hide the Full List
mod site chr5:40761581-40761582:- [5]
Sequence TATTATGAACATTTTTAAAAACAGAAAAATTGAAAAACTGT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666707
mod ID: M6ASITE068965 Click to Show/Hide the Full List
mod site chr5:40761593-40761594:- [5]
Sequence CCCCCCAAATTTTATTATGAACATTTTTAAAAACAGAAAAA
Motif Score 2.951386905
Cell/Tissue List HeLa; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666708
mod ID: M6ASITE068966 Click to Show/Hide the Full List
mod site chr5:40761638-40761639:- [5]
Sequence TAGAAAACTATCTCTTACAAACTTTAAGTGCTCTGATATGA
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666709
mod ID: M6ASITE068967 Click to Show/Hide the Full List
mod site chr5:40761642-40761643:- [4]
Sequence TGCATAGAAAACTATCTCTTACAAACTTTAAGTGCTCTGAT
Motif Score 2.07285119
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666710
mod ID: M6ASITE068968 Click to Show/Hide the Full List
mod site chr5:40761652-40761653:- [5]
Sequence ATTGATTCAGTGCATAGAAAACTATCTCTTACAAACTTTAA
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666711
mod ID: M6ASITE068969 Click to Show/Hide the Full List
mod site chr5:40761752-40761753:- [3]
Sequence ATATTATTTTTGCCAATTTCACAAATTCCTCTGGCCCATCA
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666712
mod ID: M6ASITE068970 Click to Show/Hide the Full List
mod site chr5:40761786-40761787:- [4]
Sequence ACAAGAGCTGAGTTGCATATACTGTAGATAAATCATATTAT
Motif Score 2.53247619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666713
mod ID: M6ASITE068971 Click to Show/Hide the Full List
mod site chr5:40761806-40761807:- [3]
Sequence CACAAAATGTTCTTTTTGTTACAAGAGCTGAGTTGCATATA
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666714
mod ID: M6ASITE068972 Click to Show/Hide the Full List
mod site chr5:40761827-40761828:- [3]
Sequence ATATTCCCACGATATTCTGTACACAAAATGTTCTTTTTGTT
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666715
mod ID: M6ASITE068973 Click to Show/Hide the Full List
mod site chr5:40761896-40761897:- [7]
Sequence TTAGCTTTACAAGTCCAAAAACACAGAATTTATATATTCAG
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666716
mod ID: M6ASITE068974 Click to Show/Hide the Full List
mod site chr5:40761908-40761909:- [3]
Sequence TTAAATTTCATTTTAGCTTTACAAGTCCAAAAACACAGAAT
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666717
mod ID: M6ASITE068975 Click to Show/Hide the Full List
mod site chr5:40761935-40761936:- [7]
Sequence TAAGTCATATCAGATATCAGACCTAATTTAAATTTCATTTT
Motif Score 2.876744048
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666718
mod ID: M6ASITE068976 Click to Show/Hide the Full List
mod site chr5:40762313-40762314:- [6]
Sequence AGTATCTTCCAGCAGTAGTAACAGTCTGGATAACTTCTTCC
Motif Score 2.168095238
Cell/Tissue List liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666719
mod ID: M6ASITE068977 Click to Show/Hide the Full List
mod site chr5:40762383-40762384:- [5]
Sequence ATTTGCCTAGAATTCCCAAGACCTTTATAGGTGATTTTGTT
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666720
mod ID: M6ASITE068978 Click to Show/Hide the Full List
mod site chr5:40762492-40762493:- [3]
Sequence GGCTATTTTATATTTAGTGTACACAGGGCTTTGAAATATTA
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666721
mod ID: M6ASITE068979 Click to Show/Hide the Full List
mod site chr5:40762550-40762551:- [3]
Sequence GTATGTATATAGCATAATATACACAGTGAATTATAGGTCTC
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666722
mod ID: M6ASITE068980 Click to Show/Hide the Full List
mod site chr5:40762637-40762638:- [5]
Sequence CAATTTGCACAGGGATTGGAACATGATTTATAGTTAAAAGC
Motif Score 2.951386905
Cell/Tissue List HeLa; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000397128.6
External Link RMBase: m6A_site_666723
mod ID: M6ASITE068981 Click to Show/Hide the Full List
mod site chr5:40762769-40762770:- [5]
Sequence TCTTGCACAATAAACAGAAAACTTTGCTTATTTCTTTTGCA
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; fibroblasts; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000397128.6; ENST00000354209.7
External Link RMBase: m6A_site_666724
mod ID: M6ASITE068982 Click to Show/Hide the Full List
mod site chr5:40762776-40762777:- [5]
Sequence TTAAAATTCTTGCACAATAAACAGAAAACTTTGCTTATTTC
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; fibroblasts; A549; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000354209.7; ENST00000397128.6
External Link RMBase: m6A_site_666725
mod ID: M6ASITE068983 Click to Show/Hide the Full List
mod site chr5:40762832-40762833:- [3]
Sequence AACTCCAAGACCTGGAAGTCACACAATAGAATTTTTTGAGA
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000397128.6; ENST00000354209.7
External Link RMBase: m6A_site_666726
mod ID: M6ASITE068984 Click to Show/Hide the Full List
mod site chr5:40762843-40762844:- [5]
Sequence CCTGTTGACCTAACTCCAAGACCTGGAAGTCACACAATAGA
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; fibroblasts; A549; Huh7; CD4T; HEK293A-TOA; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000397128.6; ENST00000354209.7
External Link RMBase: m6A_site_666727
mod ID: M6ASITE068985 Click to Show/Hide the Full List
mod site chr5:40762995-40762996:- [5]
Sequence TTACAGAAGCCAAATCAGGGACTGCTACTCCACAGAGATCG
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; BGC823; fibroblasts; A549; Huh7; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000354209.7; ENST00000397128.6
External Link RMBase: m6A_site_666728
mod ID: M6ASITE068986 Click to Show/Hide the Full List
mod site chr5:40764480-40764481:- [5]
Sequence CACAAAACAACATAGATTAGACCTTGTTACTAACTTGGTAT
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; Huh7; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000354209.7; ENST00000513152.1; ENST00000397128.6
External Link RMBase: m6A_site_666729
mod ID: M6ASITE068987 Click to Show/Hide the Full List
mod site chr5:40764494-40764495:- [5]
Sequence TGGTATGTACATCACACAAAACAACATAGATTAGACCTTGT
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; BGC823; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000397128.6; ENST00000513152.1; ENST00000354209.7
External Link RMBase: m6A_site_666730
mod ID: M6ASITE068988 Click to Show/Hide the Full List
mod site chr5:40764543-40764544:- [5]
Sequence TATACCAAGTGGATAGTAGAACTTATCTACTGGATTTCCGT
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34; HEK293T; BGC823; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000513152.1; ENST00000397128.6; ENST00000354209.7
External Link RMBase: m6A_site_666731
mod ID: M6ASITE068989 Click to Show/Hide the Full List
mod site chr5:40764568-40764569:- [6]
Sequence ACTTACTCCAAAATGAGTCTACAGTTATACCAAGTGGATAG
Motif Score 2.078666667
Cell/Tissue List liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000513152.1; ENST00000397128.6; ENST00000354209.7
External Link RMBase: m6A_site_666732
mod ID: M6ASITE068990 Click to Show/Hide the Full List
mod site chr5:40764594-40764595:- [3]
Sequence TACGAAGGAAGAATCCTGTGACAAGCACTTACTCCAAAATG
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000397128.6; ENST00000354209.7; ENST00000513152.1
External Link RMBase: m6A_site_666733
mod ID: M6ASITE068991 Click to Show/Hide the Full List
mod site chr5:40764632-40764633:- [5]
Sequence TACCATGTGCTAGGTTGTAAACCCATATTATTTGCGTGTAC
Motif Score 2.185083333
Cell/Tissue List HeLa; CD34; HEK293T; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000397128.6; ENST00000513152.1; ENST00000354209.7
External Link RMBase: m6A_site_666734
mod ID: M6ASITE068992 Click to Show/Hide the Full List
mod site chr5:40764772-40764773:- [5]
Sequence GAAGTATGTAGAGCAATCAAACAATTGGATTATGAATGGAA
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HEK293T; hESC-HEK293T; hNPCs
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000513152.1; ENST00000505783.5; ENST00000354209.7; ENST00000397128.6
External Link RMBase: m6A_site_666735
mod ID: M6ASITE068993 Click to Show/Hide the Full List
mod site chr5:40764865-40764866:- [5]
Sequence TTAAATCCACAGAAATCCAAACACCAAGGTGTAAGGAAAGC
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HEK293T; hESC-HEK293T; hNPCs
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000354209.7; ENST00000397128.6; ENST00000505783.5
External Link RMBase: m6A_site_666736
mod ID: M6ASITE068994 Click to Show/Hide the Full List
mod site chr5:40764915-40764916:- [5]
Sequence TACCATTCTTGGTTGCTGAAACACCAAGGGCACGCCATACC
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T; hNPCs
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000397128.6; ENST00000505783.5; ENST00000354209.7
External Link RMBase: m6A_site_666737
mod ID: M6ASITE068995 Click to Show/Hide the Full List
mod site chr5:40764996-40764997:- [3]
Sequence CCAAAGATTTCTATTTGGCGACAAGCCCACCTGATTCTTTT
Motif Score 2.865571429
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000505783.5; ENST00000506652.5; ENST00000397128.6; ENST00000354209.7
External Link RMBase: m6A_site_666738
mod ID: M6ASITE068996 Click to Show/Hide the Full List
mod site chr5:40765091-40765092:- [3]
Sequence GGAAGTTCTCAGCTGTCTTTACAACAGAAATCACCAGGATC
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000354209.7; ENST00000506652.5; ENST00000505783.5; ENST00000397128.6
External Link RMBase: m6A_site_666739
mod ID: M6ASITE068997 Click to Show/Hide the Full List
mod site chr5:40765214-40765215:- [5]
Sequence ACATGAATGGTTTAAACAGGACCTTCCAAAATATCTCTTTC
Motif Score 3.622404762
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000397128.6; ENST00000354209.7; ENST00000506652.5; ENST00000505783.5
External Link RMBase: m6A_site_666740
mod ID: M6ASITE068998 Click to Show/Hide the Full List
mod site chr5:40765219-40765220:- [5]
Sequence AGGGAACATGAATGGTTTAAACAGGACCTTCCAAAATATCT
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000505783.5; ENST00000397128.6; ENST00000506652.5; ENST00000354209.7
External Link RMBase: m6A_site_666741
mod ID: M6ASITE068999 Click to Show/Hide the Full List
mod site chr5:40765234-40765235:- [5]
Sequence TGCCATTTTTCTCTCAGGGAACATGAATGGTTTAAACAGGA
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000354209.7; ENST00000505783.5; ENST00000506652.5; ENST00000397128.6
External Link RMBase: m6A_site_666742
mod ID: M6ASITE069000 Click to Show/Hide the Full List
mod site chr5:40767515-40767516:- [5]
Sequence TCTGTGATTAGCCTTTTGAAACATATGCTGCAGGTGGATCC
Motif Score 2.20572619
Cell/Tissue List HeLa; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000509874.5; ENST00000505783.5; ENST00000354209.7; ENST00000506652.5; ENST00000397128.6
External Link RMBase: m6A_site_666743
mod ID: M6ASITE069001 Click to Show/Hide the Full List
mod site chr5:40767622-40767623:- [5]
Sequence TCTATGCTTTATTATGTGGAACCCTTCCATTTGATGATGAC
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000397128.6; ENST00000509874.5; ENST00000506652.5; ENST00000354209.7; ENST00000505783.5
External Link RMBase: m6A_site_666744
mod ID: M6ASITE069002 Click to Show/Hide the Full List
mod site chr5:40768433-40768434:- [5]
Sequence AAACAATTCAGGACATGGAGACTGTGGAAAGTTGTTATTTA
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000505783.5; ENST00000397128.6; ENST00000506652.5; ENST00000354209.7; ENST00000509874.5; ENST00000296800.4
External Link RMBase: m6A_site_666745
mod ID: M6ASITE069003 Click to Show/Hide the Full List
mod site chr5:40768441-40768442:- [5]
Sequence TAGGAATAAAACAATTCAGGACATGGAGACTGTGGAAAGTT
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000397128.6; ENST00000505783.5; ENST00000354209.7; ENST00000296800.4; ENST00000506652.5; ENST00000509874.5
External Link RMBase: m6A_site_666746
mod ID: M6ASITE069004 Click to Show/Hide the Full List
mod site chr5:40768451-40768452:- [5]
Sequence TTAATTCTTTTAGGAATAAAACAATTCAGGACATGGAGACT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000506652.5; ENST00000505783.5; ENST00000509874.5; ENST00000354209.7; ENST00000397128.6; ENST00000296800.4
External Link RMBase: m6A_site_666747
mod ID: M6ASITE069005 Click to Show/Hide the Full List
mod site chr5:40771746-40771747:- [3]
Sequence GAAAATGTCCTGCTTGATGCACACATGAATGCAAAGATAGC
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000397128.6; ENST00000296800.4; ENST00000509874.5; ENST00000354209.7; ENST00000505783.5; ENST00000506652.5
External Link RMBase: m6A_site_666748
mod ID: M6ASITE069006 Click to Show/Hide the Full List
mod site chr5:40771801-40771802:- [6]
Sequence TTCTGGTGTGGATTATTGTCACAGGCATATGGTGGTCCATA
Motif Score 2.047297619
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000505783.5; ENST00000296800.4; ENST00000354209.7; ENST00000506652.5; ENST00000397128.6; ENST00000509874.5
External Link RMBase: m6A_site_666749
mod ID: M6ASITE069007 Click to Show/Hide the Full List
mod site chr5:40774944-40774945:- [5]
Sequence ATGTACCTGGAGTAGTAAAAACAGGCTCCACGAAGGAGGTA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000354209.7; ENST00000296800.4; ENST00000397128.6; ENST00000509874.5; ENST00000506652.5
External Link RMBase: m6A_site_666750
mod ID: M6ASITE069008 Click to Show/Hide the Full List
mod site chr5:40775486-40775487:- [3]
Sequence CCAGGTACCAGGTCATCAGTACACCATCTGATATTTTCATG
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000509874.5; ENST00000397128.6; ENST00000354209.7; ENST00000296800.4; ENST00000506652.5
External Link RMBase: m6A_site_666751
mod ID: M6ASITE069009 Click to Show/Hide the Full List
mod site chr5:40775753-40775754:- [4]
Sequence TTTCCTTTAGCACTCTGTATACAAAGATTCCCCTTCATTTG
Motif Score 2.110482143
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000509874.5; ENST00000397128.6; ENST00000354209.7; rmsk_1604589; ENST00000296800.4; ENST00000506652.5
External Link RMBase: m6A_site_666752
mod ID: M6ASITE069010 Click to Show/Hide the Full List
mod site chr5:40777038-40777039:- [5]
Sequence GCTTGGGCAACAAAAGCGAAACTCTGTCCCAAAAAAAAATA
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000354209.7; ENST00000509874.5; ENST00000296800.4; ENST00000506652.5; ENST00000511248.1; rmsk_1604590; ENST00000397128.6
External Link RMBase: m6A_site_666753
mod ID: M6ASITE069011 Click to Show/Hide the Full List
mod site chr5:40777108-40777109:- [5]
Sequence AAGGCAGGAGAATGGCTTGAACCTGGGAGGCGGAGGTTGCA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000397128.6; ENST00000354209.7; ENST00000511248.1; rmsk_1604590; ENST00000296800.4; ENST00000509874.5; ENST00000506652.5
External Link RMBase: m6A_site_666754
mod ID: M6ASITE069012 Click to Show/Hide the Full List
mod site chr5:40777446-40777447:- [5]
Sequence AGGCATCCTCATATAATTAAACTGTAAGCTCTGTTTATATT
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000511248.1; ENST00000296800.4; ENST00000506652.5; ENST00000354209.7; ENST00000397128.6; ENST00000509874.5; ENST00000397006.2
External Link RMBase: m6A_site_666755
mod ID: M6ASITE069013 Click to Show/Hide the Full List
mod site chr5:40777480-40777481:- [5]
Sequence AATCCGCAGAGAAATTCAGAACCTCAAGCTTTTCAGGCATC
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; A549; peripheral-blood
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000506652.5; ENST00000354209.7; ENST00000397006.2; ENST00000397128.6; ENST00000511248.1; ENST00000509874.5; ENST00000296800.4
External Link RMBase: m6A_site_666756
mod ID: M6ASITE069014 Click to Show/Hide the Full List
mod site chr5:40777578-40777579:- [5]
Sequence ACTTCTTTTACAGTTGGCAAACATGAATTGACTGGGCATAA
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HepG2; A549; hESC-HEK293T; fibroblasts; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; MSC; TIME; iSLK; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000397006.2; ENST00000506652.5; ENST00000354209.7; ENST00000397128.6; ENST00000509874.5; ENST00000511248.1; ENST00000296800.4
External Link RMBase: m6A_site_666757
mod ID: M6ASITE069015 Click to Show/Hide the Full List
mod site chr5:40798097-40798098:- [3]
Sequence CGGCCACTACATTCTGGGTGACACGCTGGGGGTCGGCACCT
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000506652.5; ENST00000397128.6; ENST00000509874.5; ENST00000511248.1; ENST00000296800.4; ENST00000397006.2; ENST00000354209.7
External Link RMBase: m6A_site_666758
mod ID: M6ASITE069016 Click to Show/Hide the Full List
mod site chr5:40798138-40798139:- [5]
Sequence GCGACAGCCGAGAAGCAGAAACACGACGGGCGGGTGAAGAT
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; A549; H1A; HEK293T; fibroblasts; MT4; MM6; Jurkat; CD4T; HEK293A-TOA; MSC; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000506652.5; ENST00000397006.2; ENST00000296800.4; ENST00000511248.1; ENST00000397128.6; ENST00000509874.5; ENST00000354209.7
External Link RMBase: m6A_site_666759
mod ID: M6ASITE069017 Click to Show/Hide the Full List
mod site chr5:40798180-40798181:- [5]
Sequence TCCCGCAGCGCCATGCGCAGACTCAGTTCCTGGAGAAAGAT
Motif Score 3.319380952
Cell/Tissue List HeLa; CD34; H1A; HEK293T; fibroblasts; A549; CD4T; HEK293A-TOA; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000397128.6; ENST00000354209.7; ENST00000509874.5
External Link RMBase: m6A_site_666760