m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00161)
Target Name Autophagy-related protein 16-1 (ATG16L1)
Synonyms
APG16-like 1; APG16L; UNQ9393/PRO34307
    Click to Show/Hide
Gene Name ATG16L1
Chromosomal Location 2q37.1
Family WD repeat ATG16 family
Function
Plays an essential role in both canonical and non-canonical autophagy: interacts with ATG12-ATG5 to mediate the lipidation to ATG8 family proteins (MAP1LC3A, MAP1LC3B, MAP1LC3C, GABARAPL1, GABARAPL2 and GABARAP). Acts as a molecular hub, coordinating autophagy pathways via distinct domains that support either canonical or non-canonical signaling. During canonical autophagy, interacts with ATG12-ATG5 to mediate the conjugation of phosphatidylethanolamine (PE) to ATG8 proteins, to produce a membrane-bound activated form of ATG8. Thereby, controls the elongation of the nascent autophagosomal membrane. Also involved in non-canonical autophagy, a parallel pathway involving conjugation of ATG8 proteins to single membranes at endolysosomal compartments, probably by catalyzing conjugation of phosphatidylserine (PS) to ATG8. Non-canonical autophagy plays a key role in epithelial cells to limit lethal infection by influenza A (IAV) virus (By similarity). Regulates mitochondrial antiviral signaling (MAVS)-dependent type I interferon (IFN-I) production. Negatively regulates NOD1- and NOD2-driven inflammatory cytokine response. Instead, promotes with NOD2 an autophagy-dependent antibacterial pathway. Plays a role in regulating morphology and function of Paneth cell.
    Click to Show/Hide
Gene ID 55054
Uniprot ID
A16L1_HUMAN
HGNC ID
HGNC:21498
KEGG ID
hsa:55054
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ATG16L1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line CT26 cell line Mus musculus
Treatment: METTL3 knockout CT26 cells
Control: CT26 cells
 GSE142589
Regulation
logFC: -8.44E-01
p-value: 3.07E-03
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between ATG16L1 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 2.03E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, ATG5, ATG7, ATG12, and Autophagy-related protein 16-1 (ATG16L1).
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Responsed Drug Sorafenib Approved
 Drug Info 
Pathway Response FoxO signaling pathway hsa04068
Autophagy hsa04140
Cell Process Cell autophagy
YTH domain-containing family protein 1 (YTHDF1) [READER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF1
Cell Line AGS cell line Homo sapiens
Treatment: shYTHDF1 AGS
Control: shNC AGS
 GSE166972
Regulation
logFC: -1.37E+00
p-value: 3.41E-02
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, ATG5, ATG7, ATG12, and Autophagy-related protein 16-1 (ATG16L1).
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Responsed Drug Sorafenib Approved
 Drug Info 
Pathway Response FoxO signaling pathway hsa04068
Autophagy hsa04140
Cell Process Cell autophagy
Liver cancer [ICD-11: 2C12]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, ATG5, ATG7, ATG12, and Autophagy-related protein 16-1 (ATG16L1).
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Sorafenib Approved
 Drug Info 
Pathway Response FoxO signaling pathway hsa04068
Autophagy hsa04140
Cell Process Cell autophagy
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, ATG5, ATG7, ATG12, and Autophagy-related protein 16-1 (ATG16L1).
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Sorafenib Approved
 Drug Info 
Pathway Response FoxO signaling pathway hsa04068
Autophagy hsa04140
Cell Process Cell autophagy
Sorafenib [Approved]
 Drug Info 
In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, ATG5, ATG7, ATG12, and Autophagy-related protein 16-1 (ATG16L1).
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Pathway Response FoxO signaling pathway hsa04068
Autophagy hsa04140
Cell Process Cell autophagy
Experiment 2 Reporting the m6A-centered Drug Response [1]
Response Summary METTL3 can sensitise hepatocellular carcinoma cells to sorafenib through stabilising forkhead box class O3 (FOXO3) in an m6A-dependent manner and translated by YTHDF1, thereby inhibiting the transcription of autophagy-related genes, including ATG3, ATG5, ATG7, ATG12, and Autophagy-related protein 16-1 (ATG16L1).
Target Regulator YTH domain-containing family protein 1 (YTHDF1) READER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Pathway Response FoxO signaling pathway hsa04068
Autophagy hsa04140
Cell Process Cell autophagy
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00161)
Autophagy-related protein 16-1 (ATG16L1)
Adenosine-to-Inosine editing (A-to-I)
In total 4 m6A sequence/site(s) in this target gene
mod ID: A2ISITE010257 Click to Show/Hide the Full List
mod site chr2:233257910-233257911:+ [2]
Sequence GCTACCCGGGAGGTTGAGACAGAATTGCTTGAACCTGGGAG
Transcript ID List ENST00000479942.5; ENST00000373525.9; ENST00000392021.7; ENST00000347464.9; ENST00000392018.1; ENST00000392017.9; ENST00000444735.5; rmsk_850296; ENST00000419681.5; ENST00000392020.8; ENST00000485623.5; ENST00000431917.5; ENST00000474148.5; ENST00000417017.5
External Link RMBase: RNA-editing_site_84313
mod ID: A2ISITE010258 Click to Show/Hide the Full List
mod site chr2:233288091-233288092:+ [2]
Sequence GCCGGCACCCGACTGGCAGCAGTTGTAAGATGCTGTCCCAG
Transcript ID List ENST00000498620.5; ENST00000474148.5; ENST00000392020.8; ENST00000392017.9; ENST00000392021.7; ENST00000392018.1; ENST00000464645.5; ENST00000479942.5; ENST00000373525.9; ENST00000347464.9
External Link RMBase: RNA-editing_site_84314
mod ID: A2ISITE010259 Click to Show/Hide the Full List
mod site chr2:233288418-233288419:+ [3]
Sequence AGCCTCCCCTGTAACAGCTGAGACTATAAGTACCCACCACA
Transcript ID List ENST00000392021.7; ENST00000392018.1; ENST00000474148.5; ENST00000392017.9; ENST00000392020.8; ENST00000464645.5; ENST00000373525.9; ENST00000498620.5; ENST00000479942.5; ENST00000347464.9
External Link RMBase: RNA-editing_site_84315
mod ID: A2ISITE010260 Click to Show/Hide the Full List
mod site chr2:233288842-233288843:+ [2]
Sequence TTCCTCCGTGAGCTCAGGGAAGACACTGGTTGGCATCCAAC
Transcript ID List ENST00000392018.1; ENST00000373525.9; ENST00000392020.8; ENST00000498620.5; ENST00000464645.5; ENST00000515982.1; ENST00000474148.5; ENST00000347464.9; ENST00000479942.5; ENST00000392017.9; ENST00000392021.7
External Link RMBase: RNA-editing_site_84316
5-methylcytidine (m5C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002529 Click to Show/Hide the Full List
mod site chr2:233251931-233251932:+
Sequence AGACAGGCGTTCGAGGAGATCATCCTGCAGTGTGAGCGGCG
Cell/Tissue List HEK293T
Seq Type List Bisulfite-seq
Transcript ID List ENST00000392021.7; ENST00000444735.5; ENST00000392018.1; ENST00000431917.5; ENST00000417017.5; ENST00000392020.8; ENST00000373525.9; ENST00000392017.9; ENST00000479942.5; ENST00000485623.5; ENST00000419681.5; ENST00000347464.9; ENST00000474148.5
External Link RMBase: m5C_site_28033
N6-methyladenosine (m6A)
In total 33 m6A sequence/site(s) in this target gene
mod ID: M6ASITE050524 Click to Show/Hide the Full List
mod site chr2:233256104-233256105:+ [4]
Sequence CTTTTTTATTTTAATAGATAACAAATTGCTGGAAAAGTCAG
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000373525.9; ENST00000347464.9; ENST00000485623.5; ENST00000392021.7; ENST00000419681.5; ENST00000431917.5; ENST00000417017.5; ENST00000444735.5; ENST00000479942.5; ENST00000392020.8; ENST00000392017.9; ENST00000392018.1; ENST00000474148.5
External Link RMBase: m6A_site_515642
mod ID: M6ASITE050525 Click to Show/Hide the Full List
mod site chr2:233263165-233263166:+ [4]
Sequence ACATGGAATGACAATCAGCTACAAGAAATGGCCCAACTGAG
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000373525.9; ENST00000392018.1; ENST00000417017.5; ENST00000392020.8; ENST00000392021.7; ENST00000419681.5; ENST00000392017.9; ENST00000431917.5; ENST00000347464.9; ENST00000485623.5; ENST00000474148.5; ENST00000444735.5; ENST00000479942.5
External Link RMBase: m6A_site_515643
mod ID: M6ASITE050526 Click to Show/Hide the Full List
mod site chr2:233263216-233263217:+ [4]
Sequence CAAGAGGAACTGACTGAATTACACAAGAAACGTGGGGAGGT
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000392017.9; ENST00000444735.5; ENST00000373525.9; ENST00000485623.5; ENST00000392020.8; ENST00000479942.5; ENST00000392018.1; ENST00000347464.9; ENST00000431917.5; ENST00000392021.7; ENST00000417017.5; ENST00000474148.5; ENST00000419681.5
External Link RMBase: m6A_site_515644
mod ID: M6ASITE050527 Click to Show/Hide the Full List
mod site chr2:233273006-233273007:+ [4]
Sequence TGTGGATGAAACTTCTGATCACACAGAAGAGACCTCTCCTG
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000347464.9; ENST00000479942.5; ENST00000419681.5; ENST00000417017.5; ENST00000392018.1; ENST00000392017.9; ENST00000474148.5; ENST00000498620.5; ENST00000392020.8; ENST00000392021.7; ENST00000373525.9; ENST00000444735.5
External Link RMBase: m6A_site_515645
mod ID: M6ASITE050528 Click to Show/Hide the Full List
mod site chr2:233274710-233274711:+ [4]
Sequence TTCCTTCCCAGTCCCCCAGGACAATGTGGATACTCATCCTG
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000419681.5; ENST00000373525.9; ENST00000347464.9; ENST00000392021.7; ENST00000392018.1; ENST00000392020.8; ENST00000492298.5; ENST00000498620.5; ENST00000479942.5; ENST00000392017.9; ENST00000474148.5; ENST00000444735.5
External Link RMBase: m6A_site_515646
mod ID: M6ASITE050529 Click to Show/Hide the Full List
mod site chr2:233275926-233275927:+ [5]
Sequence GCTGACGAGTATCCAACAAAACCAGTTACACAGGAGACTGA
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000347464.9; ENST00000474148.5; ENST00000492298.5; ENST00000392017.9; ENST00000464645.5; ENST00000392021.7; ENST00000419681.5; ENST00000479942.5; ENST00000392020.8; ENST00000516201.1; ENST00000392018.1; ENST00000373525.9; ENST00000498620.5
External Link RMBase: m6A_site_515647
mod ID: M6ASITE050530 Click to Show/Hide the Full List
mod site chr2:233275942-233275943:+ [5]
Sequence CAAAACCAGTTACACAGGAGACTGACGAGTGGCAGTCATGG
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000392020.8; ENST00000474148.5; ENST00000392018.1; ENST00000498620.5; ENST00000392017.9; ENST00000419681.5; ENST00000492298.5; ENST00000373525.9; ENST00000347464.9; ENST00000479942.5; ENST00000392021.7; ENST00000464645.5; ENST00000516201.1
External Link RMBase: m6A_site_515648
mod ID: M6ASITE050531 Click to Show/Hide the Full List
mod site chr2:233275999-233276000:+ [5]
Sequence TCTCAAGTTTTCAATCTGAGACCTCCTAAGGAGAAAGAAAC
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000474148.5; ENST00000392018.1; ENST00000392020.8; ENST00000419681.5; ENST00000492298.5; ENST00000392021.7; ENST00000479942.5; ENST00000464645.5; ENST00000373525.9; ENST00000347464.9; ENST00000498620.5; ENST00000516201.1; ENST00000392017.9
External Link RMBase: m6A_site_515649
mod ID: M6ASITE050532 Click to Show/Hide the Full List
mod site chr2:233281151-233281152:+ [4]
Sequence CTGGCAGTAATGCAGGAATTACAAGCATTGAATTTGATAGT
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000474148.5; ENST00000392021.7; ENST00000464645.5; ENST00000373525.9; ENST00000472242.1; ENST00000392018.1; ENST00000392017.9; ENST00000392020.8; ENST00000347464.9; ENST00000498620.5; ENST00000479942.5
External Link RMBase: m6A_site_515650
mod ID: M6ASITE050533 Click to Show/Hide the Full List
mod site chr2:233288844-233288845:+ [5]
Sequence CCTCCGTGAGCTCAGGGAAGACACTGGTTGGCATCCAACAG
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000464645.5; ENST00000474148.5; ENST00000392018.1; ENST00000498620.5; ENST00000392020.8; ENST00000392017.9; ENST00000479942.5; ENST00000515982.1; ENST00000392021.7; ENST00000373525.9; ENST00000347464.9
External Link RMBase: m6A_site_515651
mod ID: M6ASITE050534 Click to Show/Hide the Full List
mod site chr2:233288937-233288938:+ [5]
Sequence TCTGCCTTGTTCAAGCTGAGACCTCTGATTGAAAATCCCCC
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000373525.9; ENST00000347464.9; ENST00000392021.7; ENST00000392020.8; ENST00000392018.1; ENST00000479942.5; ENST00000464645.5; ENST00000474148.5; ENST00000392017.9; ENST00000515982.1; ENST00000498620.5
External Link RMBase: m6A_site_515652
mod ID: M6ASITE050535 Click to Show/Hide the Full List
mod site chr2:233289854-233289855:+ [4]
Sequence GCTGTGTTCTCTCTCCTAGCACACACTCACGGGACACAGTG
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000373525.9; ENST00000347464.9; ENST00000392017.9; ENST00000392021.7; ENST00000479942.5; ENST00000474148.5; ENST00000392020.8; ENST00000392018.1; ENST00000498620.5; ENST00000464645.5
External Link RMBase: m6A_site_515653
mod ID: M6ASITE050536 Click to Show/Hide the Full List
mod site chr2:233289905-233289906:+ [4]
Sequence GTCTGCTAAGTTCCTGCTGGACAATGCGCGGATTGTCTCAG
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000392021.7; ENST00000474148.5; ENST00000464645.5; ENST00000392018.1; ENST00000392017.9; ENST00000347464.9; ENST00000479942.5; ENST00000373525.9; ENST00000392020.8
External Link RMBase: m6A_site_515654
mod ID: M6ASITE050537 Click to Show/Hide the Full List
mod site chr2:233290346-233290347:+ [4]
Sequence CAAGAAAATTCGTTTCTGGGACATTCGGTATGATACCCAAG
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000392020.8; ENST00000392021.7; ENST00000479942.5; ENST00000392017.9; ENST00000347464.9; ENST00000473865.1; ENST00000474148.5; ENST00000373525.9; ENST00000464645.5; ENST00000392018.1
External Link RMBase: m6A_site_515655
mod ID: M6ASITE050538 Click to Show/Hide the Full List
mod site chr2:233292251-233292252:+ [4]
Sequence TAAAAGTTATTGATCTCCGAACAAATGCTATCAAGCAGACA
Motif Score 2.951386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000392021.7; ENST00000392017.9; ENST00000373525.9; ENST00000473865.1; ENST00000479942.5; ENST00000474148.5; ENST00000392020.8; ENST00000392018.1; ENST00000347464.9
External Link RMBase: m6A_site_515656
mod ID: M6ASITE050539 Click to Show/Hide the Full List
mod site chr2:233294398-233294399:+ [4]
Sequence GTGCCCTCCTCAGAAGAAGCACATGGGCTCCTGCAGCCCTG
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000392017.9; ENST00000474148.5; ENST00000479942.5; ENST00000347464.9; ENST00000392018.1; ENST00000373525.9; ENST00000392020.8; ENST00000392021.7; ENST00000473865.1
External Link RMBase: m6A_site_515657
mod ID: M6ASITE050540 Click to Show/Hide the Full List
mod site chr2:233294547-233294548:+ [4]
Sequence TCTCTTGGCCTGGAAGAATAACACTGAAAAAACCTGACGCT
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T; AML
Seq Type List MAZTER-seq; miCLIP
Transcript ID List ENST00000392020.8; ENST00000479942.5; ENST00000392021.7; ENST00000373525.9; ENST00000392017.9; ENST00000474148.5; ENST00000392018.1; ENST00000347464.9
External Link RMBase: m6A_site_515658
mod ID: M6ASITE050541 Click to Show/Hide the Full List
mod site chr2:233294574-233294575:+ [6]
Sequence AAAAACCTGACGCTGCGGTCACTTAGCAGAGGCTCAGGTTC
Motif Score 2.469291667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000392020.8; ENST00000373525.9; ENST00000474148.5; ENST00000392018.1; ENST00000392021.7; ENST00000347464.9; ENST00000479942.5; ENST00000392017.9
External Link RMBase: m6A_site_515659
mod ID: M6ASITE050542 Click to Show/Hide the Full List
mod site chr2:233294607-233294608:+ [4]
Sequence TCAGGTTCTTGCCTTGGGAAACACTACTAGCTCTGACCTTC
Motif Score 2.20572619
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000479942.5; ENST00000392021.7; ENST00000392017.9; ENST00000474148.5; ENST00000347464.9; ENST00000373525.9; ENST00000392020.8; ENST00000392018.1
External Link RMBase: m6A_site_515660
mod ID: M6ASITE050543 Click to Show/Hide the Full List
mod site chr2:233294699-233294700:+ [4]
Sequence CAGTGCCAAAATCAGCCCCCACATCAAGGTGGTGTTCTCTG
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000474148.5; ENST00000392018.1; ENST00000392017.9; ENST00000392021.7; ENST00000347464.9; ENST00000392020.8; ENST00000479942.5; ENST00000373525.9
External Link RMBase: m6A_site_515661
mod ID: M6ASITE050544 Click to Show/Hide the Full List
mod site chr2:233294769-233294770:+ [4]
Sequence CTGGCCTAACGCATGTCCCAACACCTTGGGTTCATTTGCCC
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000479942.5; ENST00000392021.7; ENST00000392020.8; ENST00000392018.1; ENST00000347464.9; ENST00000373525.9; ENST00000474148.5; ENST00000392017.9
External Link RMBase: m6A_site_515662
mod ID: M6ASITE050545 Click to Show/Hide the Full List
mod site chr2:233294795-233294796:+ [5]
Sequence TGGGTTCATTTGCCCGGTGAACTCACTTTAAGCATTGGATT
Motif Score 3.373380952
Cell/Tissue List HeLa; AML
Seq Type List m6A-seq; miCLIP
Transcript ID List ENST00000392017.9; ENST00000474148.5; ENST00000392018.1; ENST00000347464.9; ENST00000479942.5; ENST00000373525.9; ENST00000392021.7; ENST00000392020.8
External Link RMBase: m6A_site_515663
mod ID: M6ASITE050546 Click to Show/Hide the Full List
mod site chr2:233294799-233294800:+ [6]
Sequence TTCATTTGCCCGGTGAACTCACTTTAAGCATTGGATTAACG
Motif Score 2.469291667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000392021.7; ENST00000373525.9; ENST00000392017.9; ENST00000474148.5; ENST00000392018.1; ENST00000479942.5; ENST00000347464.9; ENST00000392020.8
External Link RMBase: m6A_site_515664
mod ID: M6ASITE050547 Click to Show/Hide the Full List
mod site chr2:233294823-233294824:+ [5]
Sequence TAAGCATTGGATTAACGGAAACTCCCGAACTACAGACCCCT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000347464.9; ENST00000479942.5; ENST00000392020.8; ENST00000392018.1; ENST00000474148.5; ENST00000392017.9; ENST00000373525.9; ENST00000392021.7
External Link RMBase: m6A_site_515665
mod ID: M6ASITE050548 Click to Show/Hide the Full List
mod site chr2:233294831-233294832:+ [5]
Sequence GGATTAACGGAAACTCCCGAACTACAGACCCCTCCCTGGTG
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000479942.5; ENST00000373525.9; ENST00000474148.5; ENST00000392021.7; ENST00000392020.8; ENST00000392017.9; ENST00000392018.1; ENST00000347464.9
External Link RMBase: m6A_site_515666
mod ID: M6ASITE050549 Click to Show/Hide the Full List
mod site chr2:233294834-233294835:+ [7]
Sequence TTAACGGAAACTCCCGAACTACAGACCCCTCCCTGGTGGGT
Motif Score 2.078666667
Cell/Tissue List HEK293
Seq Type List m6A-REF-seq
Transcript ID List ENST00000392018.1; ENST00000347464.9; ENST00000392020.8; ENST00000474148.5; ENST00000392021.7; ENST00000373525.9; ENST00000392017.9; ENST00000479942.5
External Link RMBase: m6A_site_515667
mod ID: M6ASITE050550 Click to Show/Hide the Full List
mod site chr2:233294838-233294839:+ [5]
Sequence CGGAAACTCCCGAACTACAGACCCCTCCCTGGTGGGTTGCA
Motif Score 2.876744048
Cell/Tissue List HeLa; CD8T
Seq Type List m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000373525.9; ENST00000392017.9; ENST00000392020.8; ENST00000392021.7; ENST00000479942.5; ENST00000392018.1; ENST00000347464.9; ENST00000474148.5
External Link RMBase: m6A_site_515668
mod ID: M6ASITE050551 Click to Show/Hide the Full List
mod site chr2:233294874-233294875:+ [6]
Sequence TTGCATGAATGTGTCTCATTACTGCTGAAATGTCCTCACAT
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000474148.5; ENST00000392021.7; ENST00000479942.5; ENST00000347464.9; ENST00000392017.9; ENST00000392018.1; ENST00000392020.8; ENST00000373525.9
External Link RMBase: m6A_site_515669
mod ID: M6ASITE050552 Click to Show/Hide the Full List
mod site chr2:233294891-233294892:+ [7]
Sequence ATTACTGCTGAAATGTCCTCACATCTCTTTCACTGTTCTTC
Motif Score 2.047297619
Cell/Tissue List kidney; hESC-HEK293T
Seq Type List m6A-REF-seq; MAZTER-seq
Transcript ID List ENST00000392018.1; ENST00000373525.9; ENST00000479942.5; ENST00000392021.7; ENST00000347464.9; ENST00000392020.8; ENST00000474148.5; ENST00000392017.9
External Link RMBase: m6A_site_515670
mod ID: M6ASITE050553 Click to Show/Hide the Full List
mod site chr2:233294937-233294938:+ [4]
Sequence TTTCTGGCTCTCTTTCCCCCACAAAATTCGACATATTTAAA
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000392021.7; ENST00000347464.9; ENST00000392020.8; ENST00000392017.9; ENST00000373525.9; ENST00000392018.1; ENST00000474148.5; ENST00000479942.5
External Link RMBase: m6A_site_515671
mod ID: M6ASITE050554 Click to Show/Hide the Full List
mod site chr2:233295091-233295092:+ [4]
Sequence GTTCCTGTATCGATCTGCAGACACCCAGAAGGTGGGTGCAC
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000479942.5; ENST00000474148.5; ENST00000392018.1; ENST00000347464.9; ENST00000392021.7; ENST00000392017.9; ENST00000373525.9; ENST00000392020.8
External Link RMBase: m6A_site_515672
mod ID: M6ASITE050555 Click to Show/Hide the Full List
mod site chr2:233295387-233295388:+ [6]
Sequence TTTATCACTTTTAAATTTGCACTTTATTTTTTTTCTTCCAT
Motif Score 3.252583333
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000373525.9; ENST00000392017.9; ENST00000347464.9; ENST00000474148.5; ENST00000479942.5; ENST00000392020.8; ENST00000392018.1; ENST00000392021.7
External Link RMBase: m6A_site_515673
mod ID: M6ASITE050556 Click to Show/Hide the Full List
mod site chr2:233295574-233295575:+ [7]
Sequence GTCAAGGAGAGTTGAAATTCACAGGCCAGGGCACATCTTTT
Motif Score 2.047297619
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000373525.9; ENST00000392017.9; ENST00000347464.9; ENST00000392018.1; ENST00000474148.5; ENST00000479942.5; ENST00000392021.7; ENST00000392020.8
External Link RMBase: m6A_site_515674