m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00155)

Target Name	Integrin subunit beta 3 (ITGB3)
Synonyms	ITGB3; GP3A; integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61); CD61; GPIIIa; platelet glycoprotein IIIa; antigen CD61 Click to Show/Hide
Gene Name	ITGB3
Chromosomal Location	17q21.32
Family	integrin beta chain family
Function	Integrin alpha-V/beta-3 (ITGAV:ITGB3) is a receptor for cytotactin, fibronectin, laminin, matrix metalloproteinase-2, osteopontin, osteomodulin, prothrombin, thrombospondin, vitronectin and von Willebrand factor. Integrin alpha-IIb/beta-3 (ITGA2B:ITGB3) is a receptor for fibronectin, fibrinogen, plasminogen, prothrombin, thrombospondin and vitronectin. Integrins alpha-IIb/beta-3 and alpha-V/beta-3 recognize the sequence R-G-D in a wide array of ligands. Integrin alpha-IIb/beta-3 recognizes the sequence H-H-L-G-G-G-A-K-Q-A-G-D-V in fibrinogen gamma chain. Following activation integrin alpha-IIb/beta-3 brings about platelet/platelet interaction through binding of soluble fibrinogen. This step leads to rapid platelet aggregation which physically plugs ruptured endothelial surface. Fibrinogen binding enhances SELP expression in activated platelets (By similarity). ITGAV:ITGB3 binds to fractalkine (CX3CL1) and acts as its coreceptor in CX3CR1-dependent fractalkine signaling. ITGAV:ITGB3 binds to NRG1 (via EGF domain) and this binding is essential for NRG1-ERBB signaling. ITGAV:ITGB3 binds to FGF1 and this binding is essential for FGF1 signaling. ITGAV:ITGB3 binds to FGF2 and this binding is essential for FGF2 signaling. ITGAV:ITGB3 binds to IGF1 and this binding is essential for IGF1 signaling. ITGAV:ITGB3 binds to IGF2 and this binding is essential for IGF2 signaling. ITGAV:ITGB3 binds to IL1B and this binding is essential for IL1B signaling. ITGAV:ITGB3 binds to PLA2G2A via a site (site 2) which is distinct from the classical ligand-binding site (site 1) and this induces integrin conformational changes and enhanced ligand binding to site 1. ITGAV:ITGB3 acts as a receptor for fibrillin-1 (FBN1) and mediates R-G-D-dependent cell adhesion to FBN1. In brain, plays a role in synaptic transmission and plasticity. Involved in the regulation of the serotonin neurotransmission, is required to localize to specific compartments within the synapse the serotonin receptor SLC6A4 and for an appropriate reuptake of serotonin. Controls excitatory synaptic strength by regulating GRIA2-containing AMPAR endocytosis, which affects AMPAR abundance and composition (By similarity). ITGAV:ITGB3 act as a receptor for CD40LG. (Microbial infection) Integrin ITGAV:ITGB3 acts as a receptor for Herpes virus 8/HHV-8. (Microbial infection) Integrin ITGAV:ITGB3 acts as a receptor for Coxsackievirus A9. (Microbial infection) Acts as a receptor for Hantaan virus. (Microbial infection) Integrin ITGAV:ITGB3 acts as a receptor for Cytomegalovirus/HHV-5. (Microbial infection) Integrin ITGA5:ITGB3 acts as a receptor for Human metapneumovirus. (Microbial infection) Integrin ITGAV:ITGB3 acts aP05556s a receptor for Human parechovirus 1. (Microbial infection) Integrin ITGAV:ITGB3 acts as a receptor for West nile virus. (Microbial infection) In case of HIV-1 infection, the interaction with extracellular viral Tat protein seems to enhance angiogenesis in Kaposi's sarcoma lesions. Click to Show/Hide
Gene ID	3690
Uniprot ID	ITB3_HUMAN
HGNC ID	HGNC:6156
KEGG ID	hsa:3690

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ITGB3 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: -3.38E+00 p-value: 2.43E-215
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between ITGB3 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 2.57E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	FAM225A functioned as a competing endogenous RNA (ceRNA) for sponging miR-590-3p and miR-1275, leading to the upregulation of their target Integrin subunit beta 3 (ITGB3), and the activation of FAK/PI3K/Akt signaling to promote Nasopharyngeal carcinoma cell proliferation and invasion. FAM225A showed lower RNA stability after silencing of METTL3.
Target Regulation	Up regulation
Responsed Disease	Nasopharyngeal carcinoma		ICD-11: 2B6B	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation and metastasis
In-vitro Model	5-8F	Nasopharyngeal carcinoma	Homo sapiens	CVCL_C528
	6-10B	Nasopharyngeal carcinoma	Homo sapiens	CVCL_C529
	C666-1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_7949
	CNE-1	Normal	Homo sapiens	CVCL_6888
	CNE-2	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6889
	HK1	Nasopharyngeal carcinoma	Acipenser baerii	CVCL_YE27
	HNE-1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_0308
	HONE-1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_8706
	N2Tert (The human immortalized nasopharyngeal epithelial cell lines)
	NP69 (A human immortalized nasopharyngeal epithelial)
	S18	Nasopharyngeal carcinoma	Homo sapiens	CVCL_B0U9
	S26	Nasopharyngeal carcinoma	Homo sapiens	CVCL_B0UB
	SUNE1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6946
In-vivo Model	For the tumor growth model, 1 × 10⁶ HNE1-Scrambled or HNE1-shFAM2225A 2# cells were injected into the axilla of the mice, and the tumor size was measured every 3 days.

Nasopharyngeal carcinoma [ICD-11: 2B6B]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	FAM225A functioned as a competing endogenous RNA (ceRNA) for sponging miR-590-3p and miR-1275, leading to the upregulation of their target Integrin subunit beta 3 (ITGB3), and the activation of FAK/PI3K/Akt signaling to promote Nasopharyngeal carcinoma cell proliferation and invasion. FAM225A showed lower RNA stability after silencing of METTL3.
Responsed Disease	Nasopharyngeal carcinoma [ICD-11: 2B6B]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	PI3K-Akt signaling pathway			hsa04151
Cell Process	Cell proliferation and metastasis
In-vitro Model	5-8F	Nasopharyngeal carcinoma	Homo sapiens	CVCL_C528
	6-10B	Nasopharyngeal carcinoma	Homo sapiens	CVCL_C529
	C666-1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_7949
	CNE-1	Normal	Homo sapiens	CVCL_6888
	CNE-2	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6889
	HK1	Nasopharyngeal carcinoma	Acipenser baerii	CVCL_YE27
	HNE-1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_0308
	HONE-1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_8706
	N2Tert (The human immortalized nasopharyngeal epithelial cell lines)
	NP69 (A human immortalized nasopharyngeal epithelial)
	S18	Nasopharyngeal carcinoma	Homo sapiens	CVCL_B0U9
	S26	Nasopharyngeal carcinoma	Homo sapiens	CVCL_B0UB
	SUNE1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6946
In-vivo Model	For the tumor growth model, 1 × 10⁶ HNE1-Scrambled or HNE1-shFAM2225A 2# cells were injected into the axilla of the mice, and the tumor size was measured every 3 days.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00155)

Integrin subunit beta 3 (ITGB3)

Adenosine-to-Inosine editing (A-to-I)

In total 5 m6A sequence/site(s) in this target gene
mod ID: A2ISITE008218		Click to Show/Hide the Full List
mod site	chr17:47299049-47299050:+		[2]
Sequence	AAAGGGCAAGAGAGAGGGCAAGAGGCCCAGGAGACTTAGTT
Transcript ID List	ENST00000560629.1; ENST00000559488.5
External Link	RMBase: RNA-editing_site_58674
mod ID: A2ISITE008219		Click to Show/Hide the Full List
mod site	chr17:47309271-47309272:+		[3]
Sequence	TCTGTTACCCAGGCTGGTCTAGAACTCCTGGGCTCAAGTGA
Transcript ID List	ENST00000560629.1; ENST00000559488.5
External Link	RMBase: RNA-editing_site_58675
mod ID: A2ISITE008220		Click to Show/Hide the Full List
mod site	chr17:47309299-47309300:+		[3]
Sequence	TGGGCTCAAGTGATCTTCCTACCTTGGCCCCTAAAAGTGCT
Transcript ID List	ENST00000560629.1; ENST00000559488.5
External Link	RMBase: RNA-editing_site_58676
mod ID: A2ISITE008221		Click to Show/Hide the Full List
mod site	chr17:47309722-47309723:+		[3]
Sequence	GGGCAACATGAAGAAACCCCATCTCTACAAAAAAATGCAAA
Transcript ID List	ENST00000560629.1; ENST00000559488.5; rmsk_4706758
External Link	RMBase: RNA-editing_site_58677
mod ID: A2ISITE008222		Click to Show/Hide the Full List
mod site	chr17:47309839-47309840:+		[3]
Sequence	GGGGAGGTGGAGGTTTCAGTAAGCCGAGATTGTGCCACTGC
Transcript ID List	rmsk_4706758; ENST00000560629.1; ENST00000559488.5
External Link	RMBase: RNA-editing_site_58678

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE001202		Click to Show/Hide the Full List
mod site	chr17:47289686-47289687:+
Sequence	CTTCATTTTCCTAGGATTATCCCTCTTTGGGGCTGATGACT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000571680.1; ENST00000559488.5; ENST00000560629.1
External Link	RMBase: m5C_site_19328

N6-methyladenosine (m6A)

In total 14 m6A sequence/site(s) in this target gene
mod ID: M6ASITE033476		Click to Show/Hide the Full List
mod site	chr17:47283462-47283463:+		[4]
Sequence	TGAGGCCCGAGTACTAGAGGACAGGCCCCTCAGCGACAAGG
Motif Score	3.643047619
Cell/Tissue List	kidney; endometrial
Seq Type List	m6A-REF-seq; m6A-seq
Transcript ID List	ENST00000559488.5; ENST00000571680.1; ENST00000560629.1
External Link	RMBase: m6A_site_368416
mod ID: M6ASITE033477		Click to Show/Hide the Full List
mod site	chr17:47283492-47283493:+		[5]
Sequence	CAGCGACAAGGGCTCTGGAGACAGCTCCCAGGTCACTCAAG
Motif Score	2.897386905
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000559488.5; ENST00000560629.1; ENST00000571680.1
External Link	RMBase: m6A_site_368417
mod ID: M6ASITE033478		Click to Show/Hide the Full List
mod site	chr17:47284496-47284497:+		[5]
Sequence	GGTGGAGGATTACCCTGTGGACATCTACTACTTGATGGACC
Motif Score	3.643047619
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000571680.1; ENST00000559488.5; ENST00000560629.1
External Link	RMBase: m6A_site_368418
mod ID: M6ASITE033479		Click to Show/Hide the Full List
mod site	chr17:47284514-47284515:+		[5]
Sequence	GGACATCTACTACTTGATGGACCTGTCTTACTCCATGAAGG
Motif Score	3.622404762
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000560629.1; ENST00000559488.5; ENST00000571680.1
External Link	RMBase: m6A_site_368419
mod ID: M6ASITE033480		Click to Show/Hide the Full List
mod site	chr17:47292223-47292224:+		[6]
Sequence	AAAGCCCGTGGGCTTCAAGGACAGCCTGATCGTCCAGGTCA
Motif Score	3.643047619
Cell/Tissue List	GM12878; HEK293A-TOA; MSC; TIME; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000560629.1; ENST00000559488.5
External Link	RMBase: m6A_site_368420
mod ID: M6ASITE033481		Click to Show/Hide the Full List
mod site	chr17:47292281-47292282:+		[7]
Sequence	GCCTGCCAGGCCCAAGCTGAACCTAATAGCCATCGCTGCAA
Motif Score	2.930744048
Cell/Tissue List	U2OS; fibroblasts; GM12878; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000560629.1; ENST00000559488.5
External Link	RMBase: m6A_site_368421
mod ID: M6ASITE033482		Click to Show/Hide the Full List
mod site	chr17:47292315-47292316:+		[8]
Sequence	GCTGCAACAATGGCAATGGGACCTTTGAGTGTGGGGTATGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; U2OS; fibroblasts; GM12878; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000560629.1; ENST00000559488.5
External Link	RMBase: m6A_site_368422
mod ID: M6ASITE033483		Click to Show/Hide the Full List
mod site	chr17:47292385-47292386:+		[8]
Sequence	GTGTGAGTGCTCAGAGGAGGACTATCGCCCTTCCCAGCAGG
Motif Score	4.065041667
Cell/Tissue List	HeLa; A549; U2OS; fibroblasts; GM12878; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000560629.1; ENST00000559488.5
External Link	RMBase: m6A_site_368423
mod ID: M6ASITE033484		Click to Show/Hide the Full List
mod site	chr17:47292547-47292548:+		[4]
Sequence	CGACTTCTCCTGTGTCCGCTACAAGGGGGAGATGTGCTCAG
Motif Score	2.078666667
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000559488.5; ENST00000560629.1
External Link	RMBase: m6A_site_368424
mod ID: M6ASITE033485		Click to Show/Hide the Full List
mod site	chr17:47299331-47299332:+		[9]
Sequence	TGGCCAGTGCAGCTGTGGGGACTGCCTGTGTGACTCCGACT
Motif Score	4.065041667
Cell/Tissue List	GSC-11; iSLK; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000559488.5; ENST00000560629.1
External Link	RMBase: m6A_site_368425
mod ID: M6ASITE033486		Click to Show/Hide the Full List
mod site	chr17:47299354-47299355:+		[9]
Sequence	GCCTGTGTGACTCCGACTGGACCGGCTACTACTGCAACTGT
Motif Score	3.622404762
Cell/Tissue List	GSC-11; iSLK; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000559488.5; ENST00000560629.1
External Link	RMBase: m6A_site_368426
mod ID: M6ASITE033487		Click to Show/Hide the Full List
mod site	chr17:47307561-47307562:+		[10]
Sequence	GCCGCCCTGCTCATCTGGAAACTCCTCATCACCATCCACGA
Motif Score	2.627720238
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000560629.1; ENST00000559488.5
External Link	RMBase: m6A_site_368427
mod ID: M6ASITE033488		Click to Show/Hide the Full List
mod site	chr17:47307632-47307633:+		[10]
Sequence	ACGCGCCAGAGCAAAATGGGACACAGTAAGAGACGGGGCTG
Motif Score	3.643047619
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000560629.1; ENST00000559488.5
External Link	RMBase: m6A_site_368428
mod ID: M6ASITE033489		Click to Show/Hide the Full List
mod site	chr17:47310280-47310281:+		[11]
Sequence	TGCCATCATGTTTACAGAGGACAGTATTTGTGGGGAGGGAT
Motif Score	3.643047619
Cell/Tissue List	fibroblasts
Seq Type List	m6A-seq
Transcript ID List	ENST00000559488.5; ENST00000560629.1
External Link	RMBase: m6A_site_368429

Ref 1	Long Noncoding RNA FAM225A Promotes Nasopharyngeal Carcinoma Tumorigenesis and Metastasis by Acting as ceRNA to Sponge miR-590-3p/miR-1275 and Upregulate ITGB3. Cancer Res. 2019 Sep 15;79(18):4612-4626. doi: 10.1158/0008-5472.CAN-19-0799. Epub 2019 Jul 22.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 4	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 5	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 6	Structure and thermodynamics of N6-methyladenosine in RNA: a spring-loaded base modification. J Am Chem Soc. 2015 Feb 11;137(5):2107-15. doi: 10.1021/ja513080v. Epub 2015 Feb 2.
Ref 7	RNA-methylation-dependent RNA processing controls the speed of the circadian clock. Cell. 2013 Nov 7;155(4):793-806. doi: 10.1016/j.cell.2013.10.026.
Ref 8	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 9	m(6)A Demethylase ALKBH5 Maintains Tumorigenicity of Glioblastoma Stem-like Cells by Sustaining FOXM1 Expression and Cell Proliferation Program. Cancer Cell. 2017 Apr 10;31(4):591-606.e6. doi: 10.1016/j.ccell.2017.02.013. Epub 2017 Mar 23.
Ref 10	Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat Microbiol. 2016 Feb 22;1:16011. doi: 10.1038/nmicrobiol.2016.11.
Ref 11	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map