m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00149)

Target Name	U4/U6 small nuclear ribonucleoprotein Prp31 (PRPF31/RP11)
Synonyms	PRPF31; RP11; PRP31 pre-mRNA processing factor 31 homolog (yeast); PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae); NY-BR-99; PRP31; hPrp31; SNRNP61; U4/U6 small nuclear ribonucleoprotein Prp31 Click to Show/Hide
Gene Name	PRPF31
Chromosomal Location	19q13.42
Family	PRP31 family
Function	Involved in pre-mRNA splicing as component of the spliceosome. Required for the assembly of the U4/U5/U6 tri-snRNP complex, one of the building blocks of the spliceosome. Click to Show/Hide
Gene ID	26121
Uniprot ID	PRP31_HUMAN
HGNC ID	HGNC:15446
KEGG ID	hsa:26121

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

PRPF31 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	The U4/U6 small nuclear ribonucleoprotein Prp31 (PRPF31/RP11)/hnRNPA2B1/mRNA complex accelerated the mRNA degradation of two E3 ligases, Siah1 and Fbxo45, and subsequently prevented the proteasomal degradation of Zeb1. m6A can regulate the expression of RP11, further, RP11 regulated Siah1-Fbxo45/Zeb1 was involved in the development of Colorectal cancer.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	Proteasome			hsa03050
Cell Process	Proteasomal degradation
In-vitro Model	DLD-1	Colon adenocarcinoma	Homo sapiens	CVCL_0248
	HCT 15	Colon adenocarcinoma	Homo sapiens	CVCL_0292
	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	RKO	Colon carcinoma	Homo sapiens	CVCL_0504
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
In-vivo Model	HCT-15 RP11 stable overexpression or control cells (2 × 10⁶ per mouse) diluted in 100 uL normal medium + 100 uL Matrigel (BD Biosciences) were subcutaneously injected into immunodeficient mice to investigate tumour growth.

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	The U4/U6 small nuclear ribonucleoprotein Prp31 (PRPF31/RP11)/hnRNPA2B1/mRNA complex accelerated the mRNA degradation of two E3 ligases, Siah1 and Fbxo45, and subsequently prevented the proteasomal degradation of Zeb1. m6A can regulate the expression of RP11, further, RP11 regulated Siah1-Fbxo45/Zeb1 was involved in the development of Colorectal cancer.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Proteasome			hsa03050
Cell Process	Proteasomal degradation
In-vitro Model	DLD-1	Colon adenocarcinoma	Homo sapiens	CVCL_0248
	HCT 15	Colon adenocarcinoma	Homo sapiens	CVCL_0292
	HCT 8	Colon adenocarcinoma	Homo sapiens	CVCL_2478
	RKO	Colon carcinoma	Homo sapiens	CVCL_0504
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
In-vivo Model	HCT-15 RP11 stable overexpression or control cells (2 × 10⁶ per mouse) diluted in 100 uL normal medium + 100 uL Matrigel (BD Biosciences) were subcutaneously injected into immunodeficient mice to investigate tumour growth.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03356		Crosstalk Info
Epigenetic Regulator	Histone deacetylase 2 (HDAC2)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Crosstalk ID: M6ACROT03452		Crosstalk Info
Epigenetic Regulator	Histone deacetylase 1 (HDAC1)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03551		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Crosstalk ID: M6ACROT03596		Crosstalk Info
Epigenetic Regulator	N-lysine methyltransferase SMYD2 (SMYD2)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00149)

U4/U6 small nuclear ribonucleoprotein Prp31 (PRPF31/RP11)

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002112		Click to Show/Hide the Full List
mod site	chr19:54129083-54129084:+		[2]
Sequence	AGGACGCCTACCAGGAGGACCTGGGATTCAGCCTGGGCCAC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000419967.5; ENST00000466404.5; ENST00000321030.9; ENST00000391755.1
External Link	RMBase: m5C_site_25480

N6-methyladenosine (m6A)

In total 24 m6A sequence/site(s) in this target gene
mod ID: M6ASITE042374		Click to Show/Hide the Full List
mod site	chr19:54115774-54115775:+		[3]
Sequence	GTGAGCGACTAACGCTAGAAACAGTGGTGCGCGGAGAGGAG
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000321030.9; ENST00000419967.5; ENST00000445811.5
External Link	RMBase: m6A_site_453733
mod ID: M6ASITE042375		Click to Show/Hide the Full List
mod site	chr19:54118392-54118393:+		[3]
Sequence	TCGAGGATGTGCAGGAGGAGACACAGCTGGATCTTTCCGGG
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000321030.9; ENST00000445811.5; ENST00000447810.5; ENST00000391755.1; ENST00000419967.5; ENST00000445124.5
External Link	RMBase: m6A_site_453734
mod ID: M6ASITE042376		Click to Show/Hide the Full List
mod site	chr19:54121910-54121911:+		[3]
Sequence	CCGCGTCATCGTGGATGCCAACAACCTGACCGTGGAGATCG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000321030.9; ENST00000445124.5; ENST00000419967.5; ENST00000498612.1; ENST00000391755.1; ENST00000445811.5; ENST00000466404.5; ENST00000447810.5
External Link	RMBase: m6A_site_453735
mod ID: M6ASITE042377		Click to Show/Hide the Full List
mod site	chr19:54122496-54122497:+		[3]
Sequence	TCCTGTCCCGTTTACCCTAGACATCATCCATAAGTTCATCC
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000445811.5; ENST00000445124.5; ENST00000447810.5; ENST00000419967.5; ENST00000466404.5; ENST00000321030.9; ENST00000391755.1; ENST00000498612.1
External Link	RMBase: m6A_site_453736
mod ID: M6ASITE042378		Click to Show/Hide the Full List
mod site	chr19:54122577-54122578:+		[3]
Sequence	GGTCCCCAATGCACTGGATTACATCCGCACGGTCAAGGTGA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000391755.1; ENST00000466404.5; ENST00000447810.5; ENST00000445811.5; ENST00000419967.5; ENST00000498612.1; ENST00000321030.9; ENST00000445124.5
External Link	RMBase: m6A_site_453737
mod ID: M6ASITE042379		Click to Show/Hide the Full List
mod site	chr19:54123463-54123464:+		[4]
Sequence	TCGCCCCCAGGAGCTGGGCAACAGCCTGGACAAGTGCAAGA
Motif Score	2.173910714
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000391755.1; ENST00000498612.1; ENST00000445124.5; ENST00000466404.5; ENST00000321030.9; ENST00000419967.5; ENST00000447810.5; ENST00000445811.5
External Link	RMBase: m6A_site_453738
mod ID: M6ASITE042380		Click to Show/Hide the Full List
mod site	chr19:54123484-54123485:+		[3]
Sequence	CAGCCTGGACAAGTGCAAGAACAATGAGAACCTGCAGCAGA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000391755.1; ENST00000419967.5; ENST00000498612.1; ENST00000321030.9; ENST00000445811.5; ENST00000466404.5; ENST00000447810.5; ENST00000445124.5
External Link	RMBase: m6A_site_453739
mod ID: M6ASITE042381		Click to Show/Hide the Full List
mod site	chr19:54123795-54123796:+		[3]
Sequence	GCGGCTGGAGGAGGCCTGCGACATGGCGCTGGAGCTGAACG
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000447810.5; ENST00000445811.5; ENST00000466404.5; ENST00000321030.9; ENST00000419967.5; ENST00000498612.1; ENST00000391755.1; ENST00000445124.5; rmsk_5034118
External Link	RMBase: m6A_site_453740
mod ID: M6ASITE042382		Click to Show/Hide the Full List
mod site	chr19:54124543-54124544:+		[3]
Sequence	CTCCAAGATGCCCGCCTGCAACATCATGCTGCTCGGGGCCC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000498612.1; ENST00000391755.1; ENST00000445124.5; ENST00000445811.5; ENST00000466404.5; ENST00000447810.5; ENST00000321030.9; ENST00000419967.5
External Link	RMBase: m6A_site_453741
mod ID: M6ASITE042383		Click to Show/Hide the Full List
mod site	chr19:54124609-54124610:+		[3]
Sequence	GTCTACCTCAGTGCTGCCCCACACCGGCTACATCTACCACA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000445124.5; ENST00000445811.5; ENST00000321030.9; ENST00000391755.1; ENST00000466404.5; ENST00000498612.1; ENST00000419967.5
External Link	RMBase: m6A_site_453742
mod ID: M6ASITE042384		Click to Show/Hide the Full List
mod site	chr19:54124633-54124634:+		[3]
Sequence	CGGCTACATCTACCACAGTGACATCGTGCAGTCCCTGCCAC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000445811.5; ENST00000321030.9; ENST00000419967.5; ENST00000391755.1; ENST00000466404.5; ENST00000498612.1
External Link	RMBase: m6A_site_453743
mod ID: M6ASITE042385		Click to Show/Hide the Full List
mod site	chr19:54126569-54126570:+		[3]
Sequence	GGCTGGTGGCCGCCAAGTGCACACTGGCAGCCCGTGTGGAC
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000321030.9; ENST00000419967.5; ENST00000498612.1; ENST00000391755.1; ENST00000466404.5
External Link	RMBase: m6A_site_453744
mod ID: M6ASITE042386		Click to Show/Hide the Full List
mod site	chr19:54126588-54126589:+		[4]
Sequence	CACACTGGCAGCCCGTGTGGACAGTTTCCACGAGAGCACAG
Motif Score	3.643047619
Cell/Tissue List	brain
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000419967.5; ENST00000391755.1; ENST00000498612.1; ENST00000321030.9; ENST00000466404.5
External Link	RMBase: m6A_site_453745
mod ID: M6ASITE042387		Click to Show/Hide the Full List
mod site	chr19:54126605-54126606:+		[4]
Sequence	TGGACAGTTTCCACGAGAGCACAGAAGGGAAGGTGAGGAGG
Motif Score	2.830589286
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000419967.5; ENST00000466404.5; ENST00000498612.1; ENST00000391755.1; ENST00000321030.9
External Link	RMBase: m6A_site_453746
mod ID: M6ASITE042388		Click to Show/Hide the Full List
mod site	chr19:54128112-54128113:+		[3]
Sequence	TGAGATCGAGCGCAAATTCGACAAGTGGCAGGAGCCGCCGC
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000321030.9; ENST00000419967.5; ENST00000391755.1; ENST00000498612.1; ENST00000466404.5
External Link	RMBase: m6A_site_453747
mod ID: M6ASITE042389		Click to Show/Hide the Full List
mod site	chr19:54129137-54129138:+		[3]
Sequence	GCAGTGGGCGTGTGCGGCAGACACAGGTAAACGAGGCCACC
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000419967.5; ENST00000321030.9; ENST00000466404.5; ENST00000391755.1
External Link	RMBase: m6A_site_453748
mod ID: M6ASITE042390		Click to Show/Hide the Full List
mod site	chr19:54131435-54131436:+		[5]
Sequence	GCCTTATGTCCACCTGAATGACTGCGTGTGTCCAAGGTGGC
Motif Score	3.28175
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000321030.9; ENST00000466404.5; ENST00000419967.5; ENST00000391755.1
External Link	RMBase: m6A_site_453749
mod ID: M6ASITE042391		Click to Show/Hide the Full List
mod site	chr19:54131470-54131471:+		[6]
Sequence	GGTGGCTTCCCACTGAAGGGACACAGAGGTCCAGTCCTTCT
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T; A549
Seq Type List	m6A-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000321030.9; ENST00000419967.5; ENST00000391755.1; ENST00000466404.5
External Link	RMBase: m6A_site_453750
mod ID: M6ASITE042392		Click to Show/Hide the Full List
mod site	chr19:54131522-54131523:+		[6]
Sequence	ATCGGGTTCTGGCAGGGAGAACCTGCCCTGCCACTGGCCCC
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000466404.5; ENST00000419967.5; ENST00000391755.1; ENST00000321030.9
External Link	RMBase: m6A_site_453751
mod ID: M6ASITE042393		Click to Show/Hide the Full List
mod site	chr19:54131552-54131553:+		[6]
Sequence	CCACTGGCCCCATTGCTGGGACTGCCCAGGGAGGAGGCCTT
Motif Score	4.065041667
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000321030.9; ENST00000419967.5; ENST00000466404.5; ENST00000391755.1
External Link	RMBase: m6A_site_453752
mod ID: M6ASITE042394		Click to Show/Hide the Full List
mod site	chr19:54131601-54131602:+		[7]
Sequence	CCGGCCTGGCCTCCCCCAGGACCGAGATCACCGCCCAGTAT
Motif Score	3.622404762
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000466404.5; ENST00000321030.9; ENST00000419967.5; ENST00000391755.1
External Link	RMBase: m6A_site_453753
mod ID: M6ASITE042395		Click to Show/Hide the Full List
mod site	chr19:54131660-54131661:+		[8]
Sequence	ATCATGCCTTGTCTTTTTTAACTGAGAAAGGAGATTTTTTG
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000391755.1; ENST00000321030.9; ENST00000466404.5; ENST00000419967.5
External Link	RMBase: m6A_site_453754
mod ID: M6ASITE042396		Click to Show/Hide the Full List
mod site	chr19:54131689-54131690:+		[8]
Sequence	GGAGATTTTTTGAAAAGAGTACAATTAAAAGGACATTGTCA
Motif Score	2.856142857
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000391755.1; ENST00000466404.5; ENST00000321030.9; ENST00000419967.5
External Link	RMBase: m6A_site_453755
mod ID: M6ASITE042397		Click to Show/Hide the Full List
mod site	chr19:54131701-54131702:+		[3]
Sequence	AAAAGAGTACAATTAAAAGGACATTGTCAAGATCTGTCCTT
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000466404.5; ENST00000419967.5; ENST00000391755.1; ENST00000321030.9
External Link	RMBase: m6A_site_453756

Ref 1	m(6)A-induced lncRNA RP11 triggers the dissemination of colorectal cancer cells via upregulation of Zeb1. Mol Cancer. 2019 Apr 13;18(1):87. doi: 10.1186/s12943-019-1014-2.
Ref 2	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 3	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 4	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 5	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 2017 Nov;23(11):1369-1376. doi: 10.1038/nm.4416. Epub 2017 Sep 18.
Ref 8	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map