m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00144)

Target Name	NIFK antisense RNA 1 (NIFK-AS1)
Synonyms	NIFK-AS1 Click to Show/Hide
Gene Name	NIFK-AS1
Chromosomal Location	2q14.3
Family	Antisense RNAs
Gene ID	254128
HGNC ID	HGNC:27385

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

NIFK-AS1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RIP-seq result supporting the interaction between NIFK-AS1 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 7.43E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Identified the lncRNA NIFK antisense RNA 1 (NIFK-AS1) as being highly expressed in hepatocellular carcinoma tissues and cells, promotes disease progression and sorafenib resistance, and showed this up-regulation resulted from METTL3-dependent m6A methylation.
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Responsed Drug	Sorafenib		Approved	Drug Info
In-vitro Model	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
	MHCC97-H	Adult hepatocellular carcinoma	Homo sapiens	CVCL_4972
	THLE-3	Normal	Homo sapiens	CVCL_3804
In-vivo Model	For the PDX model, fresh patient HCC tissues were cut into fragments with a volume of 3 × 3 mm³ and then implanted subcutaneously into the flanks of nude mice. The mice were given sorafenib (30 mg/kg) or vehicle orally twice a week for 24 days. This procedure was approved by the Ethics Committee of Jinling Hospital.

Liver cancer [ICD-11: 2C12]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Identified the lncRNA NIFK antisense RNA 1 (NIFK-AS1) as being highly expressed in hepatocellular carcinoma tissues and cells, promotes disease progression and sorafenib resistance, and showed this up-regulation resulted from METTL3-dependent m6A methylation.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Sorafenib		Approved	Drug Info
In-vitro Model	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
	MHCC97-H	Adult hepatocellular carcinoma	Homo sapiens	CVCL_4972
	THLE-3	Normal	Homo sapiens	CVCL_3804
In-vivo Model	For the PDX model, fresh patient HCC tissues were cut into fragments with a volume of 3 × 3 mm³ and then implanted subcutaneously into the flanks of nude mice. The mice were given sorafenib (30 mg/kg) or vehicle orally twice a week for 24 days. This procedure was approved by the Ethics Committee of Jinling Hospital.

Sorafenib [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	Identified the lncRNA NIFK antisense RNA 1 (NIFK-AS1) as being highly expressed in hepatocellular carcinoma tissues and cells, promotes disease progression and sorafenib resistance, and showed this up-regulation resulted from METTL3-dependent m6A methylation.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
In-vitro Model	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
	MHCC97-H	Adult hepatocellular carcinoma	Homo sapiens	CVCL_4972
	THLE-3	Normal	Homo sapiens	CVCL_3804
In-vivo Model	For the PDX model, fresh patient HCC tissues were cut into fragments with a volume of 3 × 3 mm³ and then implanted subcutaneously into the flanks of nude mice. The mice were given sorafenib (30 mg/kg) or vehicle orally twice a week for 24 days. This procedure was approved by the Ethics Committee of Jinling Hospital.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05504		Crosstalk Info
Epigenetic Regulator	NIFK antisense RNA 1 (NIFK-AS1)
Regulated Target	MicroRNA 637 (MIR637)
Crosstalk relationship	m6A → ncRNA
Disease	Liver cancer	Disease Info
Drug	Sorafenib	Drug Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00144)

NIFK antisense RNA 1 (NIFK-AS1)

Adenosine-to-Inosine editing (A-to-I)

In total 10 m6A sequence/site(s) in this target gene
mod ID: A2ISITE009981		Click to Show/Hide the Full List
mod site	chr2:121651984-121651985:+		[2]
Sequence	AGAAATGCTTGAACCCAGGAAGTGGAGGTTGTGGTGAACGG
Transcript ID List	rmsk_658252; ENST00000419902.2
External Link	RMBase: RNA-editing_site_79908
mod ID: A2ISITE009982		Click to Show/Hide the Full List
mod site	chr2:121655747-121655748:+		[3]
Sequence	CACCCAGGCTAGCATGCAGTAGCACAATTACAGCTCACCAC
Transcript ID List	ENST00000419902.2
External Link	RMBase: RNA-editing_site_79909
mod ID: A2ISITE009983		Click to Show/Hide the Full List
mod site	chr2:121656478-121656479:+		[3]
Sequence	GCATGGTGATGAATGCCTGTAATCCCAACACTTTGGAAGGC
Transcript ID List	ENST00000419902.2; rmsk_658268
External Link	RMBase: RNA-editing_site_79910
mod ID: A2ISITE009984		Click to Show/Hide the Full List
mod site	chr2:121659303-121659304:+		[2]
Sequence	TTGGCATCAGGGCTGGGCGCAGTGGCTCAGGCCTGTAATCC
Transcript ID List	ENST00000419902.2; rmsk_658278
External Link	RMBase: RNA-editing_site_79911
mod ID: A2ISITE009985		Click to Show/Hide the Full List
mod site	chr2:121660909-121660910:+		[3]
Sequence	GTGTGGTGATGGGCGCCTGTAATCCCAGCTACTTGGGAGGC
Transcript ID List	ENST00000419902.2; rmsk_658284
External Link	RMBase: RNA-editing_site_79912
mod ID: A2ISITE009986		Click to Show/Hide the Full List
mod site	chr2:121660910-121660911:+		[3]
Sequence	TGTGGTGATGGGCGCCTGTAATCCCAGCTACTTGGGAGGCT
Transcript ID List	ENST00000419902.2; rmsk_658284
External Link	RMBase: RNA-editing_site_79913
mod ID: A2ISITE009987		Click to Show/Hide the Full List
mod site	chr2:121663412-121663413:+		[2]
Sequence	GTGGAGGTTGCAGTGAGCCAAGATCACGCCACTGCACTTCA
Transcript ID List	ENST00000419902.2; rmsk_658291
External Link	RMBase: RNA-editing_site_79914
mod ID: A2ISITE009988		Click to Show/Hide the Full List
mod site	chr2:121678604-121678605:+		[2]
Sequence	AGCAGTGGCTCACGCCTGTAATCCCAGCTCTTTAGGAGGCC
Transcript ID List	rmsk_658327; ENST00000419902.2
External Link	RMBase: RNA-editing_site_79915
mod ID: A2ISITE009989		Click to Show/Hide the Full List
mod site	chr2:121689191-121689192:+		[2]
Sequence	GCCTGTAGTCACAGCTACTCAGGAGACTGATGCAGGAGAAT
Transcript ID List	ENST00000624478.1; rmsk_658357; ENST00000419902.2
External Link	RMBase: RNA-editing_site_79916
mod ID: A2ISITE009990		Click to Show/Hide the Full List
mod site	chr2:121689570-121689571:+		[2]
Sequence	ATGTGCTTTGCACGCTCCCTATCTGCCAGGATCAGCTTGTT
Transcript ID List	ENST00000419902.2; ENST00000624478.1
External Link	RMBase: RNA-editing_site_79917

N6-methyladenosine (m6A)

In total 23 m6A sequence/site(s) in this target gene
mod ID: M6ASITE047303		Click to Show/Hide the Full List
mod site	chr2:121649806-121649807:+		[4]
Sequence	CCTTGGAAAGTTGCGACAAAACTCGAGTTAGACAAGGAAGG
Motif Score	2.627720238
Cell/Tissue List	HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000413904.6; ENST00000414554.6
External Link	RMBase: m6A_site_491196
mod ID: M6ASITE047304		Click to Show/Hide the Full List
mod site	chr2:121649817-121649818:+		[4]
Sequence	TGCGACAAAACTCGAGTTAGACAAGGAAGGTCGGAACTAAG
Motif Score	2.897386905
Cell/Tissue List	HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000414554.6; ENST00000413904.6
External Link	RMBase: m6A_site_491197
mod ID: M6ASITE047305		Click to Show/Hide the Full List
mod site	chr2:121649832-121649833:+		[5]
Sequence	GTTAGACAAGGAAGGTCGGAACTAAGTGGCCACAGCAACAA
Motif Score	3.373380952
Cell/Tissue List	HeLa; GM12878; HEK293A-TOA; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000413904.6; ENST00000414554.6
External Link	RMBase: m6A_site_491198
mod ID: M6ASITE047306		Click to Show/Hide the Full List
mod site	chr2:121649904-121649905:+		[5]
Sequence	AGCTAAAGAGGAATCGGGAAACCCTGGGTAAAAGTCGTCCA
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; H1A; GM12878; CD4T; HEK293A-TOA; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000413904.6; ENST00000414554.6
External Link	RMBase: m6A_site_491199
mod ID: M6ASITE047307		Click to Show/Hide the Full List
mod site	chr2:121650107-121650108:+		[5]
Sequence	GACGCTTGTGCCGGAAGTAAACTTGTTAACGGTTCTTTGCC
Motif Score	2.627720238
Cell/Tissue List	HeLa; peripheral-blood; TREX; MSC; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000447668.2; ENST00000439321.1; ENST00000419902.2; ENST00000413904.6; ENST00000414554.6
External Link	RMBase: m6A_site_491200
mod ID: M6ASITE047308		Click to Show/Hide the Full List
mod site	chr2:121650143-121650144:+		[5]
Sequence	TTGCCTTTTGGGGAGGGGAGACAGCCCAGAGAAGGCTTTGG
Motif Score	2.897386905
Cell/Tissue List	HeLa; peripheral-blood; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000439321.1; ENST00000419902.2; ENST00000414554.6; ENST00000447668.2; ENST00000413904.6
External Link	RMBase: m6A_site_491201
mod ID: M6ASITE047309		Click to Show/Hide the Full List
mod site	chr2:121650166-121650167:+		[5]
Sequence	GCCCAGAGAAGGCTTTGGAGACCCTTGAGTCGGCCAGCGAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000414554.6; ENST00000439321.1; ENST00000413904.6; ENST00000447668.2; ENST00000419902.2
External Link	RMBase: m6A_site_491202
mod ID: M6ASITE047310		Click to Show/Hide the Full List
mod site	chr2:121650503-121650504:+		[6]
Sequence	GTTTCCCAGCCTTGTCTCAAACTCCTGACCTCAAGTGATCC
Motif Score	2.627720238
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000413904.6; ENST00000447668.2; ENST00000419902.2; ENST00000439321.1; ENST00000414554.6
External Link	RMBase: m6A_site_491203
mod ID: M6ASITE047311		Click to Show/Hide the Full List
mod site	chr2:121650552-121650553:+		[7]
Sequence	GGGTCTTCGAAAGTGCTGGGACAGCAGGAGTGAGCCACCGC
Motif Score	3.643047619
Cell/Tissue List	peripheral-blood; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000447668.2; ENST00000439321.1; ENST00000419902.2; ENST00000413904.6; ENST00000414554.6
External Link	RMBase: m6A_site_491204
mod ID: M6ASITE047312		Click to Show/Hide the Full List
mod site	chr2:121650644-121650645:+		[5]
Sequence	GCCTTCAAGGATCCCGAAGGACCCACAGATTTGCCGCATCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; U2OS; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000413904.6; ENST00000414554.6; ENST00000439321.1; ENST00000419902.2; ENST00000447668.2
External Link	RMBase: m6A_site_491205
mod ID: M6ASITE047313		Click to Show/Hide the Full List
mod site	chr2:121650793-121650794:+		[5]
Sequence	TGGGAGAGAAGTGCGGGAGAACTATGAGATAATGCCCCCTG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000414554.6; ENST00000413904.6; ENST00000447668.2; ENST00000419902.2; ENST00000439321.1
External Link	RMBase: m6A_site_491206
mod ID: M6ASITE047314		Click to Show/Hide the Full List
mod site	chr2:121650933-121650934:+		[8]
Sequence	GATTTGAAAGAGTAGGGATGACATGGAGGATGCGACTCCTG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000419902.2; ENST00000413904.6; ENST00000447668.2; ENST00000439321.1; ENST00000414554.6
External Link	RMBase: m6A_site_491207
mod ID: M6ASITE047315		Click to Show/Hide the Full List
mod site	chr2:121650967-121650968:+		[5]
Sequence	ACTCCTGGTTGGATCTATAAACTAATGTCTTTGGAACGAAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000439321.1; ENST00000419902.2; ENST00000447668.2; ENST00000414554.6; ENST00000413904.6
External Link	RMBase: m6A_site_491208
mod ID: M6ASITE047316		Click to Show/Hide the Full List
mod site	chr2:121650990-121650991:+		[8]
Sequence	AATGTCTTTGGAACGAAAGCACATGCAACCTTTTGAAAATG
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000447668.2; ENST00000439321.1; ENST00000419902.2; ENST00000413904.6; ENST00000414554.6
External Link	RMBase: m6A_site_491209
mod ID: M6ASITE047317		Click to Show/Hide the Full List
mod site	chr2:121651029-121651030:+		[5]
Sequence	TGGATGGGTGATAATGAAAGACCATTCCAGAGAAGAAACAC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; CD8T; MM6; Huh7; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000414554.6; ENST00000419902.2; ENST00000439321.1; ENST00000447668.2; ENST00000413904.6
External Link	RMBase: m6A_site_491210
mod ID: M6ASITE047318		Click to Show/Hide the Full List
mod site	chr2:121651046-121651047:+		[5]
Sequence	AAGACCATTCCAGAGAAGAAACACCATGGTGCAAAGGCTCA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000413904.6; ENST00000439321.1; ENST00000414554.6; ENST00000447668.2; ENST00000419902.2
External Link	RMBase: m6A_site_491211
mod ID: M6ASITE047319		Click to Show/Hide the Full List
mod site	chr2:121651125-121651126:+		[5]
Sequence	CTGAAATGGGAAAAAAAGAAACAAAGAGTAAAAAGTAAGAT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000447668.2; ENST00000439321.1; ENST00000419902.2; ENST00000413904.6; ENST00000414554.6
External Link	RMBase: m6A_site_491212
mod ID: M6ASITE047320		Click to Show/Hide the Full List
mod site	chr2:121651293-121651294:+		[9]
Sequence	AATTCTTTTCATCTTGCAAAACAAACCCCGAACCCATTAAA
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hNPCs; GM12878; Huh7
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000447668.2; ENST00000439321.1; ENST00000413904.6; ENST00000414554.6; ENST00000419902.2
External Link	RMBase: m6A_site_491213
mod ID: M6ASITE047321		Click to Show/Hide the Full List
mod site	chr2:121651304-121651305:+		[9]
Sequence	TCTTGCAAAACAAACCCCGAACCCATTAAACAATTTCTCAT
Motif Score	2.930744048
Cell/Tissue List	HEK293T; hNPCs; GM12878; Huh7
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000414554.6; ENST00000419902.2; ENST00000447668.2; ENST00000413904.6; ENST00000439321.1
External Link	RMBase: m6A_site_491214
mod ID: M6ASITE047322		Click to Show/Hide the Full List
mod site	chr2:121651313-121651314:+		[9]
Sequence	ACAAACCCCGAACCCATTAAACAATTTCTCATTCGCCATTT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hNPCs; GM12878; Huh7
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000439321.1; ENST00000447668.2; ENST00000419902.2; ENST00000414554.6; ENST00000413904.6
External Link	RMBase: m6A_site_491215
mod ID: M6ASITE047323		Click to Show/Hide the Full List
mod site	chr2:121651511-121651512:+		[10]
Sequence	GAATTTCCTTCCCTTTTAAGACTAAATAATATTCCATTGTG
Motif Score	3.319380952
Cell/Tissue List	Huh7; AML
Seq Type List	MeRIP-seq; miCLIP
Transcript ID List	ENST00000413904.6; ENST00000414554.6; ENST00000447668.2; ENST00000419902.2; ENST00000439321.1
External Link	RMBase: m6A_site_491216
mod ID: M6ASITE047324		Click to Show/Hide the Full List
mod site	chr2:121705850-121705851:+		[9]
Sequence	CCAGCTCTTCCCCTTTCAAAACCAGAAAAGCCGCATGTTTA
Motif Score	2.185083333
Cell/Tissue List	hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000419902.2
External Link	RMBase: m6A_site_491217
mod ID: M6ASITE047325		Click to Show/Hide the Full List
mod site	chr2:121727820-121727821:+		[5]
Sequence	AGGATATGGGCTGTTTGAAAACTATTTCATCATCTTTATCA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000419902.2
External Link	RMBase: m6A_site_491240

Ref 1	Upregulation of lncRNA NIFK-AS1 in hepatocellular carcinoma by m(6)A methylation promotes disease progression and sorafenib resistance. Hum Cell. 2021 Nov;34(6):1800-1811. doi: 10.1007/s13577-021-00587-z. Epub 2021 Aug 10.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 4	The U6 snRNA m(6)A Methyltransferase METTL16 Regulates SAM Synthetase Intron Retention. Cell. 2017 May 18;169(5):824-835.e14. doi: 10.1016/j.cell.2017.05.003.
Ref 5	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 6	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 7	R-2HG Exhibits Anti-tumor Activity by Targeting FTO/m(6)A/MYC/CEBPA Signaling. Cell. 2018 Jan 11;172(1-2):90-105.e23. doi: 10.1016/j.cell.2017.11.031. Epub 2017 Dec 14.
Ref 8	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 9	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 10	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map