m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00098)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
HOXC13-AS
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Fat mass and obesity-associated protein (FTO) [ERASER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | FTO-stabilized HOXC13 antisense RNA (HOXC13-AS) epigenetically up-regulated FZD6 and activated Wnt/beta-catenin signaling to drive cervical cancer proliferation, invasion, and EMT, suggesting HOXC13-AS as a potential target for cervical cancer treatment. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Cervical cancer | ICD-11: 2C77 | ||
| Pathway Response | Wnt signaling pathway | hsa04310 | ||
| Cell Process | Cell proliferation | |||
| Cell invasion | ||||
| Epithelial-mesenchymal transition | ||||
| In-vitro Model | C-33 A | Cervical squamous cell carcinoma | Homo sapiens | CVCL_1094 |
| C-4-I | Cervical squamous cell carcinoma | Homo sapiens | CVCL_2253 | |
| Ect1/E6E7 | Normal | Homo sapiens | CVCL_3679 | |
| HeLa | Endocervical adenocarcinoma | Homo sapiens | CVCL_0030 | |
| SiHa | Cervical squamous cell carcinoma | Homo sapiens | CVCL_0032 | |
Cervical cancer [ICD-11: 2C77]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | FTO-stabilized HOXC13 antisense RNA (HOXC13-AS) epigenetically up-regulated FZD6 and activated Wnt/beta-catenin signaling to drive cervical cancer proliferation, invasion, and EMT, suggesting HOXC13-AS as a potential target for cervical cancer treatment. | |||
| Responsed Disease | Cervical cancer [ICD-11: 2C77] | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | Wnt signaling pathway | hsa04310 | ||
| Cell Process | Cell proliferation | |||
| Cell invasion | ||||
| Epithelial-mesenchymal transition | ||||
| In-vitro Model | C-33 A | Cervical squamous cell carcinoma | Homo sapiens | CVCL_1094 |
| C-4-I | Cervical squamous cell carcinoma | Homo sapiens | CVCL_2253 | |
| Ect1/E6E7 | Normal | Homo sapiens | CVCL_3679 | |
| HeLa | Endocervical adenocarcinoma | Homo sapiens | CVCL_0030 | |
| SiHa | Cervical squamous cell carcinoma | Homo sapiens | CVCL_0032 | |
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Fat mass and obesity-associated protein (FTO)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03068 | ||
| Epigenetic Regulator | CREB-binding protein (CREBBP) | |
| Regulated Target | Histone H3 lysine 27 acetylation (H3K27ac) | |
| Crosstalk relationship | m6A → Histone modification | |
| Disease | Cervical cancer | |
Non-coding RNA
m6A Regulator: Fat mass and obesity-associated protein (FTO)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05520 | ||
| Epigenetic Regulator | HOXC13 antisense RNA (HOXC13-AS) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Cervical cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00098)
| In total 12 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE012951 | Click to Show/Hide the Full List | ||
| mod site | chr12:53935600-53935601:- | [2] | |
| Sequence | CCCTCAGCTACAGCTCATGAACCAAGCTCTCGGCTAAGTTC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000512916.2 | ||
| External Link | RMBase: m6A_site_190646 | ||
| mod ID: M6ASITE012952 | Click to Show/Hide the Full List | ||
| mod site | chr12:53935655-53935656:- | [2] | |
| Sequence | TCGGCTGCTTTTTCAAAGGGACTTCTACAACCGCGGAGCGG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000512916.2 | ||
| External Link | RMBase: m6A_site_190647 | ||
| mod ID: M6ASITE012953 | Click to Show/Hide the Full List | ||
| mod site | chr12:53935864-53935865:- | [2] | |
| Sequence | TTCCAGGGCCTGGCGCTGAAACCCTCGGCTGCGGTGCTCAC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000512916.2 | ||
| External Link | RMBase: m6A_site_190648 | ||
| mod ID: M6ASITE012954 | Click to Show/Hide the Full List | ||
| mod site | chr12:53935957-53935958:- | [2] | |
| Sequence | CACAAGTAAAATCAAATTAAACACTCCAGGAGAATATGCAC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293A-TOA | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000512916.2 | ||
| External Link | RMBase: m6A_site_190649 | ||
| mod ID: M6ASITE012955 | Click to Show/Hide the Full List | ||
| mod site | chr12:53935978-53935979:- | [2] | |
| Sequence | AAAATGTGGATCTCGCTGAGACACAAGTAAAATCAAATTAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293A-TOA | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000512916.2 | ||
| External Link | RMBase: m6A_site_190650 | ||
| mod ID: M6ASITE012956 | Click to Show/Hide the Full List | ||
| mod site | chr12:53936157-53936158:- | [2] | |
| Sequence | CTTTTGCTTGGTTCCCCAAGACCTTTCGCGCCTGCAAACGC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000512916.2 | ||
| External Link | RMBase: m6A_site_190651 | ||
| mod ID: M6ASITE012957 | Click to Show/Hide the Full List | ||
| mod site | chr12:53936190-53936191:- | [2] | |
| Sequence | GGGAAGTCCGCTTGCTCTGAACAATTCCCTCTTCTTTTGCT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000512916.2 | ||
| External Link | RMBase: m6A_site_190652 | ||
| mod ID: M6ASITE012958 | Click to Show/Hide the Full List | ||
| mod site | chr12:53936299-53936300:- | [2] | |
| Sequence | TAGTCCTCTTCCTCAAGAAGACCAGCCGAAGTTGTAGGCCC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000512916.2 | ||
| External Link | RMBase: m6A_site_190653 | ||
| mod ID: M6ASITE012959 | Click to Show/Hide the Full List | ||
| mod site | chr12:53937283-53937284:- | [2] | |
| Sequence | GCAGCGCCTCGCTCAGCCAGACCTACTGCACCCCTCAAGTG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000512916.2 | ||
| External Link | RMBase: m6A_site_190654 | ||
| mod ID: M6ASITE012960 | Click to Show/Hide the Full List | ||
| mod site | chr12:53937317-53937318:- | [2] | |
| Sequence | CGTGTGCAGCCAGCGCACAGACCATGGCCACAGAGCAGCGC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000512916.2 | ||
| External Link | RMBase: m6A_site_190655 | ||
| mod ID: M6ASITE012961 | Click to Show/Hide the Full List | ||
| mod site | chr12:53939611-53939612:- | [2] | |
| Sequence | AGACTTCCAGAGGTGGGCGGACTGCGACTGCTCCTTGGAGC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; HEK293A-TOA | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000512916.2 | ||
| External Link | RMBase: m6A_site_190660 | ||
| mod ID: M6ASITE012962 | Click to Show/Hide the Full List | ||
| mod site | chr12:53939629-53939630:- | [2] | |
| Sequence | TTCCTTACCTGGGAAGGGAGACTTCCAGAGGTGGGCGGACT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; HEK293A-TOA | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000512916.2 | ||
| External Link | RMBase: m6A_site_190661 | ||
References