m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00088)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
LINC00958
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | HUVEC cell line | Homo sapiens |
|
Treatment: shMETTL3 HUVEC cells
Control: shScramble HUVEC cells
|
GSE157544 | |
| Regulation |
![]() ![]() |
logFC: -6.47E-01 p-value: 2.79E-03 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between LINC00958 and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 5.60E+00 | GSE60213 |
| In total 2 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Long intergenic non-protein coding RNA 958 (LINC00958) sponged miR-3619-5p to upregulate hepatoma-derived growth factor (HDGF) expression, thereby facilitating Hepatocellular carcinoma lipogenesis and progression. METTL3-mediated N6-methyladenosine modification led to LINC00958 upregulation through stabilizing its RNA transcript. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Hepatocellular carcinoma | ICD-11: 2C12.02 | ||
| Pathway Response | mRNA surveillance pathway | hsa03015 | ||
| Cell Process | RNA stability | |||
| Lipogenesis | ||||
| In-vitro Model | FOCUS | Adult hepatocellular carcinoma | Homo sapiens | CVCL_7955 |
| HCCLM3 | Adult hepatocellular carcinoma | Homo sapiens | CVCL_6832 | |
| HEp-2 | Endocervical adenocarcinoma | Homo sapiens | CVCL_1906 | |
| Hep 3B2.1-7 | Childhood hepatocellular carcinoma | Homo sapiens | CVCL_0326 | |
| Huh-7 | Adult hepatocellular carcinoma | Homo sapiens | CVCL_0336 | |
| MHCC97-H | Adult hepatocellular carcinoma | Homo sapiens | CVCL_4972 | |
| QSG-7701 | Endocervical adenocarcinoma | Homo sapiens | CVCL_6944 | |
| Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | m6A methyltransferase-like 3 (METTL3) gave rise to the upregulation of Long intergenic non-protein coding RNA 958 (LINC00958) by promoting its RNA transcript stability in breast cancer. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Pathway Response | mRNA surveillance pathway | hsa03015 | ||
| Cell Process | RNA transcript stability | |||
| In-vitro Model | BT-549 | Invasive breast carcinoma | Homo sapiens | CVCL_1092 |
| MCF-10A | Normal | Homo sapiens | CVCL_0598 | |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| MDA-MB-468 | Breast adenocarcinoma | Homo sapiens | CVCL_0419 | |
| In-vivo Model | MCF-7 cells transfected with sh-LINC00958 or empty vector were resuspended at 2 × 107 cells/mL. | |||
Protein virilizer homolog (VIRMA) [WRITER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [3] | |||
| Response Summary | Long intergenic non-protein coding RNA 958 (LINC00958) accelerated the aerobic glycolysis of GC cells. Mechanistically, KIAA1429 interacted with the m6A modification site and promoted the enrichment of LINC00958, and LINC00958 subsequently cooperated with GLUT1 mRNA to enhance its mRNA stability. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Gastric cancer | ICD-11: 2B72 | ||
| Cell Process | Glycolysis | |||
| In-vitro Model | SGC-7901 | Gastric carcinoma | Homo sapiens | CVCL_0520 |
| MKN45 | Gastric adenocarcinoma | Homo sapiens | CVCL_0434 | |
| GES-1 | Normal | Homo sapiens | CVCL_EQ22 | |
| BGC-823 | Gastric carcinoma | Homo sapiens | CVCL_3360 | |
| In-vivo Model | Ten four-week-old BALB/c nude mice were injected with LINC00958-overexpressing or vector-transfected cells. Briefly, 5 × 106 cells were subcutaneously injected in the flank of mice. Four weeks after injection, the mice were sacrificed and examined by weighting. | |||
Gastric cancer [ICD-11: 2B72]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [3] | |||
| Response Summary | Long intergenic non-protein coding RNA 958 (LINC00958) accelerated the aerobic glycolysis of GC cells. Mechanistically, KIAA1429 interacted with the m6A modification site and promoted the enrichment of LINC00958, and LINC00958 subsequently cooperated with GLUT1 mRNA to enhance its mRNA stability. | |||
| Responsed Disease | Gastric cancer [ICD-11: 2B72] | |||
| Target Regulator | Protein virilizer homolog (VIRMA) | WRITER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Glycolysis | |||
| In-vitro Model | SGC-7901 | Gastric carcinoma | Homo sapiens | CVCL_0520 |
| MKN45 | Gastric adenocarcinoma | Homo sapiens | CVCL_0434 | |
| GES-1 | Normal | Homo sapiens | CVCL_EQ22 | |
| BGC-823 | Gastric carcinoma | Homo sapiens | CVCL_3360 | |
| In-vivo Model | Ten four-week-old BALB/c nude mice were injected with LINC00958-overexpressing or vector-transfected cells. Briefly, 5 × 106 cells were subcutaneously injected in the flank of mice. Four weeks after injection, the mice were sacrificed and examined by weighting. | |||
Liver cancer [ICD-11: 2C12]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | Long intergenic non-protein coding RNA 958 (LINC00958) sponged miR-3619-5p to upregulate hepatoma-derived growth factor (HDGF) expression, thereby facilitating Hepatocellular carcinoma lipogenesis and progression. METTL3-mediated N6-methyladenosine modification led to LINC00958 upregulation through stabilizing its RNA transcript. | |||
| Responsed Disease | Hepatocellular carcinoma [ICD-11: 2C12.02] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | mRNA surveillance pathway | hsa03015 | ||
| Cell Process | RNA stability | |||
| Lipogenesis | ||||
| In-vitro Model | FOCUS | Adult hepatocellular carcinoma | Homo sapiens | CVCL_7955 |
| HCCLM3 | Adult hepatocellular carcinoma | Homo sapiens | CVCL_6832 | |
| HEp-2 | Endocervical adenocarcinoma | Homo sapiens | CVCL_1906 | |
| Hep 3B2.1-7 | Childhood hepatocellular carcinoma | Homo sapiens | CVCL_0326 | |
| Huh-7 | Adult hepatocellular carcinoma | Homo sapiens | CVCL_0336 | |
| MHCC97-H | Adult hepatocellular carcinoma | Homo sapiens | CVCL_4972 | |
| QSG-7701 | Endocervical adenocarcinoma | Homo sapiens | CVCL_6944 | |
Breast cancer [ICD-11: 2C60]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | m6A methyltransferase-like 3 (METTL3) gave rise to the upregulation of Long intergenic non-protein coding RNA 958 (LINC00958) by promoting its RNA transcript stability in breast cancer. | |||
| Responsed Disease | Breast cancer [ICD-11: 2C60] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | mRNA surveillance pathway | hsa03015 | ||
| Cell Process | RNA transcript stability | |||
| In-vitro Model | BT-549 | Invasive breast carcinoma | Homo sapiens | CVCL_1092 |
| MCF-10A | Normal | Homo sapiens | CVCL_0598 | |
| MCF-7 | Invasive breast carcinoma | Homo sapiens | CVCL_0031 | |
| MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 | |
| MDA-MB-468 | Breast adenocarcinoma | Homo sapiens | CVCL_0419 | |
| In-vivo Model | MCF-7 cells transfected with sh-LINC00958 or empty vector were resuspended at 2 × 107 cells/mL. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 2 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05412 | ||
| Epigenetic Regulator | Long intergenic non-protein coding RNA 958 (LINC00958) | |
| Regulated Target | Hepatoma-derived growth factor (HDGF) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Liver cancer | |
| Crosstalk ID: M6ACROT05471 | ||
| Epigenetic Regulator | Long intergenic non-protein coding RNA 958 (LINC00958) | |
| Regulated Target | hsa-miR-378a-3p | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Breast cancer | |
m6A Regulator: Protein virilizer homolog (VIRMA)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05614 | ||
| Epigenetic Regulator | Long intergenic non-protein coding RNA 958 (LINC00958) | |
| Regulated Target | Solute carrier family 2 member 1 (SLC2A1) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Gastric cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00088)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE005093 | Click to Show/Hide the Full List | ||
| mod site | chr11:12965192-12965193:- | [4] | |
| Sequence | GTCTTGCTCTGTCACCCAGGCTGGAGTGCAGTGACACAATG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000527945.2 | ||
| External Link | RMBase: m5C_site_7010 | ||
N6-methyladenosine (m6A)
| In total 33 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE004173 | Click to Show/Hide the Full List | ||
| mod site | chr11:12961949-12961950:- | [5] | |
| Sequence | CCAACAAATATTTCTTAAAAACCAACCATTGAAACGTAATG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000527945.2 | ||
| External Link | RMBase: m6A_site_132449 | ||
| mod ID: M6ASITE004174 | Click to Show/Hide the Full List | ||
| mod site | chr11:12962175-12962176:- | [6] | |
| Sequence | GTTGCCCAGGCTTGTCTCAAACTCCTGGGCTCAAGTGATCC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | U2OS; Huh7; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000527945.2 | ||
| External Link | RMBase: m6A_site_132450 | ||
| mod ID: M6ASITE004175 | Click to Show/Hide the Full List | ||
| mod site | chr11:12962226-12962227:- | [6] | |
| Sequence | CATGCCAGCTAATTTTTAAAACTGTTTTTAGGGATGGGGTC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | U2OS; Huh7; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000527945.2 | ||
| External Link | RMBase: m6A_site_132451 | ||
| mod ID: M6ASITE004176 | Click to Show/Hide the Full List | ||
| mod site | chr11:12962264-12962265:- | [6] | |
| Sequence | GAGCCTCCCGAGTAGCTGGGACTACAGATGCACACCACCAT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | U2OS; Huh7; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000527945.2 | ||
| External Link | RMBase: m6A_site_132452 | ||
| mod ID: M6ASITE004177 | Click to Show/Hide the Full List | ||
| mod site | chr11:12962313-12962314:- | [6] | |
| Sequence | ACGGCTCACTACAGCCTTGAACTCCCGGGCTCAGGTGATCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | U2OS; Huh7; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000527945.2 | ||
| External Link | RMBase: m6A_site_132453 | ||
| mod ID: M6ASITE004178 | Click to Show/Hide the Full List | ||
| mod site | chr11:12962532-12962533:- | [6] | |
| Sequence | GAGCTCTCGCGCAGGCCCAGACCACTTTATAAGCCATATTT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | U2OS; Huh7; endometrial; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000527945.2 | ||
| External Link | RMBase: m6A_site_132454 | ||
| mod ID: M6ASITE004179 | Click to Show/Hide the Full List | ||
| mod site | chr11:12962653-12962654:- | [7] | |
| Sequence | AGGGGAGAGGCAAGGAGTGGACATGAGCACGGAGGATCCAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HepG2; HeLa; Huh7; HEK293T; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000527945.2 | ||
| External Link | RMBase: m6A_site_132455 | ||
| mod ID: M6ASITE004180 | Click to Show/Hide the Full List | ||
| mod site | chr11:12962710-12962711:- | [7] | |
| Sequence | TGATTCAGCACCTGGAGAAGACCGGCAACAGGGCTGAGTTT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HepG2; HeLa; Huh7; HEK293T; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000527945.2 | ||
| External Link | RMBase: m6A_site_132456 | ||
| mod ID: M6ASITE004181 | Click to Show/Hide the Full List | ||
| mod site | chr11:12979658-12979659:- | [8] | |
| Sequence | AACAAGCAAACAAACAAAAAACACGGGAGGAGCAATAAAAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; Huh7; HEK293A-TOA; iSLK; endometrial; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000504230.2; rmsk_3479473; ENST00000527945.2 | ||
| External Link | RMBase: m6A_site_132457 | ||
| mod ID: M6ASITE004182 | Click to Show/Hide the Full List | ||
| mod site | chr11:12979669-12979670:- | [8] | |
| Sequence | TAAAAAAAACAAACAAGCAAACAAACAAAAAACACGGGAGG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; Huh7; HEK293A-TOA; iSLK; endometrial; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000527945.2; rmsk_3479473; ENST00000504230.2 | ||
| External Link | RMBase: m6A_site_132458 | ||
| mod ID: M6ASITE004183 | Click to Show/Hide the Full List | ||
| mod site | chr11:12979681-12979682:- | [8] | |
| Sequence | CGAAACTCCATCTAAAAAAAACAAACAAGCAAACAAACAAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; endometrial; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000504230.2; ENST00000527945.2; rmsk_3479473 | ||
| External Link | RMBase: m6A_site_132459 | ||
| mod ID: M6ASITE004184 | Click to Show/Hide the Full List | ||
| mod site | chr11:12979697-12979698:- | [8] | |
| Sequence | GCCTGGGCAACAAGAGCGAAACTCCATCTAAAAAAAACAAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; endometrial; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | rmsk_3479473; ENST00000504230.2; ENST00000527945.2 | ||
| External Link | RMBase: m6A_site_132460 | ||
| mod ID: M6ASITE004185 | Click to Show/Hide the Full List | ||
| mod site | chr11:12979767-12979768:- | [8] | |
| Sequence | GAGGCAGCAGAATCGCTTGAACCCAGGAGGCAGAGGTTGCA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000527945.2; rmsk_3479473; ENST00000504230.2 | ||
| External Link | RMBase: m6A_site_132461 | ||
| mod ID: M6ASITE004186 | Click to Show/Hide the Full List | ||
| mod site | chr11:12979865-12979866:- | [8] | |
| Sequence | AGCCTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000504230.2; ENST00000527945.2; rmsk_3479473 | ||
| External Link | RMBase: m6A_site_132462 | ||
| mod ID: M6ASITE004187 | Click to Show/Hide the Full List | ||
| mod site | chr11:12979888-12979889:- | [8] | |
| Sequence | CCTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | rmsk_3479473; ENST00000504230.2; ENST00000527945.2 | ||
| External Link | RMBase: m6A_site_132463 | ||
| mod ID: M6ASITE004188 | Click to Show/Hide the Full List | ||
| mod site | chr11:12979984-12979985:- | [7] | |
| Sequence | AGGTGGTAGGGAAGACAAAAACATGGGAGGAGCAGCTGGGC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HepG2; HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000527945.2; ENST00000504230.2 | ||
| External Link | RMBase: m6A_site_132464 | ||
| mod ID: M6ASITE004189 | Click to Show/Hide the Full List | ||
| mod site | chr11:12979990-12979991:- | [7] | |
| Sequence | CATCAGAGGTGGTAGGGAAGACAAAAACATGGGAGGAGCAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HepG2; HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000527945.2; ENST00000504230.2 | ||
| External Link | RMBase: m6A_site_132465 | ||
| mod ID: M6ASITE004190 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980020-12980021:- | [7] | |
| Sequence | CCAACCAAAAAAAAAAAAAAACTGTGGGTTCATCAGAGGTG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HepG2; HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000527945.2; ENST00000504230.2 | ||
| External Link | RMBase: m6A_site_132466 | ||
| mod ID: M6ASITE004191 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980048-12980049:- | [7] | |
| Sequence | AAAAAAAACAGAAGCTTCAAACAAACAACCAACCAAAAAAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HepG2; HeLa; U2OS; HEK293T; Huh7; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000504230.2; ENST00000527945.2; ENST00000532541.5 | ||
| External Link | RMBase: m6A_site_132467 | ||
| mod ID: M6ASITE004192 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980061-12980062:- | [7] | |
| Sequence | AGAGAGGAAGCTCAAAAAAAACAGAAGCTTCAAACAAACAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HepG2; HeLa; U2OS; HEK293T; Huh7; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000532541.5; ENST00000504230.2; ENST00000527945.2 | ||
| External Link | RMBase: m6A_site_132468 | ||
| mod ID: M6ASITE004193 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980093-12980094:- | [7] | |
| Sequence | TTTCCCCCCTGAGTGGAGAGACTCAGCTACCAAGAGAGGAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HepG2; HeLa; U2OS; HEK293T; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000532541.5; ENST00000504230.2; ENST00000527945.2 | ||
| External Link | RMBase: m6A_site_132469 | ||
| mod ID: M6ASITE004194 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980154-12980155:- | [8] | |
| Sequence | AGTTATCATTGCAGGTTAAGACATTTCTACAAATATTTCGA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A | ||
| Seq Type List | MeRIP-seq; MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000527945.2; ENST00000504230.2; ENST00000532541.5 | ||
| External Link | RMBase: m6A_site_132470 | ||
| mod ID: M6ASITE004195 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980203-12980204:- | [8] | |
| Sequence | GCTGGAGTGTGTGTGAGTGAACCACTAAGGAATCAGATAGT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; U2OS; HEK293T; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000527945.2; ENST00000504230.2; ENST00000532541.5 | ||
| External Link | RMBase: m6A_site_132471 | ||
| mod ID: M6ASITE004196 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980231-12980232:- | [8] | |
| Sequence | CTTAAAACTCACATAGAGAAACAACTTTGCTGGAGTGTGTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A | ||
| Seq Type List | MeRIP-seq; MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000532541.5; ENST00000527945.2; ENST00000534477.5; ENST00000504230.2 | ||
| External Link | RMBase: m6A_site_132472 | ||
| mod ID: M6ASITE004197 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980245-12980246:- | [8] | |
| Sequence | CTGATAAGCAGAGCCTTAAAACTCACATAGAGAAACAACTT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000527945.2; ENST00000504230.2; ENST00000532541.5; ENST00000534477.5 | ||
| External Link | RMBase: m6A_site_132473 | ||
| mod ID: M6ASITE004198 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980312-12980313:- | [8] | |
| Sequence | CAAAGGTTACCTGTGGGAAAACTTCTTTTTCTATGCTGAAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000527945.2; ENST00000504230.2; ENST00000534477.5; ENST00000532541.5 | ||
| External Link | RMBase: m6A_site_132474 | ||
| mod ID: M6ASITE004199 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980671-12980672:- | [8] | |
| Sequence | CAGGTAGCTTCTTCAGGAGAACAGCCCTCTGAGGAGGCAGG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000529328.1; ENST00000534477.5; ENST00000531402.5; ENST00000532541.5; ENST00000527945.2; ENST00000504230.2; ENST00000526388.1 | ||
| External Link | RMBase: m6A_site_132475 | ||
| mod ID: M6ASITE004200 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980706-12980707:- | [7] | |
| Sequence | ATCACTCCTGCAGTTTCTGAACACTACACAGACGCCAGGTA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HepG2; HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000504230.2; ENST00000532541.5; ENST00000534477.5; ENST00000527945.2; ENST00000529328.1; ENST00000526388.1; ENST00000531402.5 | ||
| External Link | RMBase: m6A_site_132476 | ||
| mod ID: M6ASITE004201 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980813-12980814:- | [8] | |
| Sequence | TGAGGACTCTTGTGACCAGGACAACAGGGAAGCTTGCAGCA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A | ||
| Seq Type List | MeRIP-seq; MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000532541.5; ENST00000504230.2; ENST00000529328.1; ENST00000527945.2; ENST00000526388.1; ENST00000531402.5; ENST00000534477.5 | ||
| External Link | RMBase: m6A_site_132477 | ||
| mod ID: M6ASITE004202 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980828-12980829:- | [8] | |
| Sequence | GATTTTGAGAACAACTGAGGACTCTTGTGACCAGGACAACA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000526388.1; ENST00000529328.1; ENST00000504230.2; ENST00000531402.5; ENST00000532541.5; ENST00000534477.5; ENST00000527945.2 | ||
| External Link | RMBase: m6A_site_132478 | ||
| mod ID: M6ASITE004203 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980838-12980839:- | [8] | |
| Sequence | TTTCTTCCACGATTTTGAGAACAACTGAGGACTCTTGTGAC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A | ||
| Seq Type List | MeRIP-seq; MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000504230.2; ENST00000532541.5; ENST00000534477.5; ENST00000529328.1; ENST00000526388.1; ENST00000531402.5; ENST00000527945.2 | ||
| External Link | RMBase: m6A_site_132479 | ||
| mod ID: M6ASITE004204 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980862-12980863:- | [8] | |
| Sequence | TGAGTTTTCAAGTATAAAAGACTTTTTCTTCCACGATTTTG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000527945.2; ENST00000526388.1; ENST00000531402.5; ENST00000529328.1; ENST00000532541.5; ENST00000534477.5; ENST00000504230.2 | ||
| External Link | RMBase: m6A_site_132480 | ||
| mod ID: M6ASITE004205 | Click to Show/Hide the Full List | ||
| mod site | chr11:12980950-12980951:- | [8] | |
| Sequence | TCAGAAGATTCTATGAGGAAACCCATTTAAAAATAGGATGC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293A-TOA; iSLK; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000529328.1; ENST00000526388.1; ENST00000532541.5; ENST00000527945.2; ENST00000531402.5; ENST00000534477.5; ENST00000504230.2 | ||
| External Link | RMBase: m6A_site_132481 | ||
References

