m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00088)
Target Name Long intergenic non-protein coding RNA 958 (LINC00958)
Synonyms
LINC00958
    Click to Show/Hide
Gene Name LINC00958
Chromosomal Location 11p15.3
Family Long intergenic non-protein coding RNAs
Gene ID 100506305
HGNC ID
HGNC:48671
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
LINC00958 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line HUVEC cell line Homo sapiens
Treatment: shMETTL3 HUVEC cells
Control: shScramble HUVEC cells
 GSE157544
Regulation
logFC: -6.47E-01
p-value: 2.79E-03
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between LINC00958 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 5.60E+00 GSE60213
In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Long intergenic non-protein coding RNA 958 (LINC00958) sponged miR-3619-5p to upregulate hepatoma-derived growth factor (HDGF) expression, thereby facilitating Hepatocellular carcinoma lipogenesis and progression. METTL3-mediated N6-methyladenosine modification led to LINC00958 upregulation through stabilizing its RNA transcript.
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Pathway Response mRNA surveillance pathway hsa03015
Cell Process RNA stability
Lipogenesis
In-vitro Model FOCUS Adult hepatocellular carcinoma Homo sapiens CVCL_7955
HCCLM3 Adult hepatocellular carcinoma Homo sapiens CVCL_6832
HEp-2 Endocervical adenocarcinoma Homo sapiens CVCL_1906
Hep 3B2.1-7 Childhood hepatocellular carcinoma Homo sapiens CVCL_0326
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
MHCC97-H Adult hepatocellular carcinoma Homo sapiens CVCL_4972
QSG-7701 Endocervical adenocarcinoma Homo sapiens CVCL_6944
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary m6A methyltransferase-like 3 (METTL3) gave rise to the upregulation of Long intergenic non-protein coding RNA 958 (LINC00958) by promoting its RNA transcript stability in breast cancer.
Target Regulation Up regulation
Responsed Disease Breast cancer ICD-11: 2C60
 Disease Info 
Pathway Response mRNA surveillance pathway hsa03015
Cell Process RNA transcript stability
In-vitro Model BT-549 Invasive breast carcinoma Homo sapiens CVCL_1092
MCF-10A Normal Homo sapiens CVCL_0598
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
MDA-MB-231 Breast adenocarcinoma Homo sapiens CVCL_0062
MDA-MB-468 Breast adenocarcinoma Homo sapiens CVCL_0419
In-vivo Model MCF-7 cells transfected with sh-LINC00958 or empty vector were resuspended at 2 × 107 cells/mL.
Protein virilizer homolog (VIRMA) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [3]
Response Summary Long intergenic non-protein coding RNA 958 (LINC00958) accelerated the aerobic glycolysis of GC cells. Mechanistically, KIAA1429 interacted with the m6A modification site and promoted the enrichment of LINC00958, and LINC00958 subsequently cooperated with GLUT1 mRNA to enhance its mRNA stability.
Target Regulation Up regulation
Responsed Disease Gastric cancer ICD-11: 2B72
 Disease Info 
Cell Process Glycolysis
In-vitro Model SGC-7901 Gastric carcinoma Homo sapiens CVCL_0520
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
GES-1 Normal Homo sapiens CVCL_EQ22
BGC-823 Gastric carcinoma Homo sapiens CVCL_3360
In-vivo Model Ten four-week-old BALB/c nude mice were injected with LINC00958-overexpressing or vector-transfected cells. Briefly, 5 × 106 cells were subcutaneously injected in the flank of mice. Four weeks after injection, the mice were sacrificed and examined by weighting.
Gastric cancer [ICD-11: 2B72]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [3]
Response Summary Long intergenic non-protein coding RNA 958 (LINC00958) accelerated the aerobic glycolysis of GC cells. Mechanistically, KIAA1429 interacted with the m6A modification site and promoted the enrichment of LINC00958, and LINC00958 subsequently cooperated with GLUT1 mRNA to enhance its mRNA stability.
Responsed Disease Gastric cancer [ICD-11: 2B72]
Target Regulator Protein virilizer homolog (VIRMA) WRITER
 Regulator Info 
Target Regulation Up regulation
Cell Process Glycolysis
In-vitro Model SGC-7901 Gastric carcinoma Homo sapiens CVCL_0520
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
GES-1 Normal Homo sapiens CVCL_EQ22
BGC-823 Gastric carcinoma Homo sapiens CVCL_3360
In-vivo Model Ten four-week-old BALB/c nude mice were injected with LINC00958-overexpressing or vector-transfected cells. Briefly, 5 × 106 cells were subcutaneously injected in the flank of mice. Four weeks after injection, the mice were sacrificed and examined by weighting.
Liver cancer [ICD-11: 2C12]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Long intergenic non-protein coding RNA 958 (LINC00958) sponged miR-3619-5p to upregulate hepatoma-derived growth factor (HDGF) expression, thereby facilitating Hepatocellular carcinoma lipogenesis and progression. METTL3-mediated N6-methyladenosine modification led to LINC00958 upregulation through stabilizing its RNA transcript.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response mRNA surveillance pathway hsa03015
Cell Process RNA stability
Lipogenesis
In-vitro Model FOCUS Adult hepatocellular carcinoma Homo sapiens CVCL_7955
HCCLM3 Adult hepatocellular carcinoma Homo sapiens CVCL_6832
HEp-2 Endocervical adenocarcinoma Homo sapiens CVCL_1906
Hep 3B2.1-7 Childhood hepatocellular carcinoma Homo sapiens CVCL_0326
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
MHCC97-H Adult hepatocellular carcinoma Homo sapiens CVCL_4972
QSG-7701 Endocervical adenocarcinoma Homo sapiens CVCL_6944
Breast cancer [ICD-11: 2C60]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary m6A methyltransferase-like 3 (METTL3) gave rise to the upregulation of Long intergenic non-protein coding RNA 958 (LINC00958) by promoting its RNA transcript stability in breast cancer.
Responsed Disease Breast cancer [ICD-11: 2C60]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response mRNA surveillance pathway hsa03015
Cell Process RNA transcript stability
In-vitro Model BT-549 Invasive breast carcinoma Homo sapiens CVCL_1092
MCF-10A Normal Homo sapiens CVCL_0598
MCF-7 Invasive breast carcinoma Homo sapiens CVCL_0031
MDA-MB-231 Breast adenocarcinoma Homo sapiens CVCL_0062
MDA-MB-468 Breast adenocarcinoma Homo sapiens CVCL_0419
In-vivo Model MCF-7 cells transfected with sh-LINC00958 or empty vector were resuspended at 2 × 107 cells/mL.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05412
 Crosstalk Info 
Epigenetic Regulator Long intergenic non-protein coding RNA 958 (LINC00958)
Regulated Target Hepatoma-derived growth factor (HDGF)
Crosstalk relationship m6A → ncRNA
Disease Liver cancer
 Disease Info 
Crosstalk ID: M6ACROT05471
 Crosstalk Info 
Epigenetic Regulator Long intergenic non-protein coding RNA 958 (LINC00958)
Regulated Target hsa-miR-378a-3p
Crosstalk relationship m6A → ncRNA
Disease Breast cancer
 Disease Info 
m6A Regulator: Protein virilizer homolog (VIRMA)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05614
 Crosstalk Info 
Epigenetic Regulator Long intergenic non-protein coding RNA 958 (LINC00958)
Regulated Target Solute carrier family 2 member 1 (SLC2A1)
Crosstalk relationship m6A → ncRNA
Disease Gastric cancer
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00088)
Long intergenic non-protein coding RNA 958 (LINC00958)
5-methylcytidine (m5C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE005093 Click to Show/Hide the Full List
mod site chr11:12965192-12965193:- [4]
Sequence GTCTTGCTCTGTCACCCAGGCTGGAGTGCAGTGACACAATG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000527945.2
External Link RMBase: m5C_site_7010
N6-methyladenosine (m6A)
In total 33 m6A sequence/site(s) in this target gene
mod ID: M6ASITE004173 Click to Show/Hide the Full List
mod site chr11:12961949-12961950:- [5]
Sequence CCAACAAATATTTCTTAAAAACCAACCATTGAAACGTAATG
Motif Score 2.185083333
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000527945.2
External Link RMBase: m6A_site_132449
mod ID: M6ASITE004174 Click to Show/Hide the Full List
mod site chr11:12962175-12962176:- [6]
Sequence GTTGCCCAGGCTTGTCTCAAACTCCTGGGCTCAAGTGATCC
Motif Score 2.627720238
Cell/Tissue List U2OS; Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000527945.2
External Link RMBase: m6A_site_132450
mod ID: M6ASITE004175 Click to Show/Hide the Full List
mod site chr11:12962226-12962227:- [6]
Sequence CATGCCAGCTAATTTTTAAAACTGTTTTTAGGGATGGGGTC
Motif Score 2.627720238
Cell/Tissue List U2OS; Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000527945.2
External Link RMBase: m6A_site_132451
mod ID: M6ASITE004176 Click to Show/Hide the Full List
mod site chr11:12962264-12962265:- [6]
Sequence GAGCCTCCCGAGTAGCTGGGACTACAGATGCACACCACCAT
Motif Score 4.065041667
Cell/Tissue List U2OS; Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000527945.2
External Link RMBase: m6A_site_132452
mod ID: M6ASITE004177 Click to Show/Hide the Full List
mod site chr11:12962313-12962314:- [6]
Sequence ACGGCTCACTACAGCCTTGAACTCCCGGGCTCAGGTGATCC
Motif Score 3.373380952
Cell/Tissue List U2OS; Huh7; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000527945.2
External Link RMBase: m6A_site_132453
mod ID: M6ASITE004178 Click to Show/Hide the Full List
mod site chr11:12962532-12962533:- [6]
Sequence GAGCTCTCGCGCAGGCCCAGACCACTTTATAAGCCATATTT
Motif Score 2.876744048
Cell/Tissue List U2OS; Huh7; endometrial; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000527945.2
External Link RMBase: m6A_site_132454
mod ID: M6ASITE004179 Click to Show/Hide the Full List
mod site chr11:12962653-12962654:- [7]
Sequence AGGGGAGAGGCAAGGAGTGGACATGAGCACGGAGGATCCAG
Motif Score 3.643047619
Cell/Tissue List HepG2; HeLa; Huh7; HEK293T; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000527945.2
External Link RMBase: m6A_site_132455
mod ID: M6ASITE004180 Click to Show/Hide the Full List
mod site chr11:12962710-12962711:- [7]
Sequence TGATTCAGCACCTGGAGAAGACCGGCAACAGGGCTGAGTTT
Motif Score 2.876744048
Cell/Tissue List HepG2; HeLa; Huh7; HEK293T; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000527945.2
External Link RMBase: m6A_site_132456
mod ID: M6ASITE004181 Click to Show/Hide the Full List
mod site chr11:12979658-12979659:- [8]
Sequence AACAAGCAAACAAACAAAAAACACGGGAGGAGCAATAAAAA
Motif Score 2.20572619
Cell/Tissue List HeLa; Huh7; HEK293A-TOA; iSLK; endometrial; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000504230.2; rmsk_3479473; ENST00000527945.2
External Link RMBase: m6A_site_132457
mod ID: M6ASITE004182 Click to Show/Hide the Full List
mod site chr11:12979669-12979670:- [8]
Sequence TAAAAAAAACAAACAAGCAAACAAACAAAAAACACGGGAGG
Motif Score 2.20572619
Cell/Tissue List HeLa; Huh7; HEK293A-TOA; iSLK; endometrial; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000527945.2; rmsk_3479473; ENST00000504230.2
External Link RMBase: m6A_site_132458
mod ID: M6ASITE004183 Click to Show/Hide the Full List
mod site chr11:12979681-12979682:- [8]
Sequence CGAAACTCCATCTAAAAAAAACAAACAAGCAAACAAACAAA
Motif Score 2.20572619
Cell/Tissue List HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; endometrial; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000504230.2; ENST00000527945.2; rmsk_3479473
External Link RMBase: m6A_site_132459
mod ID: M6ASITE004184 Click to Show/Hide the Full List
mod site chr11:12979697-12979698:- [8]
Sequence GCCTGGGCAACAAGAGCGAAACTCCATCTAAAAAAAACAAA
Motif Score 2.627720238
Cell/Tissue List HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; endometrial; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List rmsk_3479473; ENST00000504230.2; ENST00000527945.2
External Link RMBase: m6A_site_132460
mod ID: M6ASITE004185 Click to Show/Hide the Full List
mod site chr11:12979767-12979768:- [8]
Sequence GAGGCAGCAGAATCGCTTGAACCCAGGAGGCAGAGGTTGCA
Motif Score 2.930744048
Cell/Tissue List HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000527945.2; rmsk_3479473; ENST00000504230.2
External Link RMBase: m6A_site_132461
mod ID: M6ASITE004186 Click to Show/Hide the Full List
mod site chr11:12979865-12979866:- [8]
Sequence AGCCTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATA
Motif Score 2.185083333
Cell/Tissue List HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000504230.2; ENST00000527945.2; rmsk_3479473
External Link RMBase: m6A_site_132462
mod ID: M6ASITE004187 Click to Show/Hide the Full List
mod site chr11:12979888-12979889:- [8]
Sequence CCTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTG
Motif Score 2.876744048
Cell/Tissue List HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List rmsk_3479473; ENST00000504230.2; ENST00000527945.2
External Link RMBase: m6A_site_132463
mod ID: M6ASITE004188 Click to Show/Hide the Full List
mod site chr11:12979984-12979985:- [7]
Sequence AGGTGGTAGGGAAGACAAAAACATGGGAGGAGCAGCTGGGC
Motif Score 2.20572619
Cell/Tissue List HepG2; HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000527945.2; ENST00000504230.2
External Link RMBase: m6A_site_132464
mod ID: M6ASITE004189 Click to Show/Hide the Full List
mod site chr11:12979990-12979991:- [7]
Sequence CATCAGAGGTGGTAGGGAAGACAAAAACATGGGAGGAGCAG
Motif Score 2.897386905
Cell/Tissue List HepG2; HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000527945.2; ENST00000504230.2
External Link RMBase: m6A_site_132465
mod ID: M6ASITE004190 Click to Show/Hide the Full List
mod site chr11:12980020-12980021:- [7]
Sequence CCAACCAAAAAAAAAAAAAAACTGTGGGTTCATCAGAGGTG
Motif Score 2.627720238
Cell/Tissue List HepG2; HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000527945.2; ENST00000504230.2
External Link RMBase: m6A_site_132466
mod ID: M6ASITE004191 Click to Show/Hide the Full List
mod site chr11:12980048-12980049:- [7]
Sequence AAAAAAAACAGAAGCTTCAAACAAACAACCAACCAAAAAAA
Motif Score 2.20572619
Cell/Tissue List HepG2; HeLa; U2OS; HEK293T; Huh7; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000504230.2; ENST00000527945.2; ENST00000532541.5
External Link RMBase: m6A_site_132467
mod ID: M6ASITE004192 Click to Show/Hide the Full List
mod site chr11:12980061-12980062:- [7]
Sequence AGAGAGGAAGCTCAAAAAAAACAGAAGCTTCAAACAAACAA
Motif Score 2.20572619
Cell/Tissue List HepG2; HeLa; U2OS; HEK293T; Huh7; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000532541.5; ENST00000504230.2; ENST00000527945.2
External Link RMBase: m6A_site_132468
mod ID: M6ASITE004193 Click to Show/Hide the Full List
mod site chr11:12980093-12980094:- [7]
Sequence TTTCCCCCCTGAGTGGAGAGACTCAGCTACCAAGAGAGGAA
Motif Score 3.319380952
Cell/Tissue List HepG2; HeLa; U2OS; HEK293T; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000532541.5; ENST00000504230.2; ENST00000527945.2
External Link RMBase: m6A_site_132469
mod ID: M6ASITE004194 Click to Show/Hide the Full List
mod site chr11:12980154-12980155:- [8]
Sequence AGTTATCATTGCAGGTTAAGACATTTCTACAAATATTTCGA
Motif Score 2.897386905
Cell/Tissue List HeLa; hESC-HEK293T; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A
Seq Type List MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List ENST00000527945.2; ENST00000504230.2; ENST00000532541.5
External Link RMBase: m6A_site_132470
mod ID: M6ASITE004195 Click to Show/Hide the Full List
mod site chr11:12980203-12980204:- [8]
Sequence GCTGGAGTGTGTGTGAGTGAACCACTAAGGAATCAGATAGT
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; U2OS; HEK293T; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000527945.2; ENST00000504230.2; ENST00000532541.5
External Link RMBase: m6A_site_132471
mod ID: M6ASITE004196 Click to Show/Hide the Full List
mod site chr11:12980231-12980232:- [8]
Sequence CTTAAAACTCACATAGAGAAACAACTTTGCTGGAGTGTGTG
Motif Score 2.20572619
Cell/Tissue List HeLa; hESC-HEK293T; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A
Seq Type List MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List ENST00000532541.5; ENST00000527945.2; ENST00000534477.5; ENST00000504230.2
External Link RMBase: m6A_site_132472
mod ID: M6ASITE004197 Click to Show/Hide the Full List
mod site chr11:12980245-12980246:- [8]
Sequence CTGATAAGCAGAGCCTTAAAACTCACATAGAGAAACAACTT
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000527945.2; ENST00000504230.2; ENST00000532541.5; ENST00000534477.5
External Link RMBase: m6A_site_132473
mod ID: M6ASITE004198 Click to Show/Hide the Full List
mod site chr11:12980312-12980313:- [8]
Sequence CAAAGGTTACCTGTGGGAAAACTTCTTTTTCTATGCTGAAA
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000527945.2; ENST00000504230.2; ENST00000534477.5; ENST00000532541.5
External Link RMBase: m6A_site_132474
mod ID: M6ASITE004199 Click to Show/Hide the Full List
mod site chr11:12980671-12980672:- [8]
Sequence CAGGTAGCTTCTTCAGGAGAACAGCCCTCTGAGGAGGCAGG
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000529328.1; ENST00000534477.5; ENST00000531402.5; ENST00000532541.5; ENST00000527945.2; ENST00000504230.2; ENST00000526388.1
External Link RMBase: m6A_site_132475
mod ID: M6ASITE004200 Click to Show/Hide the Full List
mod site chr11:12980706-12980707:- [7]
Sequence ATCACTCCTGCAGTTTCTGAACACTACACAGACGCCAGGTA
Motif Score 2.951386905
Cell/Tissue List HepG2; HeLa; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000504230.2; ENST00000532541.5; ENST00000534477.5; ENST00000527945.2; ENST00000529328.1; ENST00000526388.1; ENST00000531402.5
External Link RMBase: m6A_site_132476
mod ID: M6ASITE004201 Click to Show/Hide the Full List
mod site chr11:12980813-12980814:- [8]
Sequence TGAGGACTCTTGTGACCAGGACAACAGGGAAGCTTGCAGCA
Motif Score 3.643047619
Cell/Tissue List HeLa; hESC-HEK293T; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A
Seq Type List MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List ENST00000532541.5; ENST00000504230.2; ENST00000529328.1; ENST00000527945.2; ENST00000526388.1; ENST00000531402.5; ENST00000534477.5
External Link RMBase: m6A_site_132477
mod ID: M6ASITE004202 Click to Show/Hide the Full List
mod site chr11:12980828-12980829:- [8]
Sequence GATTTTGAGAACAACTGAGGACTCTTGTGACCAGGACAACA
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000526388.1; ENST00000529328.1; ENST00000504230.2; ENST00000531402.5; ENST00000532541.5; ENST00000534477.5; ENST00000527945.2
External Link RMBase: m6A_site_132478
mod ID: M6ASITE004203 Click to Show/Hide the Full List
mod site chr11:12980838-12980839:- [8]
Sequence TTTCTTCCACGATTTTGAGAACAACTGAGGACTCTTGTGAC
Motif Score 2.951386905
Cell/Tissue List HeLa; hESC-HEK293T; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A
Seq Type List MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List ENST00000504230.2; ENST00000532541.5; ENST00000534477.5; ENST00000529328.1; ENST00000526388.1; ENST00000531402.5; ENST00000527945.2
External Link RMBase: m6A_site_132479
mod ID: M6ASITE004204 Click to Show/Hide the Full List
mod site chr11:12980862-12980863:- [8]
Sequence TGAGTTTTCAAGTATAAAAGACTTTTTCTTCCACGATTTTG
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; U2OS; Huh7; HEK293A-TOA; iSLK; TREX; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000527945.2; ENST00000526388.1; ENST00000531402.5; ENST00000529328.1; ENST00000532541.5; ENST00000534477.5; ENST00000504230.2
External Link RMBase: m6A_site_132480
mod ID: M6ASITE004205 Click to Show/Hide the Full List
mod site chr11:12980950-12980951:- [8]
Sequence TCAGAAGATTCTATGAGGAAACCCATTTAAAAATAGGATGC
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293A-TOA; iSLK; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000529328.1; ENST00000526388.1; ENST00000532541.5; ENST00000527945.2; ENST00000531402.5; ENST00000534477.5; ENST00000504230.2
External Link RMBase: m6A_site_132481