m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00054)

Target Name	Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1)
Synonyms	DNA-binding factor KBF1; EBP-1; Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 Click to Show/Hide
Gene Name	NFKB1
Chromosomal Location	4q24
Function	NF-kappa-B is a pleiotropic transcription factor present in almost all cell types and is the endpoint of a series of signal transduction events that are initiated by a vast array of stimuli related to many biological processes such as inflammation, immunity, differentiation, cell growth, tumorigenesis and apoptosis. NF-kappa-B is a homo- or heterodimeric complex formed by the Rel-like domain-containing proteins RELA/p65, RELB, NFKB1/p105, NFKB1/p50, REL and NFKB2/p52 and the heterodimeric p65-p50 complex appears to be most abundant one. The dimers bind at kappa-B sites in the DNA of their target genes and the individual dimers have distinct preferences for different kappa-B sites that they can bind with distinguishable affinity and specificity. Different dimer combinations act as transcriptional activators or repressors, respectively. NF-kappa-B is controlled by various mechanisms of post-translational modification and subcellular compartmentalization as well as by interactions with other cofactors or corepressors. NF-kappa-B complexes are held in the cytoplasm in an inactive state complexed with members of the NF-kappa-B inhibitor (I-kappa-B) family. In a conventional activation pathway, I-kappa-B is phosphorylated by I-kappa-B kinases (IKKs) in response to different activators, subsequently degraded thus liberating the active NF-kappa-B complex which translocates to the nucleus. NF-kappa-B heterodimeric p65-p50 and RelB-p50 complexes are transcriptional activators. The NF-kappa-B p50-p50 homodimer is a transcriptional repressor, but can act as a transcriptional activator when associated with BCL3. NFKB1 appears to have dual functions such as cytoplasmic retention of attached NF-kappa-B proteins by p105 and generation of p50 by a cotranslational processing. The proteasome-mediated process ensures the production of both p50 and p105 and preserves their independent function, although processing of NFKB1/p105 also appears to occur post-translationally. p50 binds to the kappa-B consensus sequence 5'-GGRNNYYCC-3', located in the enhancer region of genes involved in immune response and acute phase reactions. In a complex with MAP3K8, NFKB1/p105 represses MAP3K8-induced MAPK signaling; active MAP3K8 is released by proteasome-dependent degradation of NFKB1/p105. Click to Show/Hide
Gene ID	4790
Uniprot ID	NFKB1_HUMAN
HGNC ID	HGNC:7794
KEGG ID	hsa:4790

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

NFKB1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: -6.78E-01 p-value: 1.44E-07
More Results	Click to View More RNA-seq Results

In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	YTHDF2 accelerated UBXN1 mRNA degradation via METTL3-mediated m6A, which, in turn, promoted Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1) activation. YTHDF2 promotes the malignant progression of gliomas and revealed important insight into the upstream regulatory mechanism of NF-Kappa-B activation via UBXN1 with a primary focus on m6A modification.
Target Regulation	Up regulation
Responsed Disease	Glioma		ICD-11: 2A00.0	Disease Info
Pathway Response	NF-kappa B signaling pathway			hsa04064
In-vitro Model	U87 (A primary glioblastoma cell line)
	N33 (The GBM patient-derived cell line)
	LN-229	Glioblastoma	Homo sapiens	CVCL_0393
	H4	Astrocytoma	Homo sapiens	CVCL_1239
In-vivo Model	Five-week-old female BALB/c nude mice (Charles Rivers, Beijing, China) were selected for the experiments. U87 cells (5 × 10⁵) transfected with an empty vector, YTHDF2 overexpression, or METTL3 overexpression vectors were suspended in PBS and injected into the right frontal node of nude mice. The inoculation position was 2 mm lateral and 2 mm posterior to the anterior fontanel. Tumor size was estimated from luciferase volume measurements and MRI. The mice were sacrificed when they exhibited disturbed activity or convulsion. The brain was then harvested and embedded in paraffin.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	The contribution of METTL3-mediated m6A modif ication of Ddit4 mRNA to macrophage metabolic reprogramming in non-alcoholic fatty liver disease and obesity. In METTL3-deficient macrophages, there is a significant downregulation of mammalian target of rapamycin (mTOR) and Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1) pathway activity in response to cellular stress and cytokine stimulation, which can be restored by knockdown of DDIT4.
Target Regulation	Up regulation
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	HIF-1 signaling pathway			hsa04066
In-vivo Model	The 8-10 weeks old mice were fed either a high fat diet or HF-CDAA , ad lib for 6-12 weeks. Chow diet was used as control for HFD.The mouse liver was perfused with PBS through portal vein, and liver tissue was cut into small pieces by a scissor. The single cell was made using syringe plunger to mull the tissue, and passed through a 40 uM cell strainer.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	The contribution of Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1)-mediated m6A modification of Ddit4 mRNA to macrophage metabolic reprogramming in non-alcoholic fatty liver disease and obesity. In METTL3-deficient macrophages, there is a significant downregulation of mammalian target of rapamycin (mTOR) and Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1) pathway activity in response to cellular stress and cytokine stimulation, which can be restored by knockdown of DDIT4.
Target Regulation	Up regulation
Responsed Disease	Obesity		ICD-11: 5B81	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
	HIF-1 signaling pathway			hsa04066
In-vivo Model	The 8-10 weeks old mice were fed either a high fat diet or HF-CDAA , ad lib for 6-12 weeks. Chow diet was used as control for HFD.The mouse liver was perfused with PBS through portal vein, and liver tissue was cut into small pieces by a scissor. The single cell was made using syringe plunger to mull the tissue, and passed through a 40 uM cell strainer.
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1) acts as transcription factor to transactivate METTL3/METTL14 genes upon LPS challenge, leading to global RNA m6A hypermethylation. m6A modification in TGF-beta1 upregulation, which helps to shed light on the molecular mechanism of nonalcoholic steatohepatitis(NASH) progression.
Target Regulation	Up regulation
Responsed Disease	Nonalcoholic steatohepatitis		ICD-11: DB92.1	Disease Info
In-vitro Model	KCs (Mouse Kupffer cells (BeNa Culture Collection, Beijing, China; BNCC340733))
In-vivo Model	At 8 weeks of age, METTL14 cKO and WT mice were challenged with LPS (Sigma-Aldrich, St. Louis, MO; L2880, single intraperitoneal injection at 5 mg/kg, n = 3) or CCl4 (10%, Macklin, Shanghai, China; C805332, intraperitoneal injection at 5 mL/kg diluted with corn oil, twice per week for 4 weeks, n = 3). The corresponding control groups were treated with single intraperitoneal injection of saline (n = 3) or intraperitoneal injection of corn oil twice per week for 4 weeks (n = 3), respectively. Two hours after LPS injection and 4 weeks after CCl4 treatment, METTL14 cKO and WT mice were etherized and the primary KCs were isolated from liver according to a previously published method.

Wilms tumor 1-associating protein (WTAP) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by WTAP*
Cell Line	mice hepatocyte	Mus musculus
Treatment: Wtap Hknockout mice hepatocyte Control: Wtap flox/flox mice hepatocyte		GSE168850
Regulation		logFC: 9.05E-01 p-value: 1.07E-04
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	WTAP could methylate 3'-UTR of CAV-1 and downregulate CAV-1 expression to activate Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1) signaling pathway in EC, which promoted EC progression.
Responsed Disease	Endometrial cancer		ICD-11: 2C76	Disease Info
Pathway Response	NF-kappa B signaling pathway			hsa04064
	Apoptosis			hsa04210
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	Ishikawa	Endometrial adenocarcinoma	Homo sapiens	CVCL_2529
	HEC-1-A	Endometrial adenocarcinoma	Homo sapiens	CVCL_0293

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[5]
Response Summary	Mettl14 gene knockout significantly reduced the inflammatory response of macrophages and the development of atherosclerotic plaques, Mettl14 plays a vital role in macrophage inflammation in atherosclerosis via the Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1)/IL-6 signaling pathway.
Target Regulation	Up regulation
Responsed Disease	Atherosclerosis		ICD-11: BD40.Z	Disease Info
Pathway Response	IL-17 signaling pathway			hsa04657
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
In-vivo Model	Mettl14 heterozygous mice (Mettl14^-/+) were established from C57/BL6 mice by Cyagen Biosciences, Inc. (Suzhou, Jiangsu, China), using CRISPR/Cas9-based targeting and homology-directed repair. C57/BL6 and APOE^-/- mice were purchased from Beijing Vital River Laboratory Animal Technology (Beijing, China). Mettl14^-/+APOE^-/- mice were generated by breeding Mettl14^-/+ mice with APOE^-/- mice. Eight- to 10-week-old male APOE^-/- (WT) mice and Mettl14^-/+APOE^-/- (KO) mice were fed a high-cholesterol diet (D12108C, Opensource diets) for 12 weeks. Then, the mice were euthanized for further analysis.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1) acts as transcription factor to transactivate METTL3/METTL14 genes upon LPS challenge, leading to global RNA m6A hypermethylation. m6A modification in TGF-beta1 upregulation, which helps to shed light on the molecular mechanism of nonalcoholic steatohepatitis(NASH) progression.
Target Regulation	Up regulation
Responsed Disease	Nonalcoholic steatohepatitis		ICD-11: DB92.1	Disease Info
In-vitro Model	KCs (Mouse Kupffer cells (BeNa Culture Collection, Beijing, China; BNCC340733))
In-vivo Model	At 8 weeks of age, METTL14 cKO and WT mice were challenged with LPS (Sigma-Aldrich, St. Louis, MO; L2880, single intraperitoneal injection at 5 mg/kg, n = 3) or CCl4 (10%, Macklin, Shanghai, China; C805332, intraperitoneal injection at 5 mL/kg diluted with corn oil, twice per week for 4 weeks, n = 3). The corresponding control groups were treated with single intraperitoneal injection of saline (n = 3) or intraperitoneal injection of corn oil twice per week for 4 weeks (n = 3), respectively. Two hours after LPS injection and 4 weeks after CCl4 treatment, METTL14 cKO and WT mice were etherized and the primary KCs were isolated from liver according to a previously published method.

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	YTHDF2 accelerated UBXN1 mRNA degradation via METTL3-mediated m6A, which, in turn, promoted Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1) activation. YTHDF2 promotes the malignant progression of gliomas and revealed important insight into the upstream regulatory mechanism of NF-Kappa-B activation via UBXN1 with a primary focus on m6A modification.
Target Regulation	Up regulation
Responsed Disease	Glioma		ICD-11: 2A00.0	Disease Info
Pathway Response	NF-kappa B signaling pathway			hsa04064
In-vitro Model	U87 (A primary glioblastoma cell line)
	N33 (The GBM patient-derived cell line)
	LN-229	Glioblastoma	Homo sapiens	CVCL_0393
	H4	Astrocytoma	Homo sapiens	CVCL_1239
In-vivo Model	Five-week-old female BALB/c nude mice (Charles Rivers, Beijing, China) were selected for the experiments. U87 cells (5 × 10⁵) transfected with an empty vector, YTHDF2 overexpression, or METTL3 overexpression vectors were suspended in PBS and injected into the right frontal node of nude mice. The inoculation position was 2 mm lateral and 2 mm posterior to the anterior fontanel. Tumor size was estimated from luciferase volume measurements and MRI. The mice were sacrificed when they exhibited disturbed activity or convulsion. The brain was then harvested and embedded in paraffin.

Brain cancer [ICD-11: 2A00]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	YTHDF2 accelerated UBXN1 mRNA degradation via METTL3-mediated m6A, which, in turn, promoted Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1) activation. YTHDF2 promotes the malignant progression of gliomas and revealed important insight into the upstream regulatory mechanism of NF-Kappa-B activation via UBXN1 with a primary focus on m6A modification.
Responsed Disease	Glioma [ICD-11: 2A00.0]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	NF-kappa B signaling pathway			hsa04064
In-vitro Model	U87 (A primary glioblastoma cell line)
	N33 (The GBM patient-derived cell line)
	LN-229	Glioblastoma	Homo sapiens	CVCL_0393
	H4	Astrocytoma	Homo sapiens	CVCL_1239
In-vivo Model	Five-week-old female BALB/c nude mice (Charles Rivers, Beijing, China) were selected for the experiments. U87 cells (5 × 10⁵) transfected with an empty vector, YTHDF2 overexpression, or METTL3 overexpression vectors were suspended in PBS and injected into the right frontal node of nude mice. The inoculation position was 2 mm lateral and 2 mm posterior to the anterior fontanel. Tumor size was estimated from luciferase volume measurements and MRI. The mice were sacrificed when they exhibited disturbed activity or convulsion. The brain was then harvested and embedded in paraffin.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	YTHDF2 accelerated UBXN1 mRNA degradation via METTL3-mediated m6A, which, in turn, promoted Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1) activation. YTHDF2 promotes the malignant progression of gliomas and revealed important insight into the upstream regulatory mechanism of NF-Kappa-B activation via UBXN1 with a primary focus on m6A modification.
Responsed Disease	Glioma [ICD-11: 2A00.0]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	NF-kappa B signaling pathway			hsa04064
In-vitro Model	U87 (A primary glioblastoma cell line)
	N33 (The GBM patient-derived cell line)
	LN-229	Glioblastoma	Homo sapiens	CVCL_0393
	H4	Astrocytoma	Homo sapiens	CVCL_1239
In-vivo Model	Five-week-old female BALB/c nude mice (Charles Rivers, Beijing, China) were selected for the experiments. U87 cells (5 × 10⁵) transfected with an empty vector, YTHDF2 overexpression, or METTL3 overexpression vectors were suspended in PBS and injected into the right frontal node of nude mice. The inoculation position was 2 mm lateral and 2 mm posterior to the anterior fontanel. Tumor size was estimated from luciferase volume measurements and MRI. The mice were sacrificed when they exhibited disturbed activity or convulsion. The brain was then harvested and embedded in paraffin.

Endometrial cancer [ICD-11: 2C76]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	WTAP could methylate 3'-UTR of CAV-1 and downregulate CAV-1 expression to activate Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1) signaling pathway in EC, which promoted EC progression.
Responsed Disease	Endometrial cancer [ICD-11: 2C76]
Target Regulator	Wilms tumor 1-associating protein (WTAP)		WRITER	Regulator Info
Pathway Response	NF-kappa B signaling pathway			hsa04064
	Apoptosis			hsa04210
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	Ishikawa	Endometrial adenocarcinoma	Homo sapiens	CVCL_2529
	HEC-1-A	Endometrial adenocarcinoma	Homo sapiens	CVCL_0293

Obesity [ICD-11: 5B81]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[2]
Response Summary	The contribution of METTL3-mediated m6A modif ication of Ddit4 mRNA to macrophage metabolic reprogramming in non-alcoholic fatty liver disease and obesity. In METTL3-deficient macrophages, there is a significant downregulation of mammalian target of rapamycin (mTOR) and Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1) pathway activity in response to cellular stress and cytokine stimulation, which can be restored by knockdown of DDIT4.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	mTOR signaling pathway		hsa04150
	HIF-1 signaling pathway		hsa04066
In-vivo Model	The 8-10 weeks old mice were fed either a high fat diet or HF-CDAA , ad lib for 6-12 weeks. Chow diet was used as control for HFD.The mouse liver was perfused with PBS through portal vein, and liver tissue was cut into small pieces by a scissor. The single cell was made using syringe plunger to mull the tissue, and passed through a 40 uM cell strainer.
Experiment 2 Reporting the m6A-centered Disease Response			[2]
Response Summary	The contribution of Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1)-mediated m6A modification of Ddit4 mRNA to macrophage metabolic reprogramming in non-alcoholic fatty liver disease and obesity. In METTL3-deficient macrophages, there is a significant downregulation of mammalian target of rapamycin (mTOR) and Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1) pathway activity in response to cellular stress and cytokine stimulation, which can be restored by knockdown of DDIT4.
Responsed Disease	Obesity [ICD-11: 5B81]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	mTOR signaling pathway		hsa04150
	HIF-1 signaling pathway		hsa04066
In-vivo Model	The 8-10 weeks old mice were fed either a high fat diet or HF-CDAA , ad lib for 6-12 weeks. Chow diet was used as control for HFD.The mouse liver was perfused with PBS through portal vein, and liver tissue was cut into small pieces by a scissor. The single cell was made using syringe plunger to mull the tissue, and passed through a 40 uM cell strainer.

Atherosclerosis [ICD-11: BD40]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[5]
Response Summary	Mettl14 gene knockout significantly reduced the inflammatory response of macrophages and the development of atherosclerotic plaques, Mettl14 plays a vital role in macrophage inflammation in atherosclerosis via the Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1)/IL-6 signaling pathway.
Responsed Disease	Atherosclerosis [ICD-11: BD40.Z]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	IL-17 signaling pathway			hsa04657
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
In-vivo Model	Mettl14 heterozygous mice (Mettl14^-/+) were established from C57/BL6 mice by Cyagen Biosciences, Inc. (Suzhou, Jiangsu, China), using CRISPR/Cas9-based targeting and homology-directed repair. C57/BL6 and APOE^-/- mice were purchased from Beijing Vital River Laboratory Animal Technology (Beijing, China). Mettl14^-/+APOE^-/- mice were generated by breeding Mettl14^-/+ mice with APOE^-/- mice. Eight- to 10-week-old male APOE^-/- (WT) mice and Mettl14^-/+APOE^-/- (KO) mice were fed a high-cholesterol diet (D12108C, Opensource diets) for 12 weeks. Then, the mice were euthanized for further analysis.

Non-alcoholic fatty liver disease [ICD-11: DB92]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[3]
Response Summary	Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1) acts as transcription factor to transactivate METTL3/METTL14 genes upon LPS challenge, leading to global RNA m6A hypermethylation. m6A modification in TGF-beta1 upregulation, which helps to shed light on the molecular mechanism of nonalcoholic steatohepatitis(NASH) progression.
Responsed Disease	Nonalcoholic steatohepatitis [ICD-11: DB92.1]
Target Regulator	Methyltransferase-like 14 (METTL14)	WRITER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	KCs (Mouse Kupffer cells (BeNa Culture Collection, Beijing, China; BNCC340733))
In-vivo Model	At 8 weeks of age, METTL14 cKO and WT mice were challenged with LPS (Sigma-Aldrich, St. Louis, MO; L2880, single intraperitoneal injection at 5 mg/kg, n = 3) or CCl4 (10%, Macklin, Shanghai, China; C805332, intraperitoneal injection at 5 mL/kg diluted with corn oil, twice per week for 4 weeks, n = 3). The corresponding control groups were treated with single intraperitoneal injection of saline (n = 3) or intraperitoneal injection of corn oil twice per week for 4 weeks (n = 3), respectively. Two hours after LPS injection and 4 weeks after CCl4 treatment, METTL14 cKO and WT mice were etherized and the primary KCs were isolated from liver according to a previously published method.
Experiment 2 Reporting the m6A-centered Disease Response			[3]
Response Summary	Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1) acts as transcription factor to transactivate METTL3/METTL14 genes upon LPS challenge, leading to global RNA m6A hypermethylation. m6A modification in TGF-beta1 upregulation, which helps to shed light on the molecular mechanism of nonalcoholic steatohepatitis(NASH) progression.
Responsed Disease	Nonalcoholic steatohepatitis [ICD-11: DB92.1]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	KCs (Mouse Kupffer cells (BeNa Culture Collection, Beijing, China; BNCC340733))
In-vivo Model	At 8 weeks of age, METTL14 cKO and WT mice were challenged with LPS (Sigma-Aldrich, St. Louis, MO; L2880, single intraperitoneal injection at 5 mg/kg, n = 3) or CCl4 (10%, Macklin, Shanghai, China; C805332, intraperitoneal injection at 5 mL/kg diluted with corn oil, twice per week for 4 weeks, n = 3). The corresponding control groups were treated with single intraperitoneal injection of saline (n = 3) or intraperitoneal injection of corn oil twice per week for 4 weeks (n = 3), respectively. Two hours after LPS injection and 4 weeks after CCl4 treatment, METTL14 cKO and WT mice were etherized and the primary KCs were isolated from liver according to a previously published method.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03321		Crosstalk Info
Epigenetic Regulator	Probable JmjC domain-containing histone demethylation protein 2C (JMJD1C)
Regulated Target	Histone H3 lysine 9 monomethylation (H3K9me1)
Crosstalk relationship	Histone modification → m6A
Disease	Brain cancer	Disease Info

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03541		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship	Histone modification → m6A
Disease	Brain cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00054)

Nuclear factor NF-kappa-B p105 subunit (NF-Kappa-B/NFKB1)

Adenosine-to-Inosine editing (A-to-I)

In total 8 m6A sequence/site(s) in this target gene
mod ID: A2ISITE000499		Click to Show/Hide the Full List
mod site	chr4:102512399-102512400:+		[7]
Sequence	GCTCTGTCACACAGGCTGGAATGCAGTGGCGCAATCATGGC
Transcript ID List	ENST00000511926.5; ENST00000509165.1; ENST00000505458.5; ENST00000507079.5; ENST00000394820.8; ENST00000651197.1; ENST00000652619.1; ENST00000226574.9
External Link	RMBase: RNA-editing_site_106022
mod ID: A2ISITE000500		Click to Show/Hide the Full List
mod site	chr4:102512460-102512461:+		[7]
Sequence	TGGTCCCAAGCTATCCTCCCACCTCAGCCACCCAAGTAGGT
Transcript ID List	ENST00000509165.1; ENST00000507079.5; ENST00000511926.5; ENST00000394820.8; ENST00000651197.1; ENST00000505458.5; ENST00000226574.9; ENST00000652619.1
External Link	RMBase: RNA-editing_site_106023
mod ID: A2ISITE000501		Click to Show/Hide the Full List
mod site	chr4:102558719-102558720:+		[7]
Sequence	GAGTGCAGTGGTGCGATCATAGCCCAATGCCACCTTGAACT
Transcript ID List	ENST00000652569.1; ENST00000394820.8; ENST00000651197.1; ENST00000652619.1; ENST00000502367.1; ENST00000226574.9; ENST00000513803.5; ENST00000507079.5; ENST00000510638.1; ENST00000509165.1; ENST00000505458.5
External Link	RMBase: RNA-editing_site_106024
mod ID: A2ISITE000502		Click to Show/Hide the Full List
mod site	chr4:102559817-102559818:+		[8]
Sequence	GTGTGGTGGCATGCACCTGTAGTCCTAGCTACCTAGGAGGC
Transcript ID List	ENST00000652569.1; ENST00000652619.1; ENST00000509165.1; ENST00000505458.5; ENST00000513803.5; ENST00000502367.1; ENST00000226574.9; ENST00000507079.5; rmsk_1394736; ENST00000394820.8; ENST00000651197.1; ENST00000510638.1
External Link	RMBase: RNA-editing_site_106025
mod ID: A2ISITE000503		Click to Show/Hide the Full List
mod site	chr4:102570474-102570475:+		[7]
Sequence	ATGTTATTGATAGGGAATTTAGGTTGATTCCATGTCTTTGC
Transcript ID List	ENST00000652569.1; ENST00000510638.1; ENST00000651197.1; ENST00000513803.5; ENST00000394820.8; ENST00000507079.5; ENST00000505458.5; ENST00000226574.9; ENST00000652619.1; ENST00000509165.1
External Link	RMBase: RNA-editing_site_106026
mod ID: A2ISITE000504		Click to Show/Hide the Full List
mod site	chr4:102570580-102570581:+		[7]
Sequence	CCTTTGATTGTGTACCCAACAGTGGGATTGCTGGGTCAAAT
Transcript ID List	ENST00000652569.1; ENST00000226574.9; ENST00000505458.5; ENST00000651197.1; ENST00000513803.5; ENST00000394820.8; ENST00000507079.5; ENST00000509165.1; ENST00000652619.1; ENST00000510638.1
External Link	RMBase: RNA-editing_site_106027
mod ID: A2ISITE000505		Click to Show/Hide the Full List
mod site	chr4:102572555-102572556:+		[7]
Sequence	CTTCCACAGTGGCTGAACTAATTTGCACTCCCACCAGCAGT
Transcript ID List	ENST00000513803.5; ENST00000394820.8; ENST00000510638.1; ENST00000509165.1; ENST00000507079.5; ENST00000226574.9; ENST00000652569.1; ENST00000652619.1; ENST00000651197.1; ENST00000505458.5
External Link	RMBase: RNA-editing_site_106028
mod ID: A2ISITE000506		Click to Show/Hide the Full List
mod site	chr4:102572576-102572577:+		[7]
Sequence	TTTGCACTCCCACCAGCAGTATATAAGTGTACCCTCTTCTC
Transcript ID List	ENST00000507079.5; ENST00000509165.1; ENST00000513803.5; ENST00000226574.9; ENST00000651197.1; ENST00000505458.5; ENST00000510638.1; ENST00000652619.1; ENST00000394820.8; ENST00000652569.1
External Link	RMBase: RNA-editing_site_106029

5-methylcytidine (m5C)

In total 3 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003328		Click to Show/Hide the Full List
mod site	chr4:102578982-102578983:+		[9]
Sequence	AGCTTTTCTTCCGGATAGCACTGGCAGCTTCACAAGGCGCC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000513803.5; ENST00000652569.1; ENST00000600343.5; ENST00000508584.1; ENST00000510638.1; ENST00000652619.1; ENST00000226574.9; ENST00000651197.1; ENST00000394820.8; ENST00000505458.5
External Link	RMBase: m5C_site_34268
mod ID: M5CSITE003329		Click to Show/Hide the Full List
mod site	chr4:102597577-102597578:+		[9]
Sequence	AGGCATGCCAATGCCCTTTTCGACTACGCGGTGACAGGAGA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000652619.1; ENST00000505458.5; ENST00000652569.1; ENST00000651197.1; ENST00000600343.5; ENST00000394820.8; ENST00000226574.9
External Link	RMBase: m5C_site_34269
mod ID: M5CSITE003330		Click to Show/Hide the Full List
mod site	chr4:102600943-102600944:+		[9]
Sequence	ATTCTCAACTTGTGAGGGATCTACTAGAAGTCACATCTGGT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000226574.9; ENST00000394820.8; ENST00000505458.5; ENST00000652569.1; ENST00000651197.1; ENST00000652619.1; ENST00000600343.5
External Link	RMBase: m5C_site_34270

N6-methyladenosine (m6A)

In total 64 m6A sequence/site(s) in this target gene
mod ID: M6ASITE066784		Click to Show/Hide the Full List
mod site	chr4:102501345-102501346:+		[10]
Sequence	GAAGTGAGAGAGTGAGCGAGACAGAAAGAGAGAGAAGTGCA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; GSC-11; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000394820.8; rmsk_1394649
External Link	RMBase: m6A_site_645711
mod ID: M6ASITE066785		Click to Show/Hide the Full List
mod site	chr4:102501775-102501776:+		[10]
Sequence	CGCCAGGAGGCCGAACGCGGACTCGCCACCCGGGTAAGCCA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000226574.9; ENST00000652619.1; ENST00000507079.5; ENST00000651197.1; ENST00000511926.5; ENST00000394820.8
External Link	RMBase: m6A_site_645712
mod ID: M6ASITE066786		Click to Show/Hide the Full List
mod site	chr4:102501914-102501915:+		[10]
Sequence	TGCGCTAACCGCTGGGCTAGACCGTGGGAGGAGGTTGACAG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000511926.5; ENST00000651197.1; ENST00000507079.5; ENST00000505458.5; ENST00000652619.1; ENST00000226574.9; ENST00000394820.8
External Link	RMBase: m6A_site_645713
mod ID: M6ASITE066787		Click to Show/Hide the Full List
mod site	chr4:102525553-102525554:+		[10]
Sequence	CCATATTTGGGAAGGCCTGAACAAGTAAGTGTCATAATCTC
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000509165.1; ENST00000507079.5; ENST00000652619.1; ENST00000651197.1; ENST00000226574.9; ENST00000505458.5; ENST00000511926.5; ENST00000394820.8
External Link	RMBase: m6A_site_645714
mod ID: M6ASITE066788		Click to Show/Hide the Full List
mod site	chr4:102533881-102533882:+		[10]
Sequence	CAAATATTAGAGCAACCTAAACAGGTAAGATTAAAGGGGTG
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000505458.5; ENST00000509165.1; ENST00000226574.9; ENST00000652569.1; ENST00000652619.1; ENST00000511926.5; ENST00000394820.8; ENST00000507079.5; ENST00000651197.1
External Link	RMBase: m6A_site_645715
mod ID: M6ASITE066789		Click to Show/Hide the Full List
mod site	chr4:102537904-102537905:+		[10]
Sequence	GAAGGCCCATCCCATGGTGGACTACCTGGTGCCTCTAGTGA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000651197.1; ENST00000509165.1; ENST00000507079.5; ENST00000505458.5; ENST00000394820.8; ENST00000652569.1; ENST00000502367.1; ENST00000226574.9; ENST00000513803.5; ENST00000652619.1
External Link	RMBase: m6A_site_645716
mod ID: M6ASITE066790		Click to Show/Hide the Full List
mod site	chr4:102537930-102537931:+		[10]
Sequence	TGGTGCCTCTAGTGAAAAGAACAAGAAGTCTTACCCTCAGG
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000652619.1; ENST00000652569.1; ENST00000226574.9; ENST00000651197.1; ENST00000513803.5; ENST00000394820.8; ENST00000507079.5; ENST00000502367.1; ENST00000509165.1; ENST00000505458.5
External Link	RMBase: m6A_site_645717
mod ID: M6ASITE066791		Click to Show/Hide the Full List
mod site	chr4:102557135-102557136:+		[10]
Sequence	GGAGAAGAGAGAGTGAAGGAACTTGCACGCAGTGACTTCTA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000394820.8; ENST00000505458.5; ENST00000507079.5; ENST00000652619.1; ENST00000652569.1; ENST00000510638.1; ENST00000226574.9; ENST00000502367.1; ENST00000651197.1; ENST00000513803.5; ENST00000509165.1
External Link	RMBase: m6A_site_645718
mod ID: M6ASITE066792		Click to Show/Hide the Full List
mod site	chr4:102567031-102567032:+		[11]
Sequence	AGGTTATTGTTCAGTTGGTCACAAATGGAAAAAATATCCAC
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000652569.1; ENST00000505458.5; ENST00000510638.1; ENST00000394820.8; ENST00000507079.5; ENST00000651197.1; ENST00000502367.1; ENST00000509165.1; ENST00000226574.9; ENST00000513803.5; ENST00000652619.1
External Link	RMBase: m6A_site_645719
mod ID: M6ASITE066793		Click to Show/Hide the Full List
mod site	chr4:102567078-102567079:+		[10]
Sequence	GCCCACAGCCTGGTGGGAAAACACTGTGAGGATGGGATCTG
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000505458.5; ENST00000652569.1; ENST00000394820.8; ENST00000226574.9; ENST00000507079.5; ENST00000651197.1; ENST00000513803.5; ENST00000510638.1; ENST00000509165.1; ENST00000652619.1; ENST00000502367.1
External Link	RMBase: m6A_site_645720
mod ID: M6ASITE066794		Click to Show/Hide the Full List
mod site	chr4:102567114-102567115:+		[10]
Sequence	ATCTGCACTGTAACTGCTGGACCCAAGGACATGGTGGTCGG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000507079.5; ENST00000652569.1; ENST00000651197.1; ENST00000226574.9; ENST00000509165.1; ENST00000513803.5; ENST00000394820.8; ENST00000505458.5; ENST00000510638.1; ENST00000652619.1
External Link	RMBase: m6A_site_645721
mod ID: M6ASITE066795		Click to Show/Hide the Full List
mod site	chr4:102567122-102567123:+		[10]
Sequence	TGTAACTGCTGGACCCAAGGACATGGTGGTCGGGTAAGTAG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000513803.5; ENST00000226574.9; ENST00000651197.1; ENST00000509165.1; ENST00000505458.5; ENST00000652619.1; ENST00000652569.1; ENST00000394820.8; ENST00000510638.1; ENST00000507079.5
External Link	RMBase: m6A_site_645722
mod ID: M6ASITE066796		Click to Show/Hide the Full List
mod site	chr4:102576883-102576884:+		[10]
Sequence	TTTTTTCTCCAGCTTCGCAAACCTGGGTATACTTCATGTGA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000507079.5; ENST00000505458.5; ENST00000652569.1; ENST00000651197.1; ENST00000394820.8; ENST00000513803.5; ENST00000509165.1; ENST00000510638.1; ENST00000652619.1; ENST00000226574.9
External Link	RMBase: m6A_site_645723
mod ID: M6ASITE066797		Click to Show/Hide the Full List
mod site	chr4:102576903-102576904:+		[11]
Sequence	ACCTGGGTATACTTCATGTGACAAAGAAAAAAGTATTTGAA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000510638.1; ENST00000652619.1; ENST00000505458.5; ENST00000226574.9; ENST00000507079.5; ENST00000651197.1; ENST00000652569.1; ENST00000513803.5; ENST00000394820.8
External Link	RMBase: m6A_site_645724
mod ID: M6ASITE066798		Click to Show/Hide the Full List
mod site	chr4:102576924-102576925:+		[10]
Sequence	CAAAGAAAAAAGTATTTGAAACACTGGAAGCACGAATGACA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000226574.9; ENST00000513803.5; ENST00000510638.1; ENST00000507079.5; ENST00000394820.8; ENST00000652569.1; ENST00000505458.5; ENST00000652619.1; ENST00000651197.1
External Link	RMBase: m6A_site_645725
mod ID: M6ASITE066799		Click to Show/Hide the Full List
mod site	chr4:102576974-102576975:+		[10]
Sequence	ATAAGGGGCTATAATCCTGGACTCTTGGTGCACCCTGACCT
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000394820.8; ENST00000513803.5; ENST00000507079.5; ENST00000652569.1; ENST00000226574.9; ENST00000652619.1; ENST00000510638.1; ENST00000651197.1; ENST00000505458.5
External Link	RMBase: m6A_site_645726
mod ID: M6ASITE066800		Click to Show/Hide the Full List
mod site	chr4:102577024-102577025:+		[10]
Sequence	GCAAGCAGAAGGTGGAGGGGACCGGCAGCTGGGAGGTAAGC
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000652619.1; ENST00000505458.5; ENST00000510638.1; ENST00000651197.1; ENST00000513803.5; ENST00000652569.1; ENST00000394820.8; ENST00000507079.5; ENST00000226574.9
External Link	RMBase: m6A_site_645727
mod ID: M6ASITE066801		Click to Show/Hide the Full List
mod site	chr4:102577721-102577722:+		[10]
Sequence	CTCCATCTTCTGATACCCAGACTCAAAACCTTCCCATCCTC
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000394820.8; ENST00000652619.1; ENST00000510638.1; ENST00000513803.5; ENST00000651197.1; ENST00000226574.9; ENST00000652569.1; ENST00000505458.5; ENST00000600343.5
External Link	RMBase: m6A_site_645728
mod ID: M6ASITE066802		Click to Show/Hide the Full List
mod site	chr4:102577728-102577729:+		[10]
Sequence	TTCTGATACCCAGACTCAAAACCTTCCCATCCTCACTGACT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000226574.9; ENST00000651197.1; ENST00000394820.8; ENST00000510638.1; ENST00000600343.5; ENST00000505458.5; ENST00000652569.1; ENST00000652619.1; ENST00000513803.5
External Link	RMBase: m6A_site_645729
mod ID: M6ASITE066803		Click to Show/Hide the Full List
mod site	chr4:102578921-102578922:+		[10]
Sequence	GCCAAGCAGCTCTGCAGCAGACCAAGGAGATGGACCTCAGC
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000651197.1; ENST00000508584.1; ENST00000652619.1; ENST00000505458.5; ENST00000652569.1; ENST00000513803.5; ENST00000394820.8; ENST00000226574.9; ENST00000600343.5; ENST00000510638.1
External Link	RMBase: m6A_site_645730
mod ID: M6ASITE066804		Click to Show/Hide the Full List
mod site	chr4:102578934-102578935:+		[10]
Sequence	GCAGCAGACCAAGGAGATGGACCTCAGCGTGGTGCGGCTCA
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000508584.1; ENST00000226574.9; ENST00000513803.5; ENST00000652619.1; ENST00000394820.8; ENST00000505458.5; ENST00000510638.1; ENST00000600343.5; ENST00000651197.1; ENST00000652569.1
External Link	RMBase: m6A_site_645731
mod ID: M6ASITE066805		Click to Show/Hide the Full List
mod site	chr4:102579007-102579008:+		[10]
Sequence	AGCTTCACAAGGCGCCTGGAACCCGTGGTATCAGACGCCAT
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000513803.5; ENST00000505458.5; ENST00000600343.5; ENST00000652619.1; ENST00000508584.1; ENST00000226574.9; ENST00000510638.1; ENST00000394820.8; ENST00000651197.1; ENST00000652569.1
External Link	RMBase: m6A_site_645732
mod ID: M6ASITE066806		Click to Show/Hide the Full List
mod site	chr4:102580573-102580574:+		[10]
Sequence	CTTGAAAATTGTAAGAATGGACAGGACAGCTGGATGTGTGA
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000394820.8; ENST00000505458.5; ENST00000652569.1; ENST00000652619.1; ENST00000508584.1; ENST00000651197.1; ENST00000510638.1; ENST00000226574.9; ENST00000600343.5
External Link	RMBase: m6A_site_645733
mod ID: M6ASITE066807		Click to Show/Hide the Full List
mod site	chr4:102580578-102580579:+		[10]
Sequence	AAATTGTAAGAATGGACAGGACAGCTGGATGTGTGACTGGA
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000510638.1; ENST00000226574.9; ENST00000394820.8; ENST00000505458.5; ENST00000652619.1; ENST00000600343.5; ENST00000652569.1; ENST00000508584.1; ENST00000651197.1
External Link	RMBase: m6A_site_645734
mod ID: M6ASITE066808		Click to Show/Hide the Full List
mod site	chr4:102580624-102580625:+		[11]
Sequence	GGAAATTTATCTTCTTTGTGACAAAGTTCAGAAAGGTAAAT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000600343.5; ENST00000394820.8; ENST00000505458.5; ENST00000652619.1; ENST00000226574.9; ENST00000651197.1; ENST00000508584.1; ENST00000652569.1
External Link	RMBase: m6A_site_645735
mod ID: M6ASITE066809		Click to Show/Hide the Full List
mod site	chr4:102582868-102582869:+		[11]
Sequence	AATGTGATTGTTTGCAGATGACATCCAGATTCGATTTTATG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000394820.8; ENST00000226574.9; ENST00000651197.1; ENST00000652619.1; ENST00000652569.1; ENST00000508584.1; ENST00000600343.5; ENST00000505458.5
External Link	RMBase: m6A_site_645736
mod ID: M6ASITE066810		Click to Show/Hide the Full List
mod site	chr4:102594950-102594951:+		[10]
Sequence	GGATTACTTTCCATCCTGGAACTACTAAATCTAATGCTGGG
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000226574.9; ENST00000652569.1; ENST00000394820.8; ENST00000600343.5; ENST00000505458.5; ENST00000504044.1; ENST00000652619.1; ENST00000651197.1
External Link	RMBase: m6A_site_645737
mod ID: M6ASITE066811		Click to Show/Hide the Full List
mod site	chr4:102596139-102596140:+		[10]
Sequence	TTTTTGCATTTATCTTAGGAACCATGGACACTGAATCTAAA
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000504044.1; ENST00000652619.1; ENST00000394820.8; ENST00000652569.1; ENST00000226574.9; ENST00000505458.5; ENST00000651197.1; ENST00000600343.5
External Link	RMBase: m6A_site_645738
mod ID: M6ASITE066812		Click to Show/Hide the Full List
mod site	chr4:102596146-102596147:+		[10]
Sequence	ATTTATCTTAGGAACCATGGACACTGAATCTAAAAAGGACC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000505458.5; ENST00000226574.9; ENST00000652619.1; ENST00000394820.8; ENST00000504044.1; ENST00000651197.1; ENST00000652569.1; ENST00000600343.5
External Link	RMBase: m6A_site_645739
mod ID: M6ASITE066813		Click to Show/Hide the Full List
mod site	chr4:102596164-102596165:+		[10]
Sequence	GGACACTGAATCTAAAAAGGACCCTGAAGGTTGTGACAAAA
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000652619.1; ENST00000651197.1; ENST00000394820.8; ENST00000652569.1; ENST00000504044.1; ENST00000600343.5; ENST00000505458.5; ENST00000226574.9
External Link	RMBase: m6A_site_645740
mod ID: M6ASITE066814		Click to Show/Hide the Full List
mod site	chr4:102596197-102596198:+		[10]
Sequence	TGACAAAAGTGATGACAAAAACACTGTAAACCTCTTTGGGA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000504044.1; ENST00000394820.8; ENST00000652619.1; ENST00000652569.1; ENST00000651197.1; ENST00000505458.5; ENST00000600343.5; ENST00000226574.9
External Link	RMBase: m6A_site_645741
mod ID: M6ASITE066815		Click to Show/Hide the Full List
mod site	chr4:102596206-102596207:+		[10]
Sequence	TGATGACAAAAACACTGTAAACCTCTTTGGGAAAGTTATTG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000505458.5; ENST00000504044.1; ENST00000652569.1; ENST00000651197.1; ENST00000394820.8; ENST00000600343.5; ENST00000652619.1; ENST00000226574.9
External Link	RMBase: m6A_site_645742
mod ID: M6ASITE066816		Click to Show/Hide the Full List
mod site	chr4:102596229-102596230:+		[10]
Sequence	TCTTTGGGAAAGTTATTGAAACCACAGAGCAAGATCAGGAG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000652569.1; ENST00000600343.5; ENST00000226574.9; ENST00000394820.8; ENST00000504044.1; ENST00000652619.1; ENST00000651197.1; ENST00000505458.5
External Link	RMBase: m6A_site_645743
mod ID: M6ASITE066817		Click to Show/Hide the Full List
mod site	chr4:102596304-102596305:+		[10]
Sequence	CTCTAACGTATGCAACAGGAACAAAAGAAGAGAGTGCTGGA
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000651197.1; ENST00000652619.1; ENST00000652569.1; ENST00000226574.9; ENST00000600343.5; ENST00000504044.1; ENST00000505458.5; ENST00000394820.8
External Link	RMBase: m6A_site_645744
mod ID: M6ASITE066818		Click to Show/Hide the Full List
mod site	chr4:102600900-102600901:+		[11]
Sequence	TGTTTTCATTCCAGTGTCTTACACTTAGCAATCATCCACCT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000652569.1; ENST00000226574.9; ENST00000600343.5; ENST00000505458.5; ENST00000651197.1; ENST00000652619.1; ENST00000394820.8
External Link	RMBase: m6A_site_645745
mod ID: M6ASITE066819		Click to Show/Hide the Full List
mod site	chr4:102600955-102600956:+		[11]
Sequence	TGAGGGATCTACTAGAAGTCACATCTGGTTTGATTTCTGAT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000652569.1; ENST00000600343.5; ENST00000394820.8; ENST00000651197.1; ENST00000652619.1; ENST00000226574.9; ENST00000505458.5
External Link	RMBase: m6A_site_645746
mod ID: M6ASITE066820		Click to Show/Hide the Full List
mod site	chr4:102600986-102600987:+		[11]
Sequence	GATTTCTGATGACATTATCAACATGAGAAATGATCTGTACC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000651197.1; ENST00000394820.8; ENST00000652569.1; ENST00000505458.5; ENST00000652619.1; ENST00000600343.5; ENST00000226574.9
External Link	RMBase: m6A_site_645747
mod ID: M6ASITE066821		Click to Show/Hide the Full List
mod site	chr4:102606580-102606581:+		[10]
Sequence	GGCCGACCTGAGCCTTCTGGACCGCTTGGGTAACTCTGTTT
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000651197.1; ENST00000600343.5; ENST00000652569.1; ENST00000505458.5; ENST00000226574.9; ENST00000652619.1; ENST00000394820.8
External Link	RMBase: m6A_site_645748
mod ID: M6ASITE066822		Click to Show/Hide the Full List
mod site	chr4:102606623-102606624:+		[10]
Sequence	CACCTAGCTGCCAAAGAAGGACATGATAAAGTTCTCAGTAT
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000600343.5; ENST00000226574.9; ENST00000505458.5; ENST00000651197.1; ENST00000394820.8; ENST00000652569.1; ENST00000652619.1
External Link	RMBase: m6A_site_645749
mod ID: M6ASITE066823		Click to Show/Hide the Full List
mod site	chr4:102606655-102606656:+		[11]
Sequence	TCTCAGTATCTTACTCAAGCACAAAAAGGCAGCACTACTTC
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000226574.9; ENST00000505458.5; ENST00000652569.1; ENST00000651197.1; ENST00000600343.5; ENST00000394820.8; ENST00000652619.1
External Link	RMBase: m6A_site_645750
mod ID: M6ASITE066824		Click to Show/Hide the Full List
mod site	chr4:102610595-102610596:+		[12]
Sequence	AGCAGATCCCCTGGTGGAGAACTTTGAGCCTCTCTATGACC
Motif Score	3.373380952
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000394820.8; ENST00000505458.5; ENST00000652569.1; ENST00000226574.9; ENST00000651197.1; ENST00000652619.1; ENST00000600343.5
External Link	RMBase: m6A_site_645751
mod ID: M6ASITE066825		Click to Show/Hide the Full List
mod site	chr4:102610666-102610667:+		[10]
Sequence	ATGAAGGAGTTGTGCCTGGAACCACGCCTCTAGATATGGCC
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000600343.5; ENST00000652619.1; ENST00000651197.1; ENST00000394820.8; ENST00000652569.1; ENST00000226574.9; ENST00000505458.5
External Link	RMBase: m6A_site_645752
mod ID: M6ASITE066826		Click to Show/Hide the Full List
mod site	chr4:102612066-102612067:+		[10]
Sequence	TTTGACATATTAAATGGGAAACCATATGAGCCAGAGTTTAC
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000651197.1; ENST00000652569.1; ENST00000600343.5; ENST00000394820.8; ENST00000226574.9; ENST00000652619.1; ENST00000505458.5
External Link	RMBase: m6A_site_645753
mod ID: M6ASITE066827		Click to Show/Hide the Full List
mod site	chr4:102612502-102612503:+		[10]
Sequence	ACTAGAAATTCCTGATCCAGACAAAAACTGGGCTACTCTGG
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000652569.1; ENST00000226574.9; ENST00000651197.1; ENST00000652619.1; ENST00000505458.5; ENST00000600343.5; ENST00000394820.8
External Link	RMBase: m6A_site_645754
mod ID: M6ASITE066828		Click to Show/Hide the Full List
mod site	chr4:102612508-102612509:+		[10]
Sequence	AATTCCTGATCCAGACAAAAACTGGGCTACTCTGGCGCAGA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000600343.5; ENST00000505458.5; ENST00000394820.8; ENST00000651197.1; ENST00000226574.9; ENST00000652619.1; ENST00000652569.1
External Link	RMBase: m6A_site_645755
mod ID: M6ASITE066829		Click to Show/Hide the Full List
mod site	chr4:102612545-102612546:+		[13]
Sequence	CAGAAATTAGGTCTGGGGATACTTAATAATGCCTTCCGGCT
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000505458.5; ENST00000600343.5; ENST00000651197.1; ENST00000226574.9; ENST00000652569.1; ENST00000394820.8; ENST00000652619.1
External Link	RMBase: m6A_site_645756
mod ID: M6ASITE066830		Click to Show/Hide the Full List
mod site	chr4:102612585-102612586:+		[10]
Sequence	TGAGTCCTGCTCCTTCCAAAACACTTATGGACAACTATGAG
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000651197.1; ENST00000394820.8; ENST00000226574.9; ENST00000600343.5; ENST00000505458.5; ENST00000652619.1; ENST00000652569.1
External Link	RMBase: m6A_site_645757
mod ID: M6ASITE066831		Click to Show/Hide the Full List
mod site	chr4:102612595-102612596:+		[10]
Sequence	TCCTTCCAAAACACTTATGGACAACTATGAGGTAACACCTT
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000652619.1; ENST00000600343.5; ENST00000226574.9; ENST00000505458.5; ENST00000651197.1; ENST00000652569.1; ENST00000394820.8
External Link	RMBase: m6A_site_645758
mod ID: M6ASITE066832		Click to Show/Hide the Full List
mod site	chr4:102613476-102613477:+		[11]
Sequence	GGCCCTGAGACAAATGGGCTACACCGAAGCAATTGAAGTGA
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000652569.1; ENST00000651197.1; ENST00000505458.5; ENST00000652619.1; ENST00000226574.9; ENST00000394820.8; ENST00000600343.5
External Link	RMBase: m6A_site_645759
mod ID: M6ASITE066833		Click to Show/Hide the Full List
mod site	chr4:102613523-102613524:+		[14]
Sequence	CAGCCTCCAGCCCAGTGAAGACCACCTCTCAGGCCCACTCG
Motif Score	2.876744048
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000652569.1; ENST00000651197.1; ENST00000226574.9; ENST00000394820.8; ENST00000505458.5; ENST00000652619.1; ENST00000600343.5
External Link	RMBase: m6A_site_645760
mod ID: M6ASITE066834		Click to Show/Hide the Full List
mod site	chr4:102613565-102613566:+		[11]
Sequence	TGCCTCTCTCGCCTGCCTCCACAAGGCAGCAAATAGGTAAA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000652569.1; ENST00000651197.1; ENST00000600343.5; ENST00000394820.8; ENST00000226574.9; ENST00000505458.5; ENST00000652619.1
External Link	RMBase: m6A_site_645761
mod ID: M6ASITE066835		Click to Show/Hide the Full List
mod site	chr4:102616445-102616446:+		[15]
Sequence	CCCCTCAGACGAGCTCCGAGACAGTGACAGTGTCTGCGACA
Motif Score	2.897386905
Cell/Tissue List	liver; endometrial
Seq Type List	m6A-REF-seq; m6A-seq
Transcript ID List	ENST00000505458.5; ENST00000651197.1; ENST00000226574.9; ENST00000652619.1; ENST00000652569.1; ENST00000600343.5; ENST00000394820.8
External Link	RMBase: m6A_site_645762
mod ID: M6ASITE066836		Click to Show/Hide the Full List
mod site	chr4:102616463-102616464:+		[15]
Sequence	AGACAGTGACAGTGTCTGCGACAGCGGCGTGGAGACATCCT
Motif Score	2.865571429
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000652569.1; ENST00000600343.5; ENST00000226574.9; ENST00000505458.5; ENST00000651197.1; ENST00000652619.1; ENST00000394820.8
External Link	RMBase: m6A_site_645763
mod ID: M6ASITE066837		Click to Show/Hide the Full List
mod site	chr4:102616477-102616478:+		[11]
Sequence	TCTGCGACAGCGGCGTGGAGACATCCTTCCGCAAACTCAGC
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T; HeLa; endometrial
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000505458.5; ENST00000652569.1; ENST00000651197.1; ENST00000600343.5; ENST00000652619.1; ENST00000394820.8; ENST00000226574.9
External Link	RMBase: m6A_site_645764
mod ID: M6ASITE066838		Click to Show/Hide the Full List
mod site	chr4:102616491-102616492:+		[16]
Sequence	GTGGAGACATCCTTCCGCAAACTCAGCTTTACCGAGTCTCT
Motif Score	2.627720238
Cell/Tissue List	HeLa; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000226574.9; ENST00000652569.1; ENST00000505458.5; ENST00000651197.1; ENST00000652619.1; ENST00000394820.8; ENST00000600343.5
External Link	RMBase: m6A_site_645765
mod ID: M6ASITE066839		Click to Show/Hide the Full List
mod site	chr4:102616534-102616535:+		[17]
Sequence	CCAGTGGTGCCTCACTGCTAACTCTCAACAAAATGCCCCAT
Motif Score	2.590089286
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000600343.5; ENST00000226574.9; ENST00000651197.1; ENST00000505458.5; ENST00000652569.1; ENST00000652619.1; ENST00000394820.8
External Link	RMBase: m6A_site_645766
mod ID: M6ASITE066840		Click to Show/Hide the Full List
mod site	chr4:102616541-102616542:+		[11]
Sequence	TGCCTCACTGCTAACTCTCAACAAAATGCCCCATGATTATG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T; CD8T; A549
Seq Type List	MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000600343.5; ENST00000652619.1; ENST00000505458.5; ENST00000651197.1; ENST00000394820.8; ENST00000226574.9; ENST00000652569.1
External Link	RMBase: m6A_site_645767
mod ID: M6ASITE066841		Click to Show/Hide the Full List
mod site	chr4:102616572-102616573:+		[18]
Sequence	CATGATTATGGGCAGGAAGGACCTCTAGAAGGCAAAATTTA
Motif Score	3.622404762
Cell/Tissue List	HEK293T; HeLa; fibroblasts; A549; LCLs; CD8T; Huh7; MSC; TIME; TREX
Seq Type List	MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000600343.5; ENST00000505458.5; ENST00000652619.1; ENST00000226574.9; ENST00000651197.1; ENST00000394820.8; ENST00000652569.1
External Link	RMBase: m6A_site_645768
mod ID: M6ASITE066842		Click to Show/Hide the Full List
mod site	chr4:102616601-102616602:+		[11]
Sequence	AGGCAAAATTTAGCCTGCTGACAATTTCCCACACCGTGTAA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T; CD8T
Seq Type List	MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000226574.9; ENST00000600343.5; ENST00000652569.1; ENST00000505458.5; ENST00000394820.8; ENST00000652619.1; ENST00000651197.1
External Link	RMBase: m6A_site_645769
mod ID: M6ASITE066843		Click to Show/Hide the Full List
mod site	chr4:102616611-102616612:+		[11]
Sequence	TAGCCTGCTGACAATTTCCCACACCGTGTAAACCAAAGCCC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000226574.9; ENST00000600343.5; ENST00000505458.5; ENST00000652569.1; ENST00000652619.1; ENST00000651197.1; ENST00000394820.8
External Link	RMBase: m6A_site_645770
mod ID: M6ASITE066844		Click to Show/Hide the Full List
mod site	chr4:102616622-102616623:+		[10]
Sequence	CAATTTCCCACACCGTGTAAACCAAAGCCCTAAAATTCCAC
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293T; fibroblasts; A549; LCLs; MT4; Huh7; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000394820.8; ENST00000652569.1; ENST00000652619.1; ENST00000505458.5; ENST00000226574.9; ENST00000600343.5; ENST00000651197.1
External Link	RMBase: m6A_site_645771
mod ID: M6ASITE066845		Click to Show/Hide the Full List
mod site	chr4:102616653-102616654:+		[11]
Sequence	AAAATTCCACTGCGTTGTCCACAAGACAGAAGCTGAAGTGC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000505458.5; ENST00000394820.8; ENST00000651197.1; ENST00000652569.1; ENST00000600343.5; ENST00000226574.9; ENST00000652619.1
External Link	RMBase: m6A_site_645772
mod ID: M6ASITE066846		Click to Show/Hide the Full List
mod site	chr4:102616658-102616659:+		[18]
Sequence	TCCACTGCGTTGTCCACAAGACAGAAGCTGAAGTGCATCCA
Motif Score	2.897386905
Cell/Tissue List	HEK293T; HeLa; fibroblasts; A549; LCLs; MT4; Huh7; iSLK; MSC; TIME; TREX
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000600343.5; ENST00000505458.5; ENST00000394820.8; ENST00000652619.1; ENST00000651197.1; ENST00000226574.9; ENST00000652569.1
External Link	RMBase: m6A_site_645773
mod ID: M6ASITE066847		Click to Show/Hide the Full List
mod site	chr4:102616729-102616730:+		[16]
Sequence	CATTCTCGATTTAACTCGAGACCTTTTCAACTTGGCTTCCT
Motif Score	2.876744048
Cell/Tissue List	HeLa; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000652619.1; ENST00000651197.1; ENST00000394820.8; ENST00000226574.9; ENST00000652569.1; ENST00000505458.5; ENST00000600343.5
External Link	RMBase: m6A_site_645774

Ref 1	YTHDF2 facilitates UBXN1 mRNA decay by recognizing METTL3-mediated m(6)A modification to activate NF-KappaB and promote the malignant progression of glioma. J Hematol Oncol. 2021 Jul 10;14(1):109. doi: 10.1186/s13045-021-01124-z.
Ref 2	m(6)A mRNA methylation-directed myeloid cell activation controls progression of NAFLD and obesity. Cell Rep. 2021 Nov 9;37(6):109968. doi: 10.1016/j.celrep.2021.109968.
Ref 3	METTL3/METTL14 Transactivation and m(6)A-Dependent TGF-Beta1 Translation in Activated Kupffer Cells. Cell Mol Gastroenterol Hepatol. 2021;12(3):839-856. doi: 10.1016/j.jcmgh.2021.05.007. Epub 2021 May 13.
Ref 4	WTAP facilitates progression of endometrial cancer via CAV-1/NF-KappaB axis. Cell Biol Int. 2021 Jun;45(6):1269-1277. doi: 10.1002/cbin.11570. Epub 2021 Feb 19.
Ref 5	Mettl14 mediates the inflammatory response of macrophages in atherosclerosis through the NF-KappaB/IL-6 signaling pathway. Cell Mol Life Sci. 2022 May 22;79(6):311. doi: 10.1007/s00018-022-04331-0.
Ref 6	Anti-IP-10 antibody (BMS-936557) for ulcerative colitis: a phase II randomised study. Gut. 2014 Mar;63(3):442-50. doi: 10.1136/gutjnl-2012-303424. Epub 2013 Mar 5.
Ref 7	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 8	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 9	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 10	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 11	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 12	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 13	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 14	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 15	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 16	N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27.
Ref 17	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 18	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map