m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00255)

Target Name	Hepatocyte nuclear factor 3-gamma (HNF3gamma/FOXA3)
Synonyms	HNF-3-gamma; HNF-3G; Fork head-related protein FKH H3; Forkhead box protein A3; Transcription factor 3G; TCF-3G; HNF3G; TCF3G Click to Show/Hide
Gene Name	FOXA3
Chromosomal Location	19q13.32
Function	Transcription factor that is thought to act as a 'pioneer' factor opening the compacted chromatin for other proteins through interactions with nucleosomal core histones and thereby replacing linker histones at target enhancer and/or promoter sites (By similarity). Originally described as a transcription activator for a number of liver genes such as AFP, albumin, tyrosine aminotransferase, PEPCK, etc. Interacts with the cis-acting regulatory regions of these genes. Involved in glucose homeostasis; binds to and activates transcription from the G6PC1 promoter. Binds to the CYP3A4 promoter and activates its transcription in cooperation with CEBPA. Binds to the CYP3A7 promoter together with members of the CTF/NF-I family. Involved in regulation of neuronal-specific transcription. May be involved in regulation of spermatogenesis. Click to Show/Hide
Gene ID	3171
Uniprot ID	FOXA3_HUMAN
HGNC ID	HGNC:5023
KEGG ID	hsa:3171

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

FOXA3 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	mouse embryonic stem cells	Mus musculus
Treatment: METTL14-/- ESCs Control: Wild type ESCs		GSE145309
Regulation		logFC: -4.46E+00 p-value: 6.08E-19
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	The Hepatocyte nuclear factor 3-gamma (HNF3gamma/FOXA3) reduction in hepatocellular carcinoma could be mediated by METTL14-dependent m6A methylation of HNF3-Gamma mRNA. HNF3-Gamma plays an essential role in HCC differentiation and serves as a therapeutic target and predictor of sorafenib benefit in patients.
Target Regulation	Down regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Responsed Drug	Sorafenib		Approved	Drug Info
Cell Process	Membrane transport
	Cell apoptosis
In-vitro Model	HCCLM3	Adult hepatocellular carcinoma	Homo sapiens	CVCL_6832
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
In-vivo Model	When xenografted tumor growth reached 500 mm³, the mice were subjected to intratumoral injection of Ad-con or Ad-HNF3γ every other day. For the PDX model, fresh patient HCC tissues were cut into fragments with a volume of 3 × 3 mm³ and then implanted subcutaneously into the flanks of nude mice. The mice were given sorafenib (30 mg/kg) or vehicle orally twice a week for 24 days.

Liver cancer [ICD-11: 2C12]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	The Hepatocyte nuclear factor 3-gamma (HNF3gamma/FOXA3) reduction in hepatocellular carcinoma could be mediated by METTL14-dependent m6A methylation of HNF3-Gamma mRNA. HNF3-Gamma plays an essential role in HCC differentiation and serves as a therapeutic target and predictor of sorafenib benefit in patients.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Sorafenib		Approved	Drug Info
Cell Process	Membrane transport
	Cell apoptosis
In-vitro Model	HCCLM3	Adult hepatocellular carcinoma	Homo sapiens	CVCL_6832
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
In-vivo Model	When xenografted tumor growth reached 500 mm³, the mice were subjected to intratumoral injection of Ad-con or Ad-HNF3γ every other day. For the PDX model, fresh patient HCC tissues were cut into fragments with a volume of 3 × 3 mm³ and then implanted subcutaneously into the flanks of nude mice. The mice were given sorafenib (30 mg/kg) or vehicle orally twice a week for 24 days.

Sorafenib [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	The Hepatocyte nuclear factor 3-gamma (HNF3gamma/FOXA3) reduction in hepatocellular carcinoma could be mediated by METTL14-dependent m6A methylation of HNF3-Gamma mRNA. HNF3-Gamma plays an essential role in HCC differentiation and serves as a therapeutic target and predictor of sorafenib benefit in patients.
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Cell Process	Membrane transport
	Cell apoptosis
In-vitro Model	HCCLM3	Adult hepatocellular carcinoma	Homo sapiens	CVCL_6832
	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
In-vivo Model	When xenografted tumor growth reached 500 mm³, the mice were subjected to intratumoral injection of Ad-con or Ad-HNF3γ every other day. For the PDX model, fresh patient HCC tissues were cut into fragments with a volume of 3 × 3 mm³ and then implanted subcutaneously into the flanks of nude mice. The mice were given sorafenib (30 mg/kg) or vehicle orally twice a week for 24 days.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00255)

Hepatocyte nuclear factor 3-gamma (HNF3gamma/FOXA3)

N6-methyladenosine (m6A)

In total 14 m6A sequence/site(s) in this target gene
mod ID: M6ASITE041571		Click to Show/Hide the Full List
mod site	chr19:45872193-45872194:+		[2]
Sequence	GCCTCCCCACTGCCCTCAGGACCCCTGGCACCCCCAGCACC
Motif Score	3.622404762
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000302177.3; ENST00000594297.1
External Link	RMBase: m6A_site_444859
mod ID: M6ASITE041572		Click to Show/Hide the Full List
mod site	chr19:45872450-45872451:+		[3]
Sequence	AATCTACCAGTGGATCATGGACCTCTTCCCTTACTACCGGG
Motif Score	3.622404762
Cell/Tissue List	HepG2; H1A; H1B; hESCs; fibroblasts; A549; Huh7; HEK293T; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000302177.3
External Link	RMBase: m6A_site_444860
mod ID: M6ASITE041573		Click to Show/Hide the Full List
mod site	chr19:45872492-45872493:+		[4]
Sequence	GAATCAGCAGCGCTGGCAGAACTCCATTCGCCACTCGCTGT
Motif Score	3.373380952
Cell/Tissue List	HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; Huh7; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000302177.3
External Link	RMBase: m6A_site_444861
mod ID: M6ASITE041574		Click to Show/Hide the Full List
mod site	chr19:45872552-45872553:+		[4]
Sequence	CAAGGTGGCGCGTTCCCCAGACAAGCCTGGCAAGGGCTCCT
Motif Score	2.897386905
Cell/Tissue List	HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; Huh7; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000302177.3
External Link	RMBase: m6A_site_444862
mod ID: M6ASITE041575		Click to Show/Hide the Full List
mod site	chr19:45872600-45872601:+		[4]
Sequence	CCTACACCCCAGCTCAGGGAACATGTTTGAGAATGGCTGCT
Motif Score	2.951386905
Cell/Tissue List	HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; Huh7; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000302177.3
External Link	RMBase: m6A_site_444863
mod ID: M6ASITE041576		Click to Show/Hide the Full List
mod site	chr19:45872704-45872705:+		[4]
Sequence	CCACCACCACCAGGAACGGGACAGGGTCTGCTGCCTCGACC
Motif Score	3.643047619
Cell/Tissue List	HepG2; HEK293T; A549; H1A; H1B; hESCs; fibroblasts; Huh7; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000302177.3
External Link	RMBase: m6A_site_444864
mod ID: M6ASITE041577		Click to Show/Hide the Full List
mod site	chr19:45872819-45872820:+		[4]
Sequence	GGAAGATGTGGGGGCTCTGGACTGTGGCTCACCCGCTTCCT
Motif Score	4.065041667
Cell/Tissue List	HepG2; HEK293T; A549; H1A; H1B; hESCs; GM12878; Huh7; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000302177.3
External Link	RMBase: m6A_site_444865
mod ID: M6ASITE041578		Click to Show/Hide the Full List
mod site	chr19:45872940-45872941:+		[4]
Sequence	ATCAACAACCTAATGTCAGAACAGACACCAGCACCTCCCAA
Motif Score	2.951386905
Cell/Tissue List	HepG2; A549; HEK293T; H1A; H1B; hESCs; fibroblasts; GM12878; Huh7; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000302177.3
External Link	RMBase: m6A_site_444866
mod ID: M6ASITE041579		Click to Show/Hide the Full List
mod site	chr19:45872961-45872962:+		[4]
Sequence	CAGACACCAGCACCTCCCAAACTGGACGTGGGGTTTGGGGG
Motif Score	2.627720238
Cell/Tissue List	HepG2; A549; HEK293T; H1A; H1B; hESCs; fibroblasts; GM12878; Huh7; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000302177.3
External Link	RMBase: m6A_site_444867
mod ID: M6ASITE041580		Click to Show/Hide the Full List
mod site	chr19:45873070-45873071:+		[4]
Sequence	CATCCTAGCAGGGGTTGGGAACATGGTGGTGGGTATGGCTG
Motif Score	2.951386905
Cell/Tissue List	HepG2; A549; H1A; H1B; hESCs; Huh7; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000302177.3
External Link	RMBase: m6A_site_444868
mod ID: M6ASITE041581		Click to Show/Hide the Full List
mod site	chr19:45873248-45873249:+		[5]
Sequence	CTGTGATAACCACCATGGATACATTTTGGTGGCCCACTGGG
Motif Score	2.110482143
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000302177.3
External Link	RMBase: m6A_site_444869
mod ID: M6ASITE041582		Click to Show/Hide the Full List
mod site	chr19:45873279-45873280:+		[4]
Sequence	GCCCACTGGGTACTGTGAGGACTGCTACATTGATGGATGTT
Motif Score	4.065041667
Cell/Tissue List	HepG2; A549; H1B; hESCs; fibroblasts; Huh7; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000302177.3
External Link	RMBase: m6A_site_444870
mod ID: M6ASITE041583		Click to Show/Hide the Full List
mod site	chr19:45873505-45873506:+		[6]
Sequence	CCCATTGGGTGCTTTGATGGACATCATACTGGGTAGGTGAC
Motif Score	3.643047619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000302177.3
External Link	RMBase: m6A_site_444871
mod ID: M6ASITE041584		Click to Show/Hide the Full List
mod site	chr19:45873686-45873687:+		[2]
Sequence	CCAACTCTGGTCCAGGAGAAACCAGAAAAGGCTGGTTAGGG
Motif Score	2.185083333
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000302177.3
External Link	RMBase: m6A_site_444872

Ref 1	m6A RNA methylation-mediated HNF3Gamma reduction renders hepatocellular carcinoma dedifferentiation and sorafenib resistance. Signal Transduct Target Ther. 2020 Dec 26;5(1):296. doi: 10.1038/s41392-020-00299-0.
Ref 2	[Action myoclonias and paranoid alternative psychosis in progressive myoclonic epilepsy (late form of the Lafora type)]. Nervenarzt. 1986 Apr;57(4):233-7.
Ref 3	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.
Ref 4	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 5	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 6	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map