m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR01735)
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05192 | ||
| Epigenetic Regulator | LOC101928222 | |
| Regulated Target | Insulin like growth factor 2 mRNA binding protein 1 (IGF2BP1) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Colorectal cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01735)
| In total 10 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE046097 | Click to Show/Hide the Full List | ||
| mod site | chr1:119748281-119748282:- | [2] | |
| Sequence | GAGGGCTGGGTCCTTGCCTCACAGGCTGCCTCTGTCCCCTT | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000369406.7 | ||
| External Link | RMBase: m6A_site_48274 | ||
| mod ID: M6ASITE046098 | Click to Show/Hide the Full List | ||
| mod site | chr1:119759961-119759962:- | [3] | |
| Sequence | TGCCATGGTGGTCTGTGGAGACATTGCCGTCTATCCCAGTG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | iSLK | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000369406.7; ENST00000476640.1; ENST00000544913.2 | ||
| External Link | RMBase: m6A_site_48275 | ||
| mod ID: M6ASITE046099 | Click to Show/Hide the Full List | ||
| mod site | chr1:119764289-119764290:- | [3] | |
| Sequence | GTCAAAACAGTGCTCATGGAACTCTTCCAGGATTCAGGCAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | iSLK | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000544913.2; ENST00000476640.1; ENST00000369406.7 | ||
| External Link | RMBase: m6A_site_48276 | ||
| mod ID: M6ASITE046100 | Click to Show/Hide the Full List | ||
| mod site | chr1:119764303-119764304:- | [3] | |
| Sequence | ACAAGTCCAAAGCTGTCAAAACAGTGCTCATGGAACTCTTC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | iSLK | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000369406.7; ENST00000476640.1; ENST00000544913.2 | ||
| External Link | RMBase: m6A_site_48277 | ||
| mod ID: M6ASITE046101 | Click to Show/Hide the Full List | ||
| mod site | chr1:119764333-119764334:- | [3] | |
| Sequence | GGCTGGAAGTAGGCACTGAGACCATCATTGACAAGTCCAAA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | iSLK | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000369406.7; ENST00000544913.2; ENST00000476640.1 | ||
| External Link | RMBase: m6A_site_48278 | ||
| mod ID: M6ASITE046102 | Click to Show/Hide the Full List | ||
| mod site | chr1:119764365-119764366:- | [3] | |
| Sequence | GCGCATACAGCTCCCATGGGACTCTGTGGGCAGGCTGGAAG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | iSLK | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000369406.7; ENST00000476640.1; ENST00000544913.2 | ||
| External Link | RMBase: m6A_site_48279 | ||
| mod ID: M6ASITE046103 | Click to Show/Hide the Full List | ||
| mod site | chr1:119764428-119764429:- | [2] | |
| Sequence | CTTCTGCTCAGTCCAAGAGGACATCAACTCCCTGTGCCTGA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | kidney; liver; iSLK | ||
| Seq Type List | m6A-REF-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000476640.1; ENST00000369406.7; ENST00000544913.2 | ||
| External Link | RMBase: m6A_site_48280 | ||
| mod ID: M6ASITE046104 | Click to Show/Hide the Full List | ||
| mod site | chr1:119764459-119764460:- | [3] | |
| Sequence | ATACAGTGGGCTTGGGCCAGACCCGTATGGGCTTCTGCTCA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | iSLK | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000476640.1; ENST00000369406.7; ENST00000544913.2 | ||
| External Link | RMBase: m6A_site_48281 | ||
| mod ID: M6ASITE046105 | Click to Show/Hide the Full List | ||
| mod site | chr1:119764591-119764592:- | [2] | |
| Sequence | CTGCTGTCCCCCTGGCCAAAACAGATACTTGGCCAAAGGAC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | kidney; liver; iSLK | ||
| Seq Type List | m6A-REF-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000544913.2; ENST00000476640.1; ENST00000369406.7 | ||
| External Link | RMBase: m6A_site_48282 | ||
| mod ID: M6ASITE046106 | Click to Show/Hide the Full List | ||
| mod site | chr1:119768783-119768784:- | [3] | |
| Sequence | TGACAAGAGCGGTGCAGGAAACCTCCCTCACACCTGCTCGC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | iSLK | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000544913.2; ENST00000369406.7 | ||
| External Link | RMBase: m6A_site_48283 | ||
References