m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR01718)
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Fat mass and obesity-associated protein (FTO)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05125 | ||
| Epigenetic Regulator | Circ_CELF1 | |
| Regulated Target | FTO alpha-ketoglutarate dependent dioxygenase (FTO) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Myocardial Fibrosis | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01718)
| In total 3 m6A sequence/site(s) in this target gene | |||
| mod ID: 2OMSITE000343 | Click to Show/Hide the Full List | ||
| mod site | chr4:107003639-107003640:- | [2] | |
| Sequence | CTGGTGTATATGCTTGGCTGAGGAGCCAATGGGGCACAACT | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | 2OMe-seq | ||
| Transcript ID List | ENST00000513208.5; rmsk_1401695; ENST00000285311.8; ENST00000510534.1; ENST00000510463.1 | ||
| External Link | RMBase: Nm_site_5253 | ||
| mod ID: 2OMSITE000341 | Click to Show/Hide the Full List | ||
| mod site | chr4:107003635-107003636:- | [3] | |
| Sequence | TGTATATGCTTGGCTGAGGAGCCAATGGGGCACAACTACCA | ||
| Cell/Tissue List | PA1 | ||
| Seq Type List | RibOxi-seq | ||
| Transcript ID List | ENST00000510534.1; ENST00000285311.8; rmsk_1401695; ENST00000513208.5; ENST00000510463.1 | ||
| External Link | RMBase: Nm_site_5251 | ||
| mod ID: 2OMSITE000342 | Click to Show/Hide the Full List | ||
| mod site | chr4:107003637-107003638:- | [2] | |
| Sequence | GGTGTATATGCTTGGCTGAGGAGCCAATGGGGCACAACTAC | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | 2OMe-seq | ||
| Transcript ID List | ENST00000510534.1; ENST00000510463.1; rmsk_1401695; ENST00000513208.5; ENST00000285311.8 | ||
| External Link | RMBase: Nm_site_5252 | ||
N6-methyladenosine (m6A)
| In total 6 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE067014 | Click to Show/Hide the Full List | ||
| mod site | chr4:106923796-106923797:- | [4] | |
| Sequence | AAGGGAGAAAGAAAACATGAACTGAATAGATTAGAATGGGT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000285311.8; ENST00000513208.5 | ||
| External Link | RMBase: m6A_site_646833 | ||
| mod ID: M6ASITE067015 | Click to Show/Hide the Full List | ||
| mod site | chr4:106923802-106923803:- | [4] | |
| Sequence | CACAAAAAGGGAGAAAGAAAACATGAACTGAATAGATTAGA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000285311.8; ENST00000513208.5 | ||
| External Link | RMBase: m6A_site_646834 | ||
| mod ID: M6ASITE067016 | Click to Show/Hide the Full List | ||
| mod site | chr4:106923923-106923924:- | [4] | |
| Sequence | AGGAACATCATCAATTGCAGACTGTGAAGTTGTGTATTTAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000513208.5; ENST00000285311.8; ENST00000510534.1 | ||
| External Link | RMBase: m6A_site_646835 | ||
| mod ID: M6ASITE067017 | Click to Show/Hide the Full List | ||
| mod site | chr4:106923939-106923940:- | [4] | |
| Sequence | AATTTGATCACCATTGAGGAACATCATCAATTGCAGACTGT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000513208.5; ENST00000285311.8; ENST00000510534.1 | ||
| External Link | RMBase: m6A_site_646836 | ||
| mod ID: M6ASITE067018 | Click to Show/Hide the Full List | ||
| mod site | chr4:106923977-106923978:- | [4] | |
| Sequence | ACCTACTCCTCCAAAGCCAGACTCCATGTGTGTCAGAAAAT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000285311.8; ENST00000513208.5; ENST00000510534.1; ENST00000510463.1 | ||
| External Link | RMBase: m6A_site_646837 | ||
| mod ID: M6ASITE067019 | Click to Show/Hide the Full List | ||
| mod site | chr4:107003374-107003375:- | [5] | |
| Sequence | TAGGGCCTAAAAGATGGTGAACTATGCCTGAGCAGAGGAAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | AML | ||
| Seq Type List | miCLIP | ||
| Transcript ID List | ENST00000285311.8; ENST00000510463.1; ENST00000513208.5; ENST00000510534.1; rmsk_1401694 | ||
| External Link | RMBase: m6A_site_646838 | ||
References