m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR01689)

Target Name	Fatty-acid amide hydrolase 1 (FAAH)
Synonyms	EC 3.5.1.99; Anandamide amidohydrolase 1; Fatty acid ester hydrolase; EC 3.1.1.-; Oleamide hydrolase 1 Click to Show/Hide
Gene Name	FAAH
Chromosomal Location	1p33
Family	Amidase family
Function	Catalyzes the hydrolysis of endogenous amidated lipids like the sleep-inducing lipid oleamide ((9Z)-octadecenamide), the endocannabinoid anandamide (N-(5Z,8Z,11Z,14Z-eicosatetraenoyl)-ethanolamine), as well as other fatty amides, to their corresponding fatty acids, thereby regulating the signaling functions of these molecules (PubMed:9122178, PubMed:17015445, PubMed:19926788). Hydrolyzes polyunsaturated substrate anandamide preferentially as compared to monounsaturated substrates (PubMed:9122178, PubMed:17015445). It can also catalyze the hydrolysis of the endocannabinoid 2-arachidonoylglycerol (2-(5Z,8Z,11Z,14Z-eicosatetraenoyl)-glycerol) (PubMed:21049984). FAAH cooperates with PM20D1 in the hydrolysis of amino acid-conjugated fatty acids such as N-fatty acyl glycine and N-fatty acyl-L-serine, thereby acting as a physiological regulator of specific subsets of intracellular, but not of extracellular, N-fatty acyl amino acids (By similarity). Click to Show/Hide
Gene ID	2166
Uniprot ID	FAAH1_HUMAN
HGNC ID	HGNC:3553
KEGG ID	hsa:2166

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05059		Crosstalk Info
Epigenetic Regulator	Circ_STAG1
Regulated Target	RNA demethylase ALKBH5 (ALKBH5)
Crosstalk relationship	ncRNA → m6A
Disease	Major depressive disorder	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01689)

Fatty-acid amide hydrolase 1 (FAAH)

Adenosine-to-Inosine editing (A-to-I)

In total 3 m6A sequence/site(s) in this target gene
mod ID: A2ISITE007697		Click to Show/Hide the Full List
mod site	chr1:46407116-46407117:+		[2]
Sequence	TACGTGAGCCAGGGTCTGCAAGCAGCGTGGTGTGCTGCTCC
Transcript ID List	ENST00000243167.9; ENST00000489366.2; ENST00000493735.5; ENST00000484697.5
External Link	RMBase: RNA-editing_site_5430
mod ID: A2ISITE007698		Click to Show/Hide the Full List
mod site	chr1:46408186-46408187:+		[2]
Sequence	CTTGTCACTCTGCATTGGGTAGCTTTGGGCAAGTCCCAGTC
Transcript ID List	ENST00000489366.2; rmsk_107861; ENST00000484697.5; ENST00000243167.9; ENST00000493735.5
External Link	RMBase: RNA-editing_site_5431
mod ID: A2ISITE007699		Click to Show/Hide the Full List
mod site	chr1:46409291-46409292:+		[2]
Sequence	GTGATGCCTGGATGGGCCTTAGCTGAATCCAACAAAGGCCT
Transcript ID List	ENST00000243167.9; ENST00000484697.5
External Link	RMBase: RNA-editing_site_5432

N6-methyladenosine (m6A)

In total 11 m6A sequence/site(s) in this target gene
mod ID: M6ASITE024247		Click to Show/Hide the Full List
mod site	chr1:46405378-46405379:+		[3]
Sequence	TCCCTCCTCCCAGGGCCAGGACTCCACGCTGGGCTTGAGCC
Motif Score	4.065041667
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000243167.9; ENST00000468718.5; ENST00000493735.5
External Link	RMBase: m6A_site_28986
mod ID: M6ASITE024248		Click to Show/Hide the Full List
mod site	chr1:46405477-46405478:+		[4]
Sequence	GGGTGCCGTGCCCTTCGTGCACACCAATGTTCCACAGTCCA
Motif Score	2.830589286
Cell/Tissue List	brain
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000493735.5; ENST00000243167.9; ENST00000468718.5
External Link	RMBase: m6A_site_28987
mod ID: M6ASITE024249		Click to Show/Hide the Full List
mod site	chr1:46405618-46405619:+		[3]
Sequence	GTAACCCCCTCTTTGGCCAGACCGTGAACCCATGGAAGTCC
Motif Score	2.876744048
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000468718.5; ENST00000243167.9; ENST00000493735.5
External Link	RMBase: m6A_site_28988
mod ID: M6ASITE024250		Click to Show/Hide the Full List
mod site	chr1:46405625-46405626:+		[3]
Sequence	CCTCTTTGGCCAGACCGTGAACCCATGGAAGTCCTCCAAAA
Motif Score	2.930744048
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000468718.5; ENST00000493735.5; ENST00000243167.9
External Link	RMBase: m6A_site_28989
mod ID: M6ASITE024251		Click to Show/Hide the Full List
mod site	chr1:46405777-46405778:+		[4]
Sequence	GCATCTGCGGCCTCAAGCCCACAGGGAACCGCCTCAGGTAA
Motif Score	2.053113095
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000484697.5; ENST00000493735.5; ENST00000468718.5; ENST00000243167.9
External Link	RMBase: m6A_site_28990
mod ID: M6ASITE024252		Click to Show/Hide the Full List
mod site	chr1:46408556-46408557:+		[4]
Sequence	CGGGCCGTGCTGGAGACCAAACAGAGCCTTGAGGCTGCGGG
Motif Score	2.20572619
Cell/Tissue List	brain; kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000484697.5; ENST00000493735.5; ENST00000489366.2; ENST00000243167.9
External Link	RMBase: m6A_site_28991
mod ID: M6ASITE024253		Click to Show/Hide the Full List
mod site	chr1:46410841-46410842:+		[5]
Sequence	GCTGTCAGCTTTCCTCAGCAACATGAAGTCTCGGTAAGGGT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000243167.9; ENST00000493636.1; ENST00000484697.5
External Link	RMBase: m6A_site_28992
mod ID: M6ASITE024254		Click to Show/Hide the Full List
mod site	chr1:46413593-46413594:+		[6]
Sequence	GATGGCTCTGGCTCCAGAGGACCTGAGACTCACACTCTCTG
Motif Score	3.622404762
Cell/Tissue List	MM6; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000484697.5; ENST00000243167.9
External Link	RMBase: m6A_site_28993
mod ID: M6ASITE024255		Click to Show/Hide the Full List
mod site	chr1:46413600-46413601:+		[6]
Sequence	CTGGCTCCAGAGGACCTGAGACTCACACTCTCTGCAGCCCA
Motif Score	3.319380952
Cell/Tissue List	MM6; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000243167.9; ENST00000484697.5
External Link	RMBase: m6A_site_28994
mod ID: M6ASITE024256		Click to Show/Hide the Full List
mod site	chr1:46413738-46413739:+		[6]
Sequence	CGCCGACTCCCTGAGTCTGGACCTCCATCCCTGCTCTGGTC
Motif Score	3.622404762
Cell/Tissue List	MM6; Huh7; HEK293A-TOA; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000243167.9; ENST00000484697.5
External Link	RMBase: m6A_site_28995
mod ID: M6ASITE024257		Click to Show/Hide the Full List
mod site	chr1:46413842-46413843:+		[7]
Sequence	GCCCAACTAACAGTCAAGAAACAGCTCCTCGTCTGTGTGGT
Motif Score	2.20572619
Cell/Tissue List	Huh7; peripheral-blood; HEK293A-TOA; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000484697.5; ENST00000243167.9
External Link	RMBase: m6A_site_28996

Ref 1	A primary adrenal steroid, 11beta-hydroxyandrostenedione, has an osteotropic effect and little androgenic activity. J Steroid Biochem Mol Biol. 2000 Nov 15;74(4):203-11. doi: 10.1016/s0960-0760(00)00124-2.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 4	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 5	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 6	FTO Plays an Oncogenic Role in Acute Myeloid Leukemia as a N(6)-Methyladenosine RNA Demethylase. Cancer Cell. 2017 Jan 9;31(1):127-141. doi: 10.1016/j.ccell.2016.11.017. Epub 2016 Dec 22.
Ref 7	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map