m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR01685)

Target Name	Small ribosomal subunit protein uS15 (RPS13)
Synonyms	40S ribosomal protein S13 Click to Show/Hide
Gene Name	RPS13
Chromosomal Location	11p15.1
Family	Universal ribosomal protein uS15 family
Function	Component of the small ribosomal subunit. The ribosome is a large ribonucleoprotein complex responsible for the synthesis of proteins in the cell. Part of the small subunit (SSU) processome, first precursor of the small eukaryotic ribosomal subunit. During the assembly of the SSU processome in the nucleolus, many ribosome biogenesis factors, an RNA chaperone and ribosomal proteins associate with the nascent pre-rRNA and work in concert to generate RNA folding, modifications, rearrangements and cleavage as well as targeted degradation of pre-ribosomal RNA by the RNA exosome (PubMed:34516797). Click to Show/Hide
Gene ID	6207
Uniprot ID	RS13_HUMAN
HGNC ID	HGNC:10386
KEGG ID	hsa:6207

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05031		Crosstalk Info
Epigenetic Regulator	mmu-miR-1981-5p
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	ncRNA → m6A

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01685)

Small ribosomal subunit protein uS15 (RPS13)

Adenosine-to-Inosine editing (A-to-I)

In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE004576		Click to Show/Hide the Full List
mod site	chr11:17076649-17076650:-		[2]
Sequence	GATGCAGAGGTGAGAGGATCACCAGAGCCTAGAAGTCCCAG
Transcript ID List	rmsk_3487030; ENST00000525634.6; ENST00000525828.1; ENST00000526895.5; ENST00000533969.1; ENST00000228140.6
External Link	RMBase: RNA-editing_site_20638
mod ID: A2ISITE004577		Click to Show/Hide the Full List
mod site	chr11:17076685-17076686:-		[2]
Sequence	GCCAGCCGCAATGTGCCTGTAGTCCCAGATACTTGGGATGC
Transcript ID List	ENST00000228140.6; ENST00000533969.1; ENST00000525634.6; ENST00000526895.5; rmsk_3487030; ENST00000525828.1
External Link	RMBase: RNA-editing_site_20639

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE005098		Click to Show/Hide the Full List
mod site	chr11:17077661-17077662:-		[3]
Sequence	TTCCACTCTCGCTCTCCTTTCGTTGCCTGATCGCCGCCATC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000527571.1; ENST00000528074.1; ENST00000526895.5; ENST00000525828.1; ENST00000525634.6; ENST00000534329.1; ENST00000228140.6
External Link	RMBase: m5C_site_7050

N6-methyladenosine (m6A)

In total 13 m6A sequence/site(s) in this target gene
mod ID: M6ASITE004252		Click to Show/Hide the Full List
mod site	chr11:17075127-17075128:-		[4]
Sequence	GTTTGGCTCGATATTATAAGACCAAGCGAGTCCTCCCTCCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000531008.5; ENST00000531908.5; ENST00000228140.6; ENST00000525828.1; ENST00000526895.5; ENST00000525634.6
External Link	RMBase: m6A_site_133254
mod ID: M6ASITE004253		Click to Show/Hide the Full List
mod site	chr11:17075418-17075419:-		[4]
Sequence	AAAACCTGGTGCTAAGTAGGACTGCTTGTACTAAATTTTTT
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000526895.5; ENST00000525634.6; ENST00000531008.5; ENST00000525828.1; ENST00000531908.5; ENST00000228140.6
External Link	RMBase: m6A_site_133255
mod ID: M6ASITE004254		Click to Show/Hide the Full List
mod site	chr11:17075435-17075436:-		[4]
Sequence	AAGGTAAGCTAATAAATAAAACCTGGTGCTAAGTAGGACTG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000531008.5; ENST00000531908.5; ENST00000525634.6; ENST00000525828.1; ENST00000228140.6; ENST00000526895.5
External Link	RMBase: m6A_site_133256
mod ID: M6ASITE004255		Click to Show/Hide the Full List
mod site	chr11:17075460-17075461:-		[4]
Sequence	TCGAAAGCATCTTGAGAGGAACAGAAAGGTAAGCTAATAAA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000228140.6; ENST00000526895.5; ENST00000525634.6; ENST00000531008.5; ENST00000525828.1; ENST00000531908.5
External Link	RMBase: m6A_site_133257
mod ID: M6ASITE004256		Click to Show/Hide the Full List
mod site	chr11:17075585-17075586:-		[5]
Sequence	TCACATGGTGTTGCACAAGTACGTTTTGTGACAGGCAATAA
Motif Score	2.830077381
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000533969.1; ENST00000525828.1; ENST00000531008.5; ENST00000531908.5; ENST00000228140.6; ENST00000526895.5; ENST00000525634.6
External Link	RMBase: m6A_site_133258
mod ID: M6ASITE004257		Click to Show/Hide the Full List
mod site	chr11:17077174-17077175:-		[6]
Sequence	AAGAAGGGCCTTACTCCTTCACAGATCGGTGAGTGTTTGTG
Motif Score	2.047297619
Cell/Tissue List	HEK293; kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000525828.1; ENST00000527571.1; ENST00000534329.1; ENST00000526895.5; ENST00000533969.1; ENST00000228140.6; ENST00000525634.6; ENST00000528074.1
External Link	RMBase: m6A_site_133259
mod ID: M6ASITE004258		Click to Show/Hide the Full List
mod site	chr11:17077201-17077202:-		[4]
Sequence	GTGAAGGAGCAGATTTACAAACTGGCCAAGAAGGGCCTTAC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000534329.1; ENST00000528074.1; ENST00000526895.5; ENST00000533969.1; ENST00000525634.6; ENST00000228140.6; ENST00000527571.1; ENST00000525828.1
External Link	RMBase: m6A_site_133260
mod ID: M6ASITE004259		Click to Show/Hide the Full List
mod site	chr11:17077233-17077234:-		[7]
Sequence	CATAACAGTGGTTGAAGTTGACATCTGACGACGTGAAGGAG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000528074.1; ENST00000534329.1; ENST00000527571.1; ENST00000526895.5; ENST00000525634.6; ENST00000228140.6; ENST00000533969.1; ENST00000525828.1
External Link	RMBase: m6A_site_133261
mod ID: M6ASITE004260		Click to Show/Hide the Full List
mod site	chr11:17077308-17077309:-		[4]
Sequence	GCGGTTTTGCGGAAGGAGAGACCGCTGTTCTGCGGCGCCAT
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000533969.1; ENST00000525634.6; ENST00000228140.6; ENST00000534329.1; ENST00000525828.1; ENST00000526895.5; ENST00000527571.1; ENST00000528074.1
External Link	RMBase: m6A_site_133262
mod ID: M6ASITE004261		Click to Show/Hide the Full List
mod site	chr11:17077347-17077348:-		[4]
Sequence	AAGCGACGCCAGGGTGAGGAACTTGCGTGTATGAGGAGCGC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000525828.1; ENST00000533969.1; ENST00000534329.1; ENST00000528074.1; ENST00000525634.6; ENST00000526895.5; ENST00000228140.6; ENST00000527571.1
External Link	RMBase: m6A_site_133263
mod ID: M6ASITE004262		Click to Show/Hide the Full List
mod site	chr11:17077410-17077411:-		[4]
Sequence	ACTGTAAGTAGCGCGCTGGGACCGGGGAGAATCCGGGGAGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000534329.1; ENST00000527571.1; ENST00000525828.1; ENST00000533969.1; ENST00000526895.5; ENST00000528074.1; ENST00000228140.6; ENST00000525634.6
External Link	RMBase: m6A_site_133264
mod ID: M6ASITE004263		Click to Show/Hide the Full List
mod site	chr11:17077493-17077494:-		[4]
Sequence	AGCCGCCACCTCACCTCGAGACTGCTTCTCTCCCCAGGAAG
Motif Score	3.319380952
Cell/Tissue List	HeLa; H1A; H1B; HEK293A-TOA; MSC; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000526895.5; ENST00000525828.1; ENST00000525634.6; ENST00000527571.1; ENST00000533969.1; ENST00000528074.1; ENST00000228140.6; ENST00000534329.1
External Link	RMBase: m6A_site_133265
mod ID: M6ASITE004264		Click to Show/Hide the Full List
mod site	chr11:17077568-17077569:-		[4]
Sequence	GGGCGGGGGGTGGGAGGAAGACAGGGAGTGTGGGCAGCGGG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293A-TOA; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527571.1; ENST00000228140.6; ENST00000533969.1; ENST00000534329.1; ENST00000528074.1; ENST00000525828.1; ENST00000526895.5; ENST00000525634.6
External Link	RMBase: m6A_site_133266

2'-O-Methylation (2'-O-Me)

In total 5 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000589		Click to Show/Hide the Full List
mod site	chr11:17075519-17075520:-		[8]
Sequence	GGACTTGCTCCTGATCTTCCTGAAGATCTCTACCATTTAAT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000531008.5; ENST00000526895.5; ENST00000525634.6; ENST00000531908.5; ENST00000525828.1; ENST00000228140.6
External Link	RMBase: Nm_site_891
mod ID: 2OMSITE000590		Click to Show/Hide the Full List
mod site	chr11:17075522-17075523:-		[8]
Sequence	AAGGGACTTGCTCCTGATCTTCCTGAAGATCTCTACCATTT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000531008.5; ENST00000525828.1; ENST00000526895.5; ENST00000531908.5; ENST00000525634.6; ENST00000228140.6
External Link	RMBase: Nm_site_892
mod ID: 2OMSITE000591		Click to Show/Hide the Full List
mod site	chr11:17075523-17075524:-		[8]
Sequence	TAAGGGACTTGCTCCTGATCTTCCTGAAGATCTCTACCATT
Cell/Tissue List	HEK293; HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000531008.5; ENST00000525828.1; ENST00000228140.6; ENST00000525634.6; ENST00000531908.5; ENST00000526895.5
External Link	RMBase: Nm_site_893
mod ID: 2OMSITE000592		Click to Show/Hide the Full List
mod site	chr11:17075531-17075532:-		[8]
Sequence	CTTAAGTCTAAGGGACTTGCTCCTGATCTTCCTGAAGATCT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000531908.5; ENST00000531008.5; ENST00000533969.1; ENST00000526895.5; ENST00000525634.6; ENST00000525828.1; ENST00000228140.6
External Link	RMBase: Nm_site_894
mod ID: 2OMSITE000593		Click to Show/Hide the Full List
mod site	chr11:17077220-17077221:-		[8]
Sequence	GAAGTTGACATCTGACGACGTGAAGGAGCAGATTTACAAAC
Cell/Tissue List	HEK293
Seq Type List	Nm-seq
Transcript ID List	ENST00000525828.1; ENST00000534329.1; ENST00000526895.5; ENST00000527571.1; ENST00000533969.1; ENST00000228140.6; ENST00000525634.6; ENST00000528074.1
External Link	RMBase: Nm_site_895

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000318		Click to Show/Hide the Full List
mod site	chr11:17074717-17074718:-		[9]
Sequence	TGATGATTGGTTGCCAGACATTCGCAGTTTCCACCAGAAAT
Transcript ID List	ENST00000525828.1; ENST00000531908.5; ENST00000525634.6; rmsk_3487024; ENST00000531008.5; ENST00000606526.1; ENST00000526895.5; ENST00000228140.6
External Link	RMBase: Pseudo_site_837

Ref 1	doi: 10.1158/1535-7163.TARG-13-B281
Ref 2	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 3	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 6	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 7	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 8	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.
Ref 9	Transcriptome-wide mapping reveals widespread dynamic-regulated pseudouridylation of ncRNA and mRNA. Cell. 2014 Sep 25;159(1):148-162. doi: 10.1016/j.cell.2014.08.028. Epub 2014 Sep 11.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map