m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR01624)

Target Name	Histone deacetylase 1 (HDAC1)
Synonyms	HD1; EC 3.5.1.98; Protein deacetylase HDAC1; EC 3.5.1.-; Protein deacylase HDAC1; EC 3.5.1.- Click to Show/Hide
Gene Name	HDAC1
Chromosomal Location	1p35.2-p35.1
Family	Histone deacetylase family, HD type 1 subfamily
Function	Histone deacetylase that catalyzes the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4) (PubMed:16762839, PubMed:17704056, PubMed:28497810). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events (PubMed:16762839, PubMed:17704056). Histone deacetylases act via the formation of large multiprotein complexes (PubMed:16762839, PubMed:17704056). Acts as a component of the histone deacetylase NuRD complex which participates in the remodeling of chromatin (PubMed:16428440, PubMed:28977666). Also functions as deacetylase for non-histone targets, such as NR1D2, RELA, SP1, SP3 and TSHZ3 (PubMed:12837748, PubMed:16478997, PubMed:17996965, PubMed:19343227). Deacetylates SP proteins, SP1 and SP3, and regulates their function (PubMed:12837748, PubMed:16478997). Component of the BRG1-RB1-HDAC1 complex, which negatively regulates the CREST-mediated transcription in resting neurons (PubMed:19081374). Upon calcium stimulation, HDAC1 is released from the complex and CREBBP is recruited, which facilitates transcriptional activation (PubMed:19081374). Deacetylates TSHZ3 and regulates its transcriptional repressor activity (PubMed:19343227). Deacetylates 'Lys-310' in RELA and thereby inhibits the transcriptional activity of NF-kappa-B (PubMed:17000776). Deacetylates NR1D2 and abrogates the effect of KAT5-mediated relieving of NR1D2 transcription repression activity (PubMed:17996965). Component of a RCOR/GFI/KDM1A/HDAC complex that suppresses, via histone deacetylase (HDAC) recruitment, a number of genes implicated in multilineage blood cell development (By similarity). Involved in CIART-mediated transcriptional repression of the circadian transcriptional activator: CLOCK-BMAL1 heterodimer (By similarity). Required for the transcriptional repression of circadian target genes, such as PER1, mediated by the large PER complex or CRY1 through histone deacetylation (By similarity). In addition to protein deacetylase activity, also has protein-lysine deacylase activity: acts as a protein decrotonylase by mediating decrotonylation ((2E)-butenoyl) of histones (PubMed:28497810). Click to Show/Hide
Gene ID	3065
Uniprot ID	HDAC1_HUMAN
HGNC ID	HGNC:4852
KEGG ID	hsa:3065

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03144		Crosstalk Info
Epigenetic Regulator	Histone deacetylase 1 (HDAC1)
Crosstalk relationship	m6A → Histone modification

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01624)

Histone deacetylase 1 (HDAC1)

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE006147		Click to Show/Hide the Full List
mod site	chr1:32318269-32318270:+		[2]
Sequence	GTTTTCCCTCTTTAAGAGGAAGACAGGACAGGCACAGCGGT
Transcript ID List	ENST00000472928.5; ENST00000481281.5; ENST00000373548.8; rmsk_74456; ENST00000463172.5; ENST00000428704.1
External Link	RMBase: RNA-editing_site_3552

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE001274		Click to Show/Hide the Full List
mod site	chr1:32332085-32332086:+		[3]
Sequence	CCCATGCTTCCCACTCCCTCCCAGTCTGCTCCTCTGACAAA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000471488.1; ENST00000476391.5; ENST00000373548.8
External Link	RMBase: m5C_site_1979

N6-methyladenosine (m6A)

In total 48 m6A sequence/site(s) in this target gene
mod ID: M6ASITE013968		Click to Show/Hide the Full List
mod site	chr1:32292136-32292137:+		[4]
Sequence	GCGGGCGGGAGGGCGGACGGACCGACTGACGGTAGGGACGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; fibroblasts; MT4; MM6; Huh7; Jurkat; CD4T; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000481281.5; ENST00000373548.8; ENST00000463172.5
External Link	RMBase: m6A_site_19833
mod ID: M6ASITE013969		Click to Show/Hide the Full List
mod site	chr1:32292206-32292207:+		[5]
Sequence	CACCCGGAGGAAAGTCTGTTACTACTACGACGGTGAGCACC
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000428704.1; ENST00000463172.5; ENST00000481281.5; ENST00000373548.8; ENST00000472928.5
External Link	RMBase: m6A_site_19834
mod ID: M6ASITE013970		Click to Show/Hide the Full List
mod site	chr1:32302645-32302646:+		[4]
Sequence	GTTGGAAATTACTATTATGGACAAGGCCACCCAATGAAGCC
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000428704.1; ENST00000481281.5; ENST00000463172.5; ENST00000472928.5; ENST00000373548.8
External Link	RMBase: m6A_site_19835
mod ID: M6ASITE013971		Click to Show/Hide the Full List
mod site	chr1:32302682-32302683:+		[5]
Sequence	AGCCTCACCGAATCCGCATGACTCATAATTTGCTGCTCAAC
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000481281.5; ENST00000463172.5; ENST00000472928.5; ENST00000373548.8; ENST00000428704.1
External Link	RMBase: m6A_site_19836
mod ID: M6ASITE013972		Click to Show/Hide the Full List
mod site	chr1:32316671-32316672:+		[6]
Sequence	TTCTGCCCTCTAGCGCCCTCACAAAGCCAATGCTGAGGAGA
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000428704.1; ENST00000373548.8; ENST00000463172.5; ENST00000472928.5; ENST00000481281.5
External Link	RMBase: m6A_site_19837
mod ID: M6ASITE013973		Click to Show/Hide the Full List
mod site	chr1:32316749-32316750:+		[7]
Sequence	GCGCTCCATCCGTCCAGATAACATGTCGGAGTACAGCAAGC
Motif Score	2.168095238
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000463172.5; ENST00000428704.1; ENST00000481281.5; ENST00000373548.8; ENST00000472928.5
External Link	RMBase: m6A_site_19838
mod ID: M6ASITE013974		Click to Show/Hide the Full List
mod site	chr1:32316761-32316762:+		[7]
Sequence	TCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGAT
Motif Score	2.856142857
Cell/Tissue List	liver; HEK293T
Seq Type List	m6A-REF-seq; DART-seq
Transcript ID List	ENST00000481281.5; ENST00000472928.5; ENST00000463172.5; ENST00000373548.8; ENST00000428704.1
External Link	RMBase: m6A_site_19839
mod ID: M6ASITE013976		Click to Show/Hide the Full List
mod site	chr1:32324493-32324494:+		[4]
Sequence	TCAAGTCAACGTTGGTGAGGACTGTCCAGTATTCGATGGCC
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000481281.5; ENST00000428704.1; ENST00000472928.5; ENST00000463172.5; ENST00000373548.8
External Link	RMBase: m6A_site_19840
mod ID: M6ASITE013987		Click to Show/Hide the Full List
mod site	chr1:32326951-32326952:+		[4]
Sequence	TGCCCAGCAAGTGCTGTGAAACTTAATAAGCAGCAGACGGA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000481281.5; ENST00000472928.5; ENST00000428704.1; ENST00000373548.8; ENST00000463172.5
External Link	RMBase: m6A_site_19841
mod ID: M6ASITE013998		Click to Show/Hide the Full List
mod site	chr1:32326971-32326972:+		[4]
Sequence	ACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTG
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000472928.5; ENST00000481281.5; ENST00000428704.1; ENST00000373548.8; ENST00000463172.5
External Link	RMBase: m6A_site_19842
mod ID: M6ASITE014009		Click to Show/Hide the Full List
mod site	chr1:32327037-32327038:+		[5]
Sequence	CGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGG
Motif Score	2.046785714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000428704.1; ENST00000481281.5; ENST00000463172.5; ENST00000373548.8; ENST00000472928.5
External Link	RMBase: m6A_site_19843
mod ID: M6ASITE014020		Click to Show/Hide the Full List
mod site	chr1:32327068-32327069:+		[5]
Sequence	ATCGTCTTGGCCATCCTGGAACTGCTAAAGTATGCCTGCCT
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000481281.5; ENST00000472928.5; ENST00000463172.5; ENST00000428704.1; ENST00000373548.8
External Link	RMBase: m6A_site_19844
mod ID: M6ASITE014031		Click to Show/Hide the Full List
mod site	chr1:32327346-32327347:+		[4]
Sequence	CTGTAGAGTAGGAAGATCGGACTTGGTCGGCTTGGTCAGGC
Motif Score	4.065041667
Cell/Tissue List	HeLa; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000428704.1; ENST00000481281.5; ENST00000482310.5; ENST00000373548.8; ENST00000463172.5; ENST00000490081.5; ENST00000472928.5
External Link	RMBase: m6A_site_19845
mod ID: M6ASITE014042		Click to Show/Hide the Full List
mod site	chr1:32327375-32327376:+		[4]
Sequence	GCTTGGTCAGGCCTCTGGAGACACCCGGCCGCTCTTCCACC
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000481281.5; ENST00000428704.1; ENST00000373548.8; ENST00000482310.5; ENST00000490081.5; ENST00000472928.5; ENST00000463172.5
External Link	RMBase: m6A_site_19846
mod ID: M6ASITE014053		Click to Show/Hide the Full List
mod site	chr1:32327555-32327556:+		[6]
Sequence	GTATCACCAGAGGGTGCTGTACATTGACATTGATATTCACC
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000428704.1; ENST00000482310.5; ENST00000472928.5; ENST00000481281.5; ENST00000373548.8; ENST00000490081.5
External Link	RMBase: m6A_site_19847
mod ID: M6ASITE014064		Click to Show/Hide the Full List
mod site	chr1:32327561-32327562:+		[5]
Sequence	CCAGAGGGTGCTGTACATTGACATTGATATTCACCATGGTG
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T; AML
Seq Type List	DART-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000482310.5; ENST00000490081.5; ENST00000472928.5; ENST00000373548.8; ENST00000428704.1; ENST00000481281.5
External Link	RMBase: m6A_site_19848
mod ID: M6ASITE014075		Click to Show/Hide the Full List
mod site	chr1:32327603-32327604:+		[6]
Sequence	CGGCGTGGAAGAGGCCTTCTACACCACGGACCGGGTCATGA
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000472928.5; ENST00000373548.8; ENST00000490081.5; ENST00000481281.5; ENST00000482310.5; ENST00000428704.1
External Link	RMBase: m6A_site_19849
mod ID: M6ASITE014086		Click to Show/Hide the Full List
mod site	chr1:32327651-32327652:+		[5]
Sequence	CTTTCATAAGTATGGAGAGTACTTCCCAGGAACTGGGGACC
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000481281.5; ENST00000490081.5; ENST00000472928.5; ENST00000373548.8; ENST00000428704.1; ENST00000482310.5
External Link	RMBase: m6A_site_19850
mod ID: M6ASITE014097		Click to Show/Hide the Full List
mod site	chr1:32329104-32329105:+		[5]
Sequence	AGGCAAGTATTATGCTGTTAACTACCCGCTCCGAGACGGGA
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000373548.8; ENST00000490081.5; ENST00000482310.5; ENST00000428704.1
External Link	RMBase: m6A_site_19851
mod ID: M6ASITE014105		Click to Show/Hide the Full List
mod site	chr1:32329804-32329805:+		[4]
Sequence	GGTGCTGATGTTTAAGCTGGACTTTGGAAAATGAGGAGGTG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000373548.8; ENST00000490081.5; ENST00000476391.5; ENST00000482310.5
External Link	RMBase: m6A_site_19852
mod ID: M6ASITE014106		Click to Show/Hide the Full List
mod site	chr1:32330768-32330769:+		[6]
Sequence	ACCCCTTCTCCCACCAAAGGACACGCCAAGTGTGTGGAATT
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000476391.5; ENST00000373548.8; ENST00000484305.1; ENST00000482310.5; ENST00000490081.5
External Link	RMBase: m6A_site_19853
mod ID: M6ASITE014107		Click to Show/Hide the Full List
mod site	chr1:32330836-32330837:+		[6]
Sequence	GATGCTGGGAGGCGGTGGTTACACCATTCGTAACGTTGCCC
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000490081.5; ENST00000373548.8; ENST00000482310.5; ENST00000476391.5; ENST00000484305.1
External Link	RMBase: m6A_site_19854
mod ID: M6ASITE014108		Click to Show/Hide the Full List
mod site	chr1:32330865-32330866:+		[7]
Sequence	GTAACGTTGCCCGGTGCTGGACATATGAGACAGCTGTGGCC
Motif Score	3.643047619
Cell/Tissue List	kidney; HEK293T
Seq Type List	m6A-REF-seq; DART-seq
Transcript ID List	ENST00000484305.1; ENST00000482310.5; ENST00000476391.5; ENST00000373548.8; ENST00000490081.5
External Link	RMBase: m6A_site_19855
mod ID: M6ASITE014109		Click to Show/Hide the Full List
mod site	chr1:32330874-32330875:+		[7]
Sequence	CCCGGTGCTGGACATATGAGACAGCTGTGGCCCTGGATACG
Motif Score	2.897386905
Cell/Tissue List	kidney; liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000484305.1; ENST00000482310.5; ENST00000490081.5; ENST00000373548.8; ENST00000476391.5
External Link	RMBase: m6A_site_19856
mod ID: M6ASITE014110		Click to Show/Hide the Full List
mod site	chr1:32331482-32331483:+		[6]
Sequence	GCCCCAATCAGAGCTTCCATACAATGACTACTTTGAATACT
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000476391.5; ENST00000482310.5; ENST00000490081.5; ENST00000373548.8
External Link	RMBase: m6A_site_19857
mod ID: M6ASITE014111		Click to Show/Hide the Full List
mod site	chr1:32331488-32331489:+		[5]
Sequence	ATCAGAGCTTCCATACAATGACTACTTTGAATACTTTGGAC
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000490081.5; ENST00000482310.5; ENST00000373548.8; ENST00000476391.5
External Link	RMBase: m6A_site_19858
mod ID: M6ASITE014112		Click to Show/Hide the Full List
mod site	chr1:32331524-32331525:+		[7]
Sequence	TGGACCAGATTTCAAGCTCCACATCAGTCCTTCCAATATGA
Motif Score	2.053113095
Cell/Tissue List	kidney; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000482310.5; ENST00000476391.5; ENST00000373548.8; ENST00000490081.5
External Link	RMBase: m6A_site_19859
mod ID: M6ASITE014113		Click to Show/Hide the Full List
mod site	chr1:32331544-32331545:+		[5]
Sequence	ACATCAGTCCTTCCAATATGACTAACCAGAACACGAATGAG
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000471488.1; ENST00000373548.8; ENST00000490081.5; ENST00000482310.5; ENST00000476391.5
External Link	RMBase: m6A_site_19860
mod ID: M6ASITE014114		Click to Show/Hide the Full List
mod site	chr1:32331554-32331555:+		[6]
Sequence	TTCCAATATGACTAACCAGAACACGAATGAGTACCTGGAGA
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000471488.1; ENST00000490081.5; ENST00000482310.5; ENST00000373548.8; ENST00000476391.5
External Link	RMBase: m6A_site_19861
mod ID: M6ASITE014115		Click to Show/Hide the Full List
mod site	chr1:32331692-32331693:+		[8]
Sequence	CAGACAGCGACTGTTTGAGAACCTTAGAATGCTGCCGCACG
Motif Score	2.930744048
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000373548.8; ENST00000476391.5; ENST00000490081.5; ENST00000471488.1
External Link	RMBase: m6A_site_19862
mod ID: M6ASITE014116		Click to Show/Hide the Full List
mod site	chr1:32331791-32331792:+		[6]
Sequence	TGAGGACGAAGACGACCCTGACAAGCGCATCTCGAGTGAGA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000373548.8; ENST00000476391.5; ENST00000471488.1
External Link	RMBase: m6A_site_19863
mod ID: M6ASITE014117		Click to Show/Hide the Full List
mod site	chr1:32331811-32331812:+		[9]
Sequence	ACAAGCGCATCTCGAGTGAGACCCAGACCTAGAGCCCTATG
Motif Score	2.876744048
Cell/Tissue List	Huh7; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000373548.8; ENST00000476391.5; ENST00000471488.1
External Link	RMBase: m6A_site_19864
mod ID: M6ASITE014118		Click to Show/Hide the Full List
mod site	chr1:32331817-32331818:+		[9]
Sequence	GCATCTCGAGTGAGACCCAGACCTAGAGCCCTATGCCTTCC
Motif Score	2.876744048
Cell/Tissue List	Huh7; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000373548.8; ENST00000476391.5; ENST00000471488.1
External Link	RMBase: m6A_site_19865
mod ID: M6ASITE014119		Click to Show/Hide the Full List
mod site	chr1:32332101-32332102:+		[5]
Sequence	CCTCCCAGTCTGCTCCTCTGACAAACGAATTGCCTGTGAGG
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000476391.5; ENST00000471488.1; ENST00000373548.8
External Link	RMBase: m6A_site_19866
mod ID: M6ASITE014120		Click to Show/Hide the Full List
mod site	chr1:32332167-32332168:+		[4]
Sequence	GGGAGAGGGGGGCCGCAAGAACTCTTCCAACTTCAAAAAAG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; H1A; H1B; hNPCs; HEK293T; fibroblasts; A549; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000471488.1; ENST00000373548.8; ENST00000476391.5
External Link	RMBase: m6A_site_19867
mod ID: M6ASITE014121		Click to Show/Hide the Full List
mod site	chr1:32332202-32332203:+		[4]
Sequence	AAAAAGCCAAGAGAGTCAAAACAGAGGATGAAAAAGAGAAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; H1A; H1B; hNPCs; hESCs; HEK293T; fibroblasts; A549; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000476391.5; ENST00000373548.8; ENST00000471488.1
External Link	RMBase: m6A_site_19868
mod ID: M6ASITE014122		Click to Show/Hide the Full List
mod site	chr1:32332224-32332225:+		[4]
Sequence	AGAGGATGAAAAAGAGAAAGACCCAGAGGAGAAGAAAGGTG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; H1A; H1B; hNPCs; hESCs; HEK293T; fibroblasts; A549; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000471488.1; ENST00000373548.8; ENST00000476391.5
External Link	RMBase: m6A_site_19869
mod ID: M6ASITE014123		Click to Show/Hide the Full List
mod site	chr1:32332720-32332721:+		[4]
Sequence	AAGTCACCGAAGAGGAGAAAACCAAGGAGGAGAAGCCAGAA
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; H1A; H1B; hNPCs; hESCs; HEK293T; fibroblasts; A549; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000471488.1; ENST00000373548.8; ENST00000476391.5
External Link	RMBase: m6A_site_19870
mod ID: M6ASITE014124		Click to Show/Hide the Full List
mod site	chr1:32333048-32333049:+		[4]
Sequence	GGTCAAGTTGGCCTGAATGGACCTCTCCAGCTCTGGCTTCC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; H1A; H1B; hNPCs; hESCs; HEK293T; A549; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000471488.1; ENST00000476391.5; ENST00000373548.8
External Link	RMBase: m6A_site_19871
mod ID: M6ASITE014125		Click to Show/Hide the Full List
mod site	chr1:32333170-32333171:+		[5]
Sequence	AAATATAAATATCCCCAGGGACAGAAACCAAGGCCCCGAGC
Motif Score	3.643047619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000476391.5; ENST00000373548.8
External Link	RMBase: m6A_site_19872
mod ID: M6ASITE014126		Click to Show/Hide the Full List
mod site	chr1:32333176-32333177:+		[5]
Sequence	AAATATCCCCAGGGACAGAAACCAAGGCCCCGAGCTCAGGG
Motif Score	2.185083333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000373548.8; ENST00000476391.5
External Link	RMBase: m6A_site_19873
mod ID: M6ASITE014127		Click to Show/Hide the Full List
mod site	chr1:32333256-32333257:+		[5]
Sequence	ACCCATTCTTCCCGTTCTTAACTTTGAACCATAAAGGGTGC
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000373548.8; ENST00000476391.5
External Link	RMBase: m6A_site_19874
mod ID: M6ASITE014128		Click to Show/Hide the Full List
mod site	chr1:32333316-32333317:+		[5]
Sequence	TACTTTTATGCAACCATAAGACAAACTCCTGAAATGCCAAG
Motif Score	2.897386905
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000476391.5; ENST00000373548.8
External Link	RMBase: m6A_site_19875
mod ID: M6ASITE014129		Click to Show/Hide the Full List
mod site	chr1:32333374-32333375:+		[6]
Sequence	TGGAAAGGTGCCCTTATTGAACATTCTAGAAGGGGTGGCTG
Motif Score	2.951386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000373548.8; ENST00000476391.5
External Link	RMBase: m6A_site_19876
mod ID: M6ASITE014130		Click to Show/Hide the Full List
mod site	chr1:32333436-32333437:+		[6]
Sequence	TTTTTCAGGCTCCTAAAGTAACATCAGCCATTTTTAGATTG
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000373548.8; ENST00000476391.5
External Link	RMBase: m6A_site_19877
mod ID: M6ASITE014131		Click to Show/Hide the Full List
mod site	chr1:32333501-32333502:+		[6]
Sequence	GGCCTCAAGTGAGCCAAGAAACACTGCCTGCCCTCTGTCTG
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T; AML
Seq Type List	MAZTER-seq; miCLIP
Transcript ID List	ENST00000373548.8; ENST00000476391.5
External Link	RMBase: m6A_site_19878
mod ID: M6ASITE014132		Click to Show/Hide the Full List
mod site	chr1:32333575-32333576:+		[5]
Sequence	TCTAGTTTCCTTTTTGAGATACTATTTTCATTTTTGTGAGC
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000373548.8; ENST00000476391.5
External Link	RMBase: m6A_site_19879
mod ID: M6ASITE014133		Click to Show/Hide the Full List
mod site	chr1:32333615-32333616:+		[6]
Sequence	CCTCTTTGTAATAAAATGGTACATTTCTATATCCTCCTGAG
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000476391.5; ENST00000373548.8
External Link	RMBase: m6A_site_19880

Ref 1	Clinical pipeline report, company report or official report of Zymeworks.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 7	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 8	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 9	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map