m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR01455)

Target Name	HOXA transcript antisense RNA, myeloid-specific 1 (HOTAIRM1)
Synonyms	HOXA-AS1; NCRNA00179; HOXA1-AS1; HOXA cluster antisense RNA 1 (non-protein coding); hox transcript antisense RNA, myeloid-specific 1 (non-protein coding) Click to Show/Hide
Gene Name	HOXA-AS1
Chromosomal Location	7p15.2
Gene ID	100506311
HGNC ID	HGNC:37117

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03322		Crosstalk Info
Epigenetic Regulator	Probable JmjC domain-containing histone demethylation protein 2C (JMJD1C)
Regulated Target	Histone H3 lysine 9 monomethylation (H3K9me1)
Crosstalk relationship	Histone modification → m6A
Disease	Brain cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01455)

HOXA transcript antisense RNA, myeloid-specific 1 (HOTAIRM1)

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004098		Click to Show/Hide the Full List
mod site	chr7:27097030-27097031:+		[2]
Sequence	GCTGGCGGACGTGGCCAGCGCGGGGGCCGGGCGGTGCGCTG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000429611.7; ENST00000425358.2; ENST00000434063.3
External Link	RMBase: m5C_site_39143

N6-methyladenosine (m6A)

In total 19 m6A sequence/site(s) in this target gene
mod ID: M6ASITE079330		Click to Show/Hide the Full List
mod site	chr7:27096377-27096378:+		[3]
Sequence	CACCGTTCAATGAAAGATGAACTGGCGAGAGGTGAGAAGGG
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000429611.7; ENST00000425358.2; ENST00000434063.3
External Link	RMBase: m6A_site_751213
mod ID: M6ASITE079331		Click to Show/Hide the Full List
mod site	chr7:27098889-27098890:+		[3]
Sequence	AAATGACGCCGAGGCCCTGAACTGTTCATGGCATCCGCGGC
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000429611.7; ENST00000428939.3; ENST00000434063.3; ENST00000425358.2
External Link	RMBase: m6A_site_751214
mod ID: M6ASITE079332		Click to Show/Hide the Full List
mod site	chr7:27099190-27099191:+		[4]
Sequence	AGAAACCAGCCATAGTCCCCACACTCCGCCGCCGCAGCTGA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000434063.3; ENST00000428939.3; ENST00000429611.7; ENST00000425358.2
External Link	RMBase: m6A_site_751215
mod ID: M6ASITE079333		Click to Show/Hide the Full List
mod site	chr7:27099262-27099263:+		[4]
Sequence	GGGAGCAAACCTATGAAGAAACATCGCGTTGTCATTGGAAC
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000429611.7; ENST00000425358.2; ENST00000434063.3; ENST00000428939.3
External Link	RMBase: m6A_site_751216
mod ID: M6ASITE079334		Click to Show/Hide the Full List
mod site	chr7:27099331-27099332:+		[4]
Sequence	TTCTTAAATCAACCCGCCCCACACACATGTTGCTTACATGC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000434063.3; ENST00000428939.3; ENST00000425358.2; ENST00000429611.7
External Link	RMBase: m6A_site_751217
mod ID: M6ASITE079335		Click to Show/Hide the Full List
mod site	chr7:27099346-27099347:+		[4]
Sequence	GCCCCACACACATGTTGCTTACATGCTGCGTTTTCTCACGG
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000434063.3; ENST00000428939.3; ENST00000425358.2; ENST00000429611.7
External Link	RMBase: m6A_site_751218
mod ID: M6ASITE079336		Click to Show/Hide the Full List
mod site	chr7:27099793-27099794:+
Sequence	TTTAGGTCTGTTTTGCCTGAACCCATCAACAGCTGGGAGAT
Motif Score	2.930744048
Cell/Tissue List	HEK293T
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000434063.3; ENST00000425358.2; ENST00000429611.7; ENST00000428939.3; ENST00000593300.1; ENST00000619974.1
External Link	RMBase: m6A_site_751219
mod ID: M6ASITE079338		Click to Show/Hide the Full List
mod site	chr7:27099801-27099802:+		[5]
Sequence	TGTTTTGCCTGAACCCATCAACAGCTGGGAGATTAATCAAC
Motif Score	2.173910714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000619974.1; ENST00000428939.3; ENST00000593300.1; ENST00000429611.7; ENST00000425358.2; ENST00000434063.3
External Link	RMBase: m6A_site_751220
mod ID: M6ASITE079339		Click to Show/Hide the Full List
mod site	chr7:27099823-27099824:+		[4]
Sequence	AGCTGGGAGATTAATCAACCACACTGAAAATGTGGAGGGAT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000619974.1; ENST00000428939.3; ENST00000425358.2; ENST00000434063.3; ENST00000593300.1; ENST00000429611.7
External Link	RMBase: m6A_site_751221
mod ID: M6ASITE079340		Click to Show/Hide the Full List
mod site	chr7:27099879-27099880:+		[6]
Sequence	TTGAAATGTGGGTGTTTGAAACAAAAGTGTATAAACAAATG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; Huh7
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000617934.1; ENST00000425358.2; ENST00000428939.3; ENST00000434063.3; ENST00000593300.1; ENST00000429611.7
External Link	RMBase: m6A_site_751222
mod ID: M6ASITE079341		Click to Show/Hide the Full List
mod site	chr7:27099893-27099894:+		[5]
Sequence	TTTGAAACAAAAGTGTATAAACAAATGAATTGTTGATAACT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	MeRIP-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000425358.2; ENST00000428939.3; ENST00000617934.1; ENST00000593300.1; ENST00000434063.3; ENST00000429611.7
External Link	RMBase: m6A_site_751223
mod ID: M6ASITE079342		Click to Show/Hide the Full List
mod site	chr7:27099931-27099932:+		[7]
Sequence	ACTTAGTTATTGACCTGGAGACTGGTAGCTTATTAAAGAAA
Motif Score	3.319380952
Cell/Tissue List	HEK293T; HeLa
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000429611.7; ENST00000617934.1; ENST00000428939.3; ENST00000593300.1; ENST00000434063.3; ENST00000425358.2
External Link	RMBase: m6A_site_751224
mod ID: M6ASITE079343		Click to Show/Hide the Full List
mod site	chr7:27099951-27099952:+		[6]
Sequence	ACTGGTAGCTTATTAAAGAAACTCCGTGTTACTCATTCCTG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000434063.3; ENST00000425358.2; ENST00000617934.1; ENST00000593300.1; ENST00000429611.7; ENST00000428939.3
External Link	RMBase: m6A_site_751225
mod ID: M6ASITE079344		Click to Show/Hide the Full List
mod site	chr7:27099961-27099962:+		[5]
Sequence	TATTAAAGAAACTCCGTGTTACTCATTCCTGGAGTTGGGGG
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000593300.1; ENST00000428939.3; ENST00000425358.2; ENST00000429611.7; ENST00000434063.3
External Link	RMBase: m6A_site_751226
mod ID: M6ASITE079345		Click to Show/Hide the Full List
mod site	chr7:27100040-27100041:+		[6]
Sequence	GGGCTTGGCCCAAATCTTAGACTGTCCAATTCTGCCTCTAT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; Huh7
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000619311.1; ENST00000593300.1; ENST00000434063.3; ENST00000428939.3
External Link	RMBase: m6A_site_751227
mod ID: M6ASITE079346		Click to Show/Hide the Full List
mod site	chr7:27100085-27100086:+		[6]
Sequence	AATTTAAATCTATGGCTTGAACCTGTGCACTGAAAATCAAA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000428939.3; ENST00000593300.1; ENST00000434063.3; ENST00000619311.1
External Link	RMBase: m6A_site_751228
mod ID: M6ASITE079347		Click to Show/Hide the Full List
mod site	chr7:27100153-27100154:+		[6]
Sequence	AAGCAAAAAAGAAAGAAAAAACACTTATTAGAAGCCCTAGT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; Huh7
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000434063.3; ENST00000593300.1
External Link	RMBase: m6A_site_751229
mod ID: M6ASITE079349		Click to Show/Hide the Full List
mod site	chr7:27100212-27100213:+		[6]
Sequence	TTTGTTGCTGTCCATTGAAGACTTTGAACATGCCGCCTTAA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000593300.1
External Link	RMBase: m6A_site_751230
mod ID: M6ASITE079350		Click to Show/Hide the Full List
mod site	chr7:27100219-27100220:+		[6]
Sequence	CTGTCCATTGAAGACTTTGAACATGCCGCCTTAATAAATGT
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; Huh7
Seq Type List	m6A-seq; DART-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000593300.1
External Link	RMBase: m6A_site_751231

Ref 1	URL: http://www.guidetopharmacology.org Nucleic Acids Res. 2015 Oct 12. pii: gkv1037. The IUPHAR/BPS Guide to PHARMACOLOGY in 2016: towards curated quantitative interactions between 1300 protein targets and 6000 ligands. (Target id: 253).
Ref 2	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 3	Dynamics of Human and Viral RNA Methylation during Zika Virus Infection. Cell Host Microbe. 2016 Nov 9;20(5):666-673. doi: 10.1016/j.chom.2016.10.002. Epub 2016 Oct 20.
Ref 4	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 5	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map