m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR01282)
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03151 | ||
| Epigenetic Regulator | Histone-lysine N-methyltransferase EHMT2 (EHMT2) | |
| Regulated Target | Histone H3 lysine 9 dimethylation (H3K9me2) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Inflammatory response | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01282)
| In total 4 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE008366 | Click to Show/Hide the Full List | ||
| mod site | chr11:105034321-105034322:- | [3] | |
| Sequence | ATGCTACAGTTATGGATAAGACCCGAGCTTTGATTGACTCC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; MSC; TIME; TREX | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000532520.1; ENST00000446369.5; ENST00000534497.5; ENST00000525825.5; ENST00000529871.1; ENST00000640184.1; ENST00000528974.1; ENST00000526511.5; ENST00000526568.5; ENST00000533400.6; ENST00000527979.5; ENST00000436863.7; ENST00000353247.9; ENST00000531166.5; ENST00000528424.1 | ||
| External Link | RMBase: m6A_site_161600 | ||
| mod ID: M6ASITE008367 | Click to Show/Hide the Full List | ||
| mod site | chr11:105034374-105034375:- | [3] | |
| Sequence | ATTACAGACAAGGGTGCTGAACAAGGAAGAGATGGAGAAAG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; iSLK; MSC; TIME; TREX | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000446369.5; ENST00000532520.1; ENST00000526568.5; ENST00000353247.9; ENST00000529871.1; ENST00000528974.1; ENST00000527979.5; ENST00000531166.5; ENST00000533400.6; ENST00000525825.5; ENST00000534497.5; ENST00000640184.1; ENST00000436863.7; ENST00000526511.5 | ||
| External Link | RMBase: m6A_site_161601 | ||
| mod ID: M6ASITE008368 | Click to Show/Hide the Full List | ||
| mod site | chr11:105034387-105034388:- | [3] | |
| Sequence | TACTGGATGAATTATTACAGACAAGGGTGCTGAACAAGGAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; iSLK; MSC; TIME; TREX | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000436863.7; ENST00000640184.1; ENST00000529871.1; ENST00000446369.5; ENST00000531166.5; ENST00000526511.5; ENST00000526568.5; ENST00000525825.5; ENST00000528974.1; ENST00000527979.5; ENST00000534497.5; ENST00000532520.1; ENST00000533400.6; ENST00000353247.9 | ||
| External Link | RMBase: m6A_site_161602 | ||
| mod ID: M6ASITE008369 | Click to Show/Hide the Full List | ||
| mod site | chr11:105034477-105034478:- | [3] | |
| Sequence | GAGAAATCCTTGTGCTCTAAACAGACAAGGTCCTGAAGGAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; MSC; TIME; TREX | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000533400.6; ENST00000446369.5; ENST00000526511.5; ENST00000528974.1; ENST00000525825.5; ENST00000534497.5; ENST00000529871.1; ENST00000526568.5; ENST00000532520.1; ENST00000436863.7; ENST00000531166.5; ENST00000353247.9; ENST00000527979.5 | ||
| External Link | RMBase: m6A_site_161603 | ||
References