m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR01055)

Target Name	SLC7A11 antisense RNA 1 (SLC7A11-AS1)
Synonyms	ENST00000512786; SLC7A11 antisense RNA 1 (non-protein coding) Click to Show/Hide
Gene Name	SLC7A11-AS1
Chromosomal Location	4q28.3
Gene ID	641364
HGNC ID	HGNC:44064

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05761		Crosstalk Info
Epigenetic Regulator	SLC7A11 antisense RNA 1 (SLC7A11-AS1)
Regulated Target	E3 ubiquitin-protein ligase CHIP (STUB1)
Crosstalk relationship	m6A → ncRNA
Disease	Liver cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01055)

SLC7A11 antisense RNA 1 (SLC7A11-AS1)

N6-methyladenosine (m6A)

In total 5 m6A sequence/site(s) in this target gene
mod ID: M6ASITE067668		Click to Show/Hide the Full List
mod site	chr4:138104595-138104596:+		[2]
Sequence	TGATGGTATTTATTCCAGGAACAGGAGCCAGTCCTGGGCAC
Motif Score	2.951386905
Cell/Tissue List	TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000510767.5
External Link	RMBase: m6A_site_651117
mod ID: M6ASITE067669		Click to Show/Hide the Full List
mod site	chr4:138104628-138104629:+		[2]
Sequence	CTGGGCACACACATAAAGGGACTTCCTTCACTCCCCAGAAG
Motif Score	4.065041667
Cell/Tissue List	TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000510767.5
External Link	RMBase: m6A_site_651118
mod ID: M6ASITE067670		Click to Show/Hide the Full List
mod site	chr4:138104732-138104733:+		[2]
Sequence	CTTCACTCACCAACAGTTAGACCTTTTCAATTGATTTTATT
Motif Score	2.876744048
Cell/Tissue List	TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000510767.5
External Link	RMBase: m6A_site_651119
mod ID: M6ASITE067748		Click to Show/Hide the Full List
mod site	chr4:138171576-138171577:+		[3]
Sequence	AGACATCTATAGTGTGTAAAACCATCTTTACAAAACCCATA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000510767.5; ENST00000512786.1
External Link	RMBase: m6A_site_651197
mod ID: M6ASITE067749		Click to Show/Hide the Full List
mod site	chr4:138171590-138171591:+		[3]
Sequence	TGTAAAACCATCTTTACAAAACCCATATATACAGAAAAATC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000510767.5; ENST00000512786.1
External Link	RMBase: m6A_site_651198

Ref 1	Metabolism and bioactivation of famitinib, a novel inhibitor of receptor tyrosine kinase, in cancer patients. Br J Pharmacol. 2013 Apr;168(7):1687-706. doi: 10.1111/bph.12047.
Ref 2	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 3	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.