m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR01051)
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05758 | ||
| Epigenetic Regulator | CALML3 antisense RNA 1 (CALML3-AS1) | |
| Regulated Target | Histone-lysine N-methyltransferase EZH2 (EZH2) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Non-small cell lung cancer | |
m6A Regulator: YTH domain-containing protein 2 (YTHDC2)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05759 | ||
| Epigenetic Regulator | CALML3 antisense RNA 1 (CALML3-AS1) | |
| Regulated Target | Histone-lysine N-methyltransferase EZH2 (EZH2) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Non-small cell lung cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01051)
| In total 9 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE095349 | Click to Show/Hide the Full List | ||
| mod site | chr10:5515124-5515125:- | [2] | |
| Sequence | CTGATGAAACGTGTGTAAGGACCGCAATGGTATCTGTGTCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000543008.2 | ||
| External Link | RMBase: m6A_site_90901 | ||
| mod ID: M6ASITE095350 | Click to Show/Hide the Full List | ||
| mod site | chr10:5515157-5515158:- | [2] | |
| Sequence | GATGGAGGACGTGAACATGAACTACTGGAGATGCTGATGAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000543008.2 | ||
| External Link | RMBase: m6A_site_90902 | ||
| mod ID: M6ASITE095351 | Click to Show/Hide the Full List | ||
| mod site | chr10:5515824-5515825:- | [2] | |
| Sequence | CCTTAGAGAGAGGCCAGGAAACTGCCGAGGTGATAAGTGAC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000543008.2 | ||
| External Link | RMBase: m6A_site_90903 | ||
| mod ID: M6ASITE095352 | Click to Show/Hide the Full List | ||
| mod site | chr10:5515859-5515860:- | [2] | |
| Sequence | ATTACAGCCACCACCCAGGGACTCTGGTGCAGGCTCCTTAG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000543008.2 | ||
| External Link | RMBase: m6A_site_90904 | ||
| mod ID: M6ASITE095353 | Click to Show/Hide the Full List | ||
| mod site | chr10:5525142-5525143:- | [2] | |
| Sequence | GCCGTCCCCATCCTTGTCAAACAGGGAGAAGGCCTCCTTGA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000545372.1; ENST00000442008.2; ENST00000542093.5; ENST00000651240.1 | ||
| External Link | RMBase: m6A_site_90905 | ||
| mod ID: M6ASITE095354 | Click to Show/Hide the Full List | ||
| mod site | chr10:5525199-5525200:- | [2] | |
| Sequence | CGTGGGGTTCTGGCCCAGGGACCGCATGACCGTGCCCAGCT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000545372.1; ENST00000442008.2; ENST00000651240.1; ENST00000542093.5 | ||
| External Link | RMBase: m6A_site_90906 | ||
| mod ID: M6ASITE095355 | Click to Show/Hide the Full List | ||
| mod site | chr10:5525289-5525290:- | [2] | |
| Sequence | CCTGGCCATCATGCCCAGGAACTCGGGGAAGTCCACGGTGC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000542093.5; ENST00000545372.1; ENST00000651240.1; ENST00000442008.2 | ||
| External Link | RMBase: m6A_site_90910 | ||
| mod ID: M6ASITE095356 | Click to Show/Hide the Full List | ||
| mod site | chr10:5525361-5525362:- | [2] | |
| Sequence | GCCGTTGCCGTCCTTGTCGAACACGCGGAAGGCCTCGCGGA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000651240.1; ENST00000442008.2; ENST00000545372.1; ENST00000542093.5 | ||
| External Link | RMBase: m6A_site_90913 | ||
| mod ID: M6ASITE095357 | Click to Show/Hide the Full List | ||
| mod site | chr10:5526182-5526183:- | [2] | |
| Sequence | CTCCTTCCAGATGAATAGGAACAGGTTACAGCTGACCCAGT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000545372.1; ENST00000542093.5 | ||
| External Link | RMBase: m6A_site_90923 | ||
References