m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR01036)

Target Name	long intergenic non-protein coding RNA 1139 (LINC01139)
Synonyms	LINK-A; TCONS_00000027; long intergenic non-coding RNA for kinase activation Click to Show/Hide
Gene Name	LINK-A
Chromosomal Location	1q43
Gene ID	339535
HGNC ID	HGNC:27924

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Fat mass and obesity-associated protein (FTO)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05748		Crosstalk Info
Epigenetic Regulator	Long intergenic non-protein coding RNA 1139 (LINC01139)
Regulated Target	Minichromosome maintenance complex component 3 (MCM3)
Crosstalk relationship	m6A → ncRNA
Disease	Esophageal Squamous Cell Carcinoma	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01036)

long intergenic non-protein coding RNA 1139 (LINC01139)

N6-methyladenosine (m6A)

In total 12 m6A sequence/site(s) in this target gene
mod ID: M6ASITE093479		Click to Show/Hide the Full List
mod site	chr1:238481116-238481117:-		[2]
Sequence	ATATTGTTTCTCTGTTTTAAACCTTGTATAAATAGGAAAAT
Motif Score	2.185083333
Cell/Tissue List	Huh7; iSLK; MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000648188.1; ENST00000649127.1; ENST00000649385.1; ENST00000400946.3; ENST00000649681.1; ENST00000648241.1
External Link	RMBase: m6A_site_87346
mod ID: M6ASITE093480		Click to Show/Hide the Full List
mod site	chr1:238481199-238481200:-		[2]
Sequence	TTTTTGTGGCTGTGGGACGGACAAAGATGCCTTTAGCTGAC
Motif Score	3.643047619
Cell/Tissue List	Huh7; iSLK; MSC; TIME
Seq Type List	MeRIP-seq
Transcript ID List	rmsk_424661; ENST00000649127.1; ENST00000400946.3; ENST00000649681.1; ENST00000648188.1; ENST00000649385.1; ENST00000648241.1
External Link	RMBase: m6A_site_87347
mod ID: M6ASITE093481		Click to Show/Hide the Full List
mod site	chr1:238481237-238481238:-		[3]
Sequence	CTGCTTCACTCACCCTTCAAACCATCTGCAAGCCTAAATTT
Motif Score	2.185083333
Cell/Tissue List	U2OS; H1A; Huh7; iSLK; MSC; TIME; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000649385.1; ENST00000649681.1; ENST00000400946.3; ENST00000649127.1; ENST00000648188.1; ENST00000648241.1; rmsk_424661
External Link	RMBase: m6A_site_87348
mod ID: M6ASITE093482		Click to Show/Hide the Full List
mod site	chr1:238481260-238481261:-		[3]
Sequence	TTCCCTTTTCACCCAATAAAACCCTGCTTCACTCACCCTTC
Motif Score	2.185083333
Cell/Tissue List	U2OS; H1A; Huh7; iSLK; MSC; TIME; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000400946.3; ENST00000648188.1; ENST00000649385.1; ENST00000648241.1; ENST00000649681.1; rmsk_424661; ENST00000649127.1
External Link	RMBase: m6A_site_87349
mod ID: M6ASITE093483		Click to Show/Hide the Full List
mod site	chr1:238481316-238481317:-		[3]
Sequence	CAGGAAGCGCTCTAGCAGGGACTCCGGCTTTGCAGAGCATC
Motif Score	4.065041667
Cell/Tissue List	U2OS; Huh7; iSLK; MSC; TIME
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000648188.1; ENST00000648241.1; ENST00000649127.1; ENST00000649385.1; ENST00000400946.3; ENST00000649681.1; rmsk_424661
External Link	RMBase: m6A_site_87350
mod ID: M6ASITE093484		Click to Show/Hide the Full List
mod site	chr1:238481358-238481359:-		[4]
Sequence	CCCTCCTCTTCCTGTGTGGAACCTGAAATTCCACCGGCTTG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; U2OS; H1B; H1A; fibroblasts; Huh7; iSLK; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000648241.1; ENST00000649385.1; rmsk_424661; ENST00000400946.3; ENST00000649127.1; ENST00000649681.1; ENST00000648188.1
External Link	RMBase: m6A_site_87351
mod ID: M6ASITE093485		Click to Show/Hide the Full List
mod site	chr1:238481421-238481422:-		[4]
Sequence	GGCCTGTGCACTAGGGTGGAACCTCAGGAAGTTGATGACAT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; U2OS; fibroblasts; iSLK; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	rmsk_424661; ENST00000649681.1; ENST00000400946.3; ENST00000648241.1; ENST00000648188.1; ENST00000649385.1; ENST00000649127.1
External Link	RMBase: m6A_site_87352
mod ID: M6ASITE093486		Click to Show/Hide the Full List
mod site	chr1:238481450-238481451:-		[4]
Sequence	TGGGAGGGGGTCTCTGGAAAACTCCATCTGGCCTGTGCACT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; U2OS; fibroblasts; iSLK; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000400946.3; ENST00000649385.1; ENST00000649127.1; ENST00000649681.1; ENST00000648241.1; ENST00000648188.1; rmsk_424661
External Link	RMBase: m6A_site_87353
mod ID: M6ASITE093487		Click to Show/Hide the Full List
mod site	chr1:238481479-238481480:-		[4]
Sequence	TCTTTAGACGGGGGAATAAGACAGCCAGGTGGGAGGGGGTC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; U2OS; fibroblasts; iSLK; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000648188.1; ENST00000649127.1; rmsk_424661; ENST00000649385.1; ENST00000648241.1; ENST00000400946.3; ENST00000649681.1
External Link	RMBase: m6A_site_87354
mod ID: M6ASITE093488		Click to Show/Hide the Full List
mod site	chr1:238481583-238481584:-		[5]
Sequence	CTGACTGATGCTTCCCCAAAACAGTGCCCCCTGTCATCAGG
Motif Score	2.20572619
Cell/Tissue List	iSLK
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000400946.3; ENST00000649681.1; ENST00000648188.1; ENST00000649385.1; ENST00000648241.1; rmsk_424662; ENST00000649127.1
External Link	RMBase: m6A_site_87355
mod ID: M6ASITE093489		Click to Show/Hide the Full List
mod site	chr1:238481619-238481620:-		[2]
Sequence	GATGGCCCCTTCTGCGGGGAACCCTTACATGGGCCTCTGAC
Motif Score	2.930744048
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000649127.1; ENST00000649681.1; ENST00000648241.1; ENST00000649385.1; ENST00000400946.3; ENST00000648188.1; rmsk_424662
External Link	RMBase: m6A_site_87356
mod ID: M6ASITE093490		Click to Show/Hide the Full List
mod site	chr1:238481672-238481673:-		[2]
Sequence	TCTTGCCTTCAGGCCATCAAACTCCAACCAGTCACCCAACC
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000649385.1; ENST00000400946.3; ENST00000649681.1; rmsk_424662; ENST00000648241.1; ENST00000648188.1; ENST00000649127.1
External Link	RMBase: m6A_site_87357

Ref 1	Company report (FirstString Research)
Ref 2	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 3	RNA-methylation-dependent RNA processing controls the speed of the circadian clock. Cell. 2013 Nov 7;155(4):793-806. doi: 10.1016/j.cell.2013.10.026.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map