m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR01031)
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05743 | ||
| Epigenetic Regulator | pri-miR-935 | |
| Regulated Target | Gap junction alpha-1 protein (GJA1) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Intrahepatic cholangiocarcinoma | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01031)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE009296 | Click to Show/Hide the Full List | ||
| mod site | chr19:53982324-53982325:+ | [2] | |
| Sequence | CCGGCGGGGGCGCGGGCGGCAGTGGCGGGAGCGGCCCCTCG | ||
| Transcript ID List | ENST00000270458.2; ENST00000638874.1; rmsk_5033654; ENST00000401179.1 | ||
| External Link | RMBase: RNA-editing_site_72810 | ||
References