m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR01005)
Target Name pri-miR-196b
Synonyms
MIR196B
    Click to Show/Hide
Gene Name pri-miR-196b
Chromosomal Location 7p15.2
Family MicroRNA MIR196 family
Gene ID 442920
HGNC ID
HGNC:31790
miRBase ID
MI0001150
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03585
 Crosstalk Info 
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
 Disease Info 
Crosstalk ID: M6ACROT03630
 Crosstalk Info 
Epigenetic Regulator N-lysine methyltransferase SMYD2 (SMYD2)
Regulated Target Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
 Disease Info 
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05731
 Crosstalk Info 
Epigenetic Regulator pri-miR-196b
Crosstalk relationship m6A → ncRNA
Disease Colorectal cancer
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01005)
pri-miR-196b
N6-methyladenosine (m6A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE079433 Click to Show/Hide the Full List
mod site chr7:27169562-27169563:- [2]
Sequence CCTTCGCGGGCAGCACCAGAACTGGTCGGTGATTTAGGTAG
Motif Score 3.373380952
Cell/Tissue List HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000487384.5; ENST00000465941.1; ENST00000489695.1; ENST00000470747.4; ENST00000384852.2
External Link RMBase: m6A_site_751563