m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00827)

Target Name	IQ motif and ankyrin repeat containing 1 (IQANK1)
Synonyms	onco-lncRNA-3; CACClnc; Chemoresistance Associated CRC lncRNA; FAM83H-AS1; FAM83H antisense RNA 1 (head to head) Click to Show/Hide
Gene Name	FAM83H-AS1
Chromosomal Location	8q24.3
Gene ID	642574
HGNC ID	HGNC:49576

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Wilms tumor 1-associating protein (WTAP)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05645		Crosstalk Info
Epigenetic Regulator	IQ motif and ankyrin repeat containing 1 (IQANK1)
Crosstalk relationship	m6A → ncRNA
Disease	Gastric cancer	Disease Info
Crosstalk ID: M6ACROT05825		Crosstalk Info
Epigenetic Regulator	IQ motif and ankyrin repeat containing 1 (IQANK1)
Crosstalk relationship	m6A → ncRNA
Disease	Gastric cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00827)

IQ motif and ankyrin repeat containing 1 (IQANK1)

Adenosine-to-Inosine editing (A-to-I)

In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE003063		Click to Show/Hide the Full List
mod site	chr8:143766775-143766776:+		[2]
Sequence	TTCCAACTCCAAGTTCCTGAAGCTGTTCTCCCATGTGATCT
Transcript ID List	ENST00000527139.6
External Link	RMBase: RNA-editing_site_133730
mod ID: A2ISITE003064		Click to Show/Hide the Full List
mod site	chr8:143778805-143778806:+		[3]
Sequence	AGATGGAGTCTTGCTCTGTCACCCAGGCTGGAGGGCAGTGG
Transcript ID List	ENST00000527139.6
External Link	RMBase: RNA-editing_site_133731

N6-methyladenosine (m6A)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE087354		Click to Show/Hide the Full List
mod site	chr8:143744315-143744316:+		[4]
Sequence	GAGGTGGACATCTTTGGGGGACATTATTCCGCCCACCAGAA
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000533004.5; ENST00000527139.6
External Link	RMBase: m6A_site_812336

Ref 1	ClinicalTrials.gov (NCT01869166) Treatment of Chemotherapy Refractory EGFR(Epidermal Growth Factor Receptor) Positive Advanced Solid Tumors (CART-EGFR)
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 4	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.