m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00801)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
STAT2
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | mouse embryonic stem cells | Mus musculus |
|
Treatment: METTL3-/- ESCs
Control: Wild type ESCs
|
GSE145309 | |
| Regulation |
![]() ![]() |
logFC: -1.27E+00 p-value: 1.09E-100 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between STAT2 and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 1.27E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | SNHG4 was downregulated in the neonatal pneumonia patient serum and its overexpression could inhibit LPS induced inflammatory injury in human lung fibroblasts and mouse lung tissue. The molecular mechanism underlying this protective effect was achieved by suppression of METTL3-mediated m6A modification levels of YTHDF1-dependent Signal transducer and activator of transcription 2 (STAT2) mRNA. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Congenital pneumonia | ICD-11: KB24 | ||
| Cell Process | Cell apoptosis | |||
| In-vitro Model | WI-38 | Normal | Homo sapiens | CVCL_0579 |
| In-vivo Model | All mice were housed under a 12 h light/dark cycle with constant temperature about 25 ℃ and relative humidity approximating 55 %. The mice had free access to food and water for 10 days prior to the experiment. Forty mice were randomly selected and divided into four groups of 10 mice each. After 10 days, mice received an intraperitoneal injection of 22 mg / mL sodium pentobarbital (diluted in saline) followed by 167 uM LPS (60 uL) Saline solution was instilled into the oral cavity through the posterior pharyngeal wall. Pinch the nares quickly and hold for 30 s, model is successful when all fluid is absorbed into the nasal cavity, and slight tracheal rales appear. Lentiviral vectors containing pcDNA-SNHG4 (150 uM) or pcDNA-3.1 were intratracheally injected into mice. Twenty-one days after establishing the model, mice were intraperitoneally injected with 3% sodium pentobarbital and euthanized by overdose anesthesia at a dose of 90 mL/Kg, and organs and tissues were removed for follow-up studies. | |||
YTH domain-containing family protein 1 (YTHDF1) [READER]
| Representative RIP-seq result supporting the interaction between STAT2 and the regulator | ||
| Cell Line | Hela | Homo sapiens |
| Regulation | logFC: 1.30E+00 | GSE63591 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | SNHG4 was downregulated in the neonatal pneumonia patient serum and its overexpression could inhibit LPS induced inflammatory injury in human lung fibroblasts and mouse lung tissue. The molecular mechanism underlying this protective effect was achieved by suppression of METTL3-mediated m6A modification levels of YTHDF1-dependent Signal transducer and activator of transcription 2 (STAT2) mRNA. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Congenital pneumonia | ICD-11: KB24 | ||
| Cell Process | Cell apoptosis | |||
| In-vitro Model | WI-38 | Normal | Homo sapiens | CVCL_0579 |
| In-vivo Model | All mice were housed under a 12 h light/dark cycle with constant temperature about 25 ℃ and relative humidity approximating 55 %. The mice had free access to food and water for 10 days prior to the experiment. Forty mice were randomly selected and divided into four groups of 10 mice each. After 10 days, mice received an intraperitoneal injection of 22 mg / mL sodium pentobarbital (diluted in saline) followed by 167 uM LPS (60 uL) Saline solution was instilled into the oral cavity through the posterior pharyngeal wall. Pinch the nares quickly and hold for 30 s, model is successful when all fluid is absorbed into the nasal cavity, and slight tracheal rales appear. Lentiviral vectors containing pcDNA-SNHG4 (150 uM) or pcDNA-3.1 were intratracheally injected into mice. Twenty-one days after establishing the model, mice were intraperitoneally injected with 3% sodium pentobarbital and euthanized by overdose anesthesia at a dose of 90 mL/Kg, and organs and tissues were removed for follow-up studies. | |||
Congenital pneumonia [ICD-11: KB24]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | SNHG4 was downregulated in the neonatal pneumonia patient serum and its overexpression could inhibit LPS induced inflammatory injury in human lung fibroblasts and mouse lung tissue. The molecular mechanism underlying this protective effect was achieved by suppression of METTL3-mediated m6A modification levels of YTHDF1-dependent Signal transducer and activator of transcription 2 (STAT2) mRNA. | |||
| Responsed Disease | Congenital pneumonia [ICD-11: KB24] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Down regulation | |||
| Cell Process | Cell apoptosis | |||
| In-vitro Model | WI-38 | Normal | Homo sapiens | CVCL_0579 |
| In-vivo Model | All mice were housed under a 12 h light/dark cycle with constant temperature about 25 ℃ and relative humidity approximating 55 %. The mice had free access to food and water for 10 days prior to the experiment. Forty mice were randomly selected and divided into four groups of 10 mice each. After 10 days, mice received an intraperitoneal injection of 22 mg / mL sodium pentobarbital (diluted in saline) followed by 167 uM LPS (60 uL) Saline solution was instilled into the oral cavity through the posterior pharyngeal wall. Pinch the nares quickly and hold for 30 s, model is successful when all fluid is absorbed into the nasal cavity, and slight tracheal rales appear. Lentiviral vectors containing pcDNA-SNHG4 (150 uM) or pcDNA-3.1 were intratracheally injected into mice. Twenty-one days after establishing the model, mice were intraperitoneally injected with 3% sodium pentobarbital and euthanized by overdose anesthesia at a dose of 90 mL/Kg, and organs and tissues were removed for follow-up studies. | |||
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | SNHG4 was downregulated in the neonatal pneumonia patient serum and its overexpression could inhibit LPS induced inflammatory injury in human lung fibroblasts and mouse lung tissue. The molecular mechanism underlying this protective effect was achieved by suppression of METTL3-mediated m6A modification levels of YTHDF1-dependent Signal transducer and activator of transcription 2 (STAT2) mRNA. | |||
| Responsed Disease | Congenital pneumonia [ICD-11: KB24] | |||
| Target Regulator | YTH domain-containing family protein 1 (YTHDF1) | READER | ||
| Target Regulation | Down regulation | |||
| Cell Process | Cell apoptosis | |||
| In-vitro Model | WI-38 | Normal | Homo sapiens | CVCL_0579 |
| In-vivo Model | All mice were housed under a 12 h light/dark cycle with constant temperature about 25 ℃ and relative humidity approximating 55 %. The mice had free access to food and water for 10 days prior to the experiment. Forty mice were randomly selected and divided into four groups of 10 mice each. After 10 days, mice received an intraperitoneal injection of 22 mg / mL sodium pentobarbital (diluted in saline) followed by 167 uM LPS (60 uL) Saline solution was instilled into the oral cavity through the posterior pharyngeal wall. Pinch the nares quickly and hold for 30 s, model is successful when all fluid is absorbed into the nasal cavity, and slight tracheal rales appear. Lentiviral vectors containing pcDNA-SNHG4 (150 uM) or pcDNA-3.1 were intratracheally injected into mice. Twenty-one days after establishing the model, mice were intraperitoneally injected with 3% sodium pentobarbital and euthanized by overdose anesthesia at a dose of 90 mL/Kg, and organs and tissues were removed for follow-up studies. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05342 | ||
| Epigenetic Regulator | Small nucleolar RNA host gene 4 (SNHG4) | |
| Regulated Target | Methyltransferase-like protein 3 (METTL3) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Congenital pneumonia | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00801)
| In total 11 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE005597 | Click to Show/Hide the Full List | ||
| mod site | chr12:56352030-56352031:- | [2] | |
| Sequence | GCGTGGTGGCACATACCTGTAATCCCAGCTACTCGGGAGGC | ||
| Transcript ID List | ENST00000314128.9; rmsk_3798945; ENST00000650805.1; ENST00000555519.5; ENST00000557235.5; ENST00000652624.1; ENST00000418572.7; ENST00000651301.1; ENST00000652398.1; ENST00000651967.1; ENST00000652741.1; ENST00000651078.1; ENST00000651915.1; ENST00000651805.1; ENST00000556140.6; ENST00000651934.1; ENST00000557156.1; ENST00000652091.1 | ||
| External Link | RMBase: RNA-editing_site_29124 | ||
| mod ID: A2ISITE005598 | Click to Show/Hide the Full List | ||
| mod site | chr12:56352539-56352540:- | [3] | |
| Sequence | GGCTGGAGTGCCTGGCCTTAAGTGATCTGCCCACCTTTGCT | ||
| Transcript ID List | ENST00000650805.1; ENST00000651915.1; ENST00000651967.1; ENST00000652741.1; ENST00000557156.1; ENST00000652398.1; ENST00000418572.7; ENST00000651805.1; ENST00000557235.5; ENST00000652091.1; ENST00000555519.5; ENST00000651078.1; ENST00000651301.1; ENST00000651934.1; ENST00000652624.1; ENST00000556140.6; ENST00000314128.9 | ||
| External Link | RMBase: RNA-editing_site_29125 | ||
| mod ID: A2ISITE005599 | Click to Show/Hide the Full List | ||
| mod site | chr12:56353045-56353046:- | [2] | |
| Sequence | GGTTGCAGTGAGCTGTGATCATGCCACTGTACTCCAGCCTG | ||
| Transcript ID List | ENST00000418572.7; rmsk_3798953; ENST00000557156.1; ENST00000652624.1; ENST00000652091.1; ENST00000651301.1; ENST00000651967.1; ENST00000651934.1; ENST00000556140.6; ENST00000651078.1; ENST00000652741.1; ENST00000555519.5; ENST00000651805.1; ENST00000314128.9; ENST00000650805.1; ENST00000557235.5; ENST00000651915.1; ENST00000652398.1 | ||
| External Link | RMBase: RNA-editing_site_29126 | ||
| mod ID: A2ISITE005600 | Click to Show/Hide the Full List | ||
| mod site | chr12:56353107-56353108:- | [2] | |
| Sequence | GCCTGTATTCCCAGCTACTCAGGAGGCTAAGGCAGGAAAAT | ||
| Transcript ID List | ENST00000651805.1; ENST00000651301.1; ENST00000652741.1; ENST00000651967.1; ENST00000556140.6; ENST00000652624.1; ENST00000555519.5; ENST00000650805.1; ENST00000652398.1; ENST00000557156.1; ENST00000651078.1; ENST00000418572.7; ENST00000651915.1; rmsk_3798953; ENST00000557235.5; ENST00000314128.9; ENST00000651934.1; ENST00000652091.1 | ||
| External Link | RMBase: RNA-editing_site_29127 | ||
| mod ID: A2ISITE005601 | Click to Show/Hide the Full List | ||
| mod site | chr12:56353121-56353122:- | [2] | |
| Sequence | GTGTGGTGGCGCATGCCTGTATTCCCAGCTACTCAGGAGGC | ||
| Transcript ID List | ENST00000652624.1; ENST00000651915.1; ENST00000652741.1; ENST00000418572.7; ENST00000556140.6; ENST00000651078.1; ENST00000651967.1; ENST00000650805.1; ENST00000652398.1; ENST00000651934.1; rmsk_3798953; ENST00000557235.5; ENST00000314128.9; ENST00000555519.5; ENST00000557156.1; ENST00000652091.1; ENST00000651805.1; ENST00000651301.1 | ||
| External Link | RMBase: RNA-editing_site_29128 | ||
| mod ID: A2ISITE005602 | Click to Show/Hide the Full List | ||
| mod site | chr12:56353260-56353261:- | [3] | |
| Sequence | GTCCGGACACAGTGGCTCACACATGTGGCCAGCACTGTGGG | ||
| Transcript ID List | ENST00000314128.9; ENST00000651078.1; ENST00000651967.1; ENST00000652398.1; ENST00000651915.1; ENST00000557235.5; ENST00000556140.6; ENST00000652624.1; ENST00000652741.1; ENST00000651805.1; ENST00000651934.1; ENST00000651301.1; ENST00000652091.1; rmsk_3798953; ENST00000555519.5; ENST00000557156.1; ENST00000650805.1; ENST00000418572.7 | ||
| External Link | RMBase: RNA-editing_site_29129 | ||
| mod ID: A2ISITE005603 | Click to Show/Hide the Full List | ||
| mod site | chr12:56353369-56353370:- | [3] | |
| Sequence | AAGGCTGAGGCAGGAGGATCACTTCAGTCTTGGGGTTTGAG | ||
| Transcript ID List | ENST00000652398.1; ENST00000314128.9; ENST00000556140.6; ENST00000651805.1; ENST00000652091.1; ENST00000652741.1; ENST00000651967.1; ENST00000651934.1; ENST00000651078.1; ENST00000651915.1; ENST00000557235.5; ENST00000652624.1; ENST00000557156.1; ENST00000555519.5; ENST00000418572.7; ENST00000650805.1; rmsk_3798954; ENST00000651301.1 | ||
| External Link | RMBase: RNA-editing_site_29130 | ||
| mod ID: A2ISITE005604 | Click to Show/Hide the Full List | ||
| mod site | chr12:56353382-56353383:- | [3] | |
| Sequence | CCTAGTACTTTGGAAGGCTGAGGCAGGAGGATCACTTCAGT | ||
| Transcript ID List | ENST00000651934.1; ENST00000652091.1; ENST00000651967.1; ENST00000652741.1; ENST00000556140.6; ENST00000557156.1; ENST00000652398.1; ENST00000651301.1; ENST00000314128.9; ENST00000651078.1; ENST00000555519.5; ENST00000651805.1; ENST00000651915.1; ENST00000557235.5; ENST00000650805.1; rmsk_3798954; ENST00000418572.7; ENST00000652624.1 | ||
| External Link | RMBase: RNA-editing_site_29131 | ||
| mod ID: A2ISITE005605 | Click to Show/Hide the Full List | ||
| mod site | chr12:56353827-56353828:- | [2] | |
| Sequence | AGTTTTTTTGTATTTTTAGTAGAGACGATGTTTCTCCATGT | ||
| Transcript ID List | ENST00000651967.1; ENST00000651934.1; ENST00000557156.1; ENST00000557235.5; ENST00000652624.1; ENST00000652741.1; ENST00000418572.7; ENST00000651301.1; ENST00000651805.1; ENST00000556140.6; ENST00000651078.1; ENST00000651915.1; ENST00000652091.1; ENST00000650805.1; ENST00000652398.1; ENST00000555519.5; ENST00000314128.9 | ||
| External Link | RMBase: RNA-editing_site_29132 | ||
| mod ID: A2ISITE005606 | Click to Show/Hide the Full List | ||
| mod site | chr12:56353919-56353920:- | [2] | |
| Sequence | CACTGCAACTTCCAACTCCCAGGTTCAAGCAATTCTCCTGT | ||
| Transcript ID List | ENST00000652741.1; ENST00000418572.7; ENST00000651915.1; ENST00000652398.1; ENST00000556140.6; ENST00000555519.5; ENST00000557235.5; ENST00000650805.1; ENST00000651301.1; ENST00000651805.1; ENST00000651967.1; ENST00000314128.9; ENST00000557156.1; ENST00000651934.1; ENST00000652624.1; ENST00000652091.1; ENST00000651078.1 | ||
| External Link | RMBase: RNA-editing_site_29133 | ||
| mod ID: A2ISITE005607 | Click to Show/Hide the Full List | ||
| mod site | chr12:56358891-56358892:- | [4] | |
| Sequence | CAATTTGTTGTTCTTTTGAGACAGAGTCTTGCTTTGTCACC | ||
| Transcript ID List | ENST00000651078.1; ENST00000651805.1; ENST00000650805.1; ENST00000651915.1; ENST00000651934.1; ENST00000314128.9; ENST00000418572.7; ENST00000652741.1; ENST00000556140.6; ENST00000652398.1; ENST00000651301.1; ENST00000557235.5; ENST00000555646.1; ENST00000557417.5; ENST00000652624.1; ENST00000652091.1 | ||
| External Link | RMBase: RNA-editing_site_29134 | ||
5-methylcytidine (m5C)
| In total 5 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE000056 | Click to Show/Hide the Full List | ||
| mod site | chr12:56343275-56343276:- | [5] | |
| Sequence | TCCCTTCCAAGCTGTGTTAACTGTTCAAACTCAGGCCTGTG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000652398.1; ENST00000650805.1; ENST00000651805.1; ENST00000652091.1; ENST00000556140.6; ENST00000651339.1; ENST00000557235.5; ENST00000651301.1; ENST00000652624.1; ENST00000652741.1; ENST00000651934.1; ENST00000651078.1; ENST00000651915.1; ENST00000314128.9; ENST00000651967.1; ENST00000556539.5 | ||
| External Link | RMBase: m5C_site_10410 | ||
| mod ID: M5CSITE000057 | Click to Show/Hide the Full List | ||
| mod site | chr12:56346847-56346848:- | [5] | |
| Sequence | ATCGTCAGAAGGGGGCATTACCTGCTCCTGGGTGGAGCACC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000557235.5; ENST00000651934.1; ENST00000651967.1; ENST00000555488.1; ENST00000556539.5; ENST00000651339.1; ENST00000651301.1; ENST00000652741.1; ENST00000651915.1; ENST00000652398.1; ENST00000652091.1; ENST00000557199.1; ENST00000651078.1; ENST00000650805.1; ENST00000556140.6; ENST00000314128.9; ENST00000651805.1; ENST00000652624.1 | ||
| External Link | RMBase: m5C_site_10411 | ||
| mod ID: M5CSITE000058 | Click to Show/Hide the Full List | ||
| mod site | chr12:56349024-56349025:- | [5] | |
| Sequence | CTCCAACCCCCCCAAGGCCCCCTGGAGCTTGCTGGGCCCTG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000651805.1; ENST00000418572.7; ENST00000651915.1; ENST00000652091.1; ENST00000314128.9; ENST00000651301.1; ENST00000651078.1; ENST00000651967.1; ENST00000557235.5; ENST00000556140.6; ENST00000652741.1; ENST00000556539.5; ENST00000652624.1; ENST00000651339.1; ENST00000650805.1; ENST00000652398.1; ENST00000651934.1 | ||
| External Link | RMBase: m5C_site_10412 | ||
| mod ID: M5CSITE000059 | Click to Show/Hide the Full List | ||
| mod site | chr12:56349216-56349217:- | [5] | |
| Sequence | ATTTCCAACATGAACCAGCTCTCAATTGCCTGGGCTTCAGT | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000652091.1; ENST00000652741.1; ENST00000651967.1; ENST00000418572.7; ENST00000651805.1; ENST00000556539.5; ENST00000651301.1; ENST00000651934.1; ENST00000651339.1; ENST00000650805.1; ENST00000651078.1; ENST00000557235.5; ENST00000651915.1; ENST00000314128.9; ENST00000652624.1; ENST00000556140.6; ENST00000652398.1 | ||
| External Link | RMBase: m5C_site_10413 | ||
| mod ID: M5CSITE000060 | Click to Show/Hide the Full List | ||
| mod site | chr12:56354856-56354857:- | [5] | |
| Sequence | TTCCCACCATCCAGGGAAGACACCCTCTCTGGACCCCCATC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000652091.1; ENST00000652398.1; ENST00000651915.1; ENST00000651301.1; ENST00000557156.1; ENST00000557235.5; ENST00000651967.1; ENST00000652624.1; ENST00000418572.7; ENST00000314128.9; ENST00000651805.1; ENST00000651078.1; ENST00000652741.1; ENST00000557417.5; ENST00000650805.1; ENST00000556140.6; ENST00000651934.1 | ||
| External Link | RMBase: m5C_site_10416 | ||
N6-methyladenosine (m6A)
| In total 68 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE013409 | Click to Show/Hide the Full List | ||
| mod site | chr12:56341855-56341856:- | [6] | |
| Sequence | TTCGTTGGTTGTGGACCTGGACAAAGTCCAAGTCTGTGGAA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000651805.1; ENST00000556539.5; ENST00000652741.1; ENST00000652624.1; ENST00000651934.1; ENST00000651915.1; ENST00000651301.1; ENST00000651078.1; ENST00000314128.9; ENST00000652091.1; ENST00000650805.1 | ||
| External Link | RMBase: m6A_site_193438 | ||
| mod ID: M6ASITE013410 | Click to Show/Hide the Full List | ||
| mod site | chr12:56341971-56341972:- | [7] | |
| Sequence | GGATAAAGTTTGGTGTTTTTACAGAGGAGAAGCAATGGGTC | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000651805.1; ENST00000651078.1; ENST00000314128.9; ENST00000651934.1; ENST00000652624.1; ENST00000651301.1; ENST00000652741.1; ENST00000651915.1; ENST00000556539.5; ENST00000650805.1; ENST00000652091.1 | ||
| External Link | RMBase: m6A_site_193439 | ||
| mod ID: M6ASITE013411 | Click to Show/Hide the Full List | ||
| mod site | chr12:56342966-56342967:- | [8] | |
| Sequence | GAGCACAGACACAGGATAGGACTCCATTTCTTTCTTCCATT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000652741.1; ENST00000651339.1; ENST00000650805.1; ENST00000651915.1; ENST00000556539.5; ENST00000314128.9; ENST00000652091.1; ENST00000557235.5; ENST00000651301.1; ENST00000651967.1; ENST00000652398.1; ENST00000556140.6; ENST00000651078.1; ENST00000652624.1; ENST00000651805.1; ENST00000651934.1 | ||
| External Link | RMBase: m6A_site_193440 | ||
| mod ID: M6ASITE013412 | Click to Show/Hide the Full List | ||
| mod site | chr12:56342978-56342979:- | [8] | |
| Sequence | GCCCTTGGTGGGGAGCACAGACACAGGATAGGACTCCATTT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000556140.6; ENST00000651915.1; ENST00000314128.9; ENST00000652091.1; ENST00000651967.1; ENST00000651934.1; ENST00000652398.1; ENST00000556539.5; ENST00000651078.1; ENST00000651339.1; ENST00000652741.1; ENST00000650805.1; ENST00000557235.5; ENST00000652624.1; ENST00000651301.1; ENST00000651805.1 | ||
| External Link | RMBase: m6A_site_193441 | ||
| mod ID: M6ASITE013413 | Click to Show/Hide the Full List | ||
| mod site | chr12:56343190-56343191:- | [8] | |
| Sequence | GGGGACAACAATGAATCAGAACAGATGCTGAGCCATAGGTC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000556539.5; ENST00000651915.1; ENST00000651805.1; ENST00000651339.1; ENST00000651967.1; ENST00000314128.9; ENST00000651301.1; ENST00000556140.6; ENST00000652741.1; ENST00000650805.1; ENST00000651934.1; ENST00000652624.1; ENST00000652398.1; ENST00000651078.1; ENST00000652091.1; rmsk_3798926; ENST00000557235.5 | ||
| External Link | RMBase: m6A_site_193442 | ||
| mod ID: M6ASITE013414 | Click to Show/Hide the Full List | ||
| mod site | chr12:56343206-56343207:- | [8] | |
| Sequence | ATAACATGGGTACAGAGGGGACAACAATGAATCAGAACAGA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000651339.1; ENST00000651934.1; ENST00000556539.5; ENST00000651967.1; ENST00000651078.1; ENST00000651301.1; ENST00000652091.1; ENST00000314128.9; ENST00000652741.1; ENST00000652398.1; rmsk_3798926; ENST00000652624.1; ENST00000651915.1; ENST00000556140.6; ENST00000557235.5; ENST00000650805.1; ENST00000651805.1 | ||
| External Link | RMBase: m6A_site_193443 | ||
| mod ID: M6ASITE013415 | Click to Show/Hide the Full List | ||
| mod site | chr12:56343267-56343268:- | [8] | |
| Sequence | AAGCTGTGTTAACTGTTCAAACTCAGGCCTGTGTGACTCCA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000556140.6; ENST00000557235.5; ENST00000652624.1; ENST00000652091.1; ENST00000314128.9; ENST00000652398.1; ENST00000651915.1; ENST00000556539.5; ENST00000651967.1; ENST00000651339.1; ENST00000651934.1; ENST00000652741.1; ENST00000651301.1; ENST00000650805.1; ENST00000651805.1; ENST00000651078.1 | ||
| External Link | RMBase: m6A_site_193444 | ||
| mod ID: M6ASITE013416 | Click to Show/Hide the Full List | ||
| mod site | chr12:56343385-56343386:- | [8] | |
| Sequence | ATGCCTTCTGACTTCTAGGAACCACATTTCCTCTGTTCTTT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651915.1; ENST00000314128.9; ENST00000652398.1; ENST00000556140.6; ENST00000651301.1; ENST00000651339.1; ENST00000556539.5; ENST00000652741.1; ENST00000651934.1; ENST00000652624.1; ENST00000557235.5; ENST00000651805.1; ENST00000650805.1; ENST00000652091.1; ENST00000651967.1; ENST00000651078.1 | ||
| External Link | RMBase: m6A_site_193445 | ||
| mod ID: M6ASITE013417 | Click to Show/Hide the Full List | ||
| mod site | chr12:56343412-56343413:- | [8] | |
| Sequence | AGCCACTTCTACACTGATGGACCCTTGATGCCTTCTGACTT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; MM6; HEK293A-TOA; iSLK; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000652624.1; ENST00000314128.9; ENST00000651339.1; ENST00000651967.1; ENST00000652398.1; ENST00000651915.1; ENST00000652091.1; ENST00000651805.1; ENST00000650805.1; ENST00000556140.6; ENST00000651301.1; ENST00000651078.1; ENST00000556539.5; ENST00000651934.1; ENST00000652741.1; ENST00000557235.5 | ||
| External Link | RMBase: m6A_site_193446 | ||
| mod ID: M6ASITE013418 | Click to Show/Hide the Full List | ||
| mod site | chr12:56343464-56343465:- | [8] | |
| Sequence | CCCACTGTTGGCTGGCCAGAACACCGTGGATGAGGTTTACG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; fibroblasts; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651805.1; ENST00000651915.1; ENST00000556539.5; ENST00000556140.6; ENST00000651301.1; ENST00000651078.1; ENST00000557235.5; ENST00000651934.1; ENST00000652741.1; ENST00000651339.1; ENST00000651967.1; ENST00000650805.1; ENST00000652398.1; ENST00000652624.1; ENST00000314128.9; ENST00000652091.1 | ||
| External Link | RMBase: m6A_site_193447 | ||
| mod ID: M6ASITE013419 | Click to Show/Hide the Full List | ||
| mod site | chr12:56343521-56343522:- | [8] | |
| Sequence | GGATTACCTAGTCTTCAGAAACTGTGTAAAGATTGAAGAAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; fibroblasts; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000556140.6; ENST00000556539.5; ENST00000651078.1; ENST00000652624.1; ENST00000652741.1; ENST00000651301.1; ENST00000650805.1; ENST00000557235.5; ENST00000652091.1; ENST00000651339.1; ENST00000651915.1; ENST00000314128.9; ENST00000651805.1; ENST00000652398.1; ENST00000651967.1; ENST00000651934.1 | ||
| External Link | RMBase: m6A_site_193448 | ||
| mod ID: M6ASITE013420 | Click to Show/Hide the Full List | ||
| mod site | chr12:56343841-56343842:- | [8] | |
| Sequence | CTGTGATCTGAGACATTTGAACACTGAGCCAATGGAAAGTA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; fibroblasts; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000652624.1; ENST00000651934.1; ENST00000652741.1; ENST00000556140.6; ENST00000651078.1; ENST00000314128.9; ENST00000651301.1; ENST00000651967.1; ENST00000650805.1; ENST00000556539.5; ENST00000651915.1; ENST00000652091.1; ENST00000651339.1; ENST00000557235.5; ENST00000651805.1; ENST00000652398.1 | ||
| External Link | RMBase: m6A_site_193449 | ||
| mod ID: M6ASITE013421 | Click to Show/Hide the Full List | ||
| mod site | chr12:56343849-56343850:- | [8] | |
| Sequence | GATTTGCCCTGTGATCTGAGACATTTGAACACTGAGCCAAT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; fibroblasts; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651301.1; ENST00000650805.1; ENST00000652624.1; ENST00000556140.6; ENST00000651339.1; ENST00000651805.1; ENST00000652398.1; ENST00000651967.1; ENST00000651915.1; ENST00000314128.9; ENST00000651078.1; ENST00000556539.5; ENST00000652741.1; ENST00000651934.1; ENST00000652091.1; ENST00000557235.5 | ||
| External Link | RMBase: m6A_site_193450 | ||
| mod ID: M6ASITE013422 | Click to Show/Hide the Full List | ||
| mod site | chr12:56343897-56343898:- | [8] | |
| Sequence | GTGCCAGAGCCAGACCAAGGACCTGTATCACAGCCAGTGCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; fibroblasts; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000314128.9; ENST00000557235.5; ENST00000556140.6; ENST00000652398.1; ENST00000651301.1; ENST00000651339.1; ENST00000651078.1; ENST00000651805.1; ENST00000652624.1; ENST00000556539.5; ENST00000651967.1; ENST00000650805.1; ENST00000652741.1; ENST00000652091.1; ENST00000651934.1; ENST00000651915.1 | ||
| External Link | RMBase: m6A_site_193451 | ||
| mod ID: M6ASITE013423 | Click to Show/Hide the Full List | ||
| mod site | chr12:56343904-56343905:- | [8] | |
| Sequence | ACAAACAGTGCCAGAGCCAGACCAAGGACCTGTATCACAGC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; fibroblasts; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000557235.5; ENST00000556140.6; ENST00000651078.1; ENST00000650805.1; ENST00000652398.1; ENST00000652741.1; ENST00000652091.1; ENST00000651915.1; ENST00000556539.5; ENST00000651934.1; ENST00000651967.1; ENST00000651339.1; ENST00000651301.1; ENST00000652624.1; ENST00000314128.9; ENST00000651805.1 | ||
| External Link | RMBase: m6A_site_193452 | ||
| mod ID: M6ASITE013424 | Click to Show/Hide the Full List | ||
| mod site | chr12:56343920-56343921:- | [8] | |
| Sequence | CACTATGCATGGTATCACAAACAGTGCCAGAGCCAGACCAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; fibroblasts; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651301.1; ENST00000652091.1; ENST00000557235.5; ENST00000556539.5; ENST00000556140.6; ENST00000652741.1; ENST00000651934.1; ENST00000651967.1; ENST00000651078.1; ENST00000652624.1; ENST00000651339.1; ENST00000651915.1; ENST00000314128.9; ENST00000650805.1; ENST00000652398.1; ENST00000651805.1 | ||
| External Link | RMBase: m6A_site_193453 | ||
| mod ID: M6ASITE013425 | Click to Show/Hide the Full List | ||
| mod site | chr12:56343941-56343942:- | [6] | |
| Sequence | TGGAGCCTGTGATAGAGCCCACACTATGCATGGTATCACAA | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000651915.1; ENST00000651967.1; ENST00000557235.5; ENST00000651339.1; ENST00000556539.5; ENST00000652398.1; ENST00000651078.1; ENST00000651934.1; ENST00000652624.1; ENST00000652091.1; ENST00000652741.1; ENST00000556140.6; ENST00000314128.9; ENST00000651805.1; ENST00000650805.1; ENST00000651301.1 | ||
| External Link | RMBase: m6A_site_193454 | ||
| mod ID: M6ASITE013426 | Click to Show/Hide the Full List | ||
| mod site | chr12:56344030-56344031:- | [8] | |
| Sequence | AGAGCCAGAGCTCAGCCTGGACTTAGAGCCACTGCTGAAGG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; fibroblasts; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651078.1; ENST00000651967.1; ENST00000556140.6; ENST00000651934.1; ENST00000314128.9; ENST00000650805.1; ENST00000652741.1; ENST00000651915.1; ENST00000651339.1; ENST00000651301.1; ENST00000652091.1; ENST00000651805.1; ENST00000557235.5; ENST00000652398.1; ENST00000556539.5; ENST00000652624.1 | ||
| External Link | RMBase: m6A_site_193455 | ||
| mod ID: M6ASITE013427 | Click to Show/Hide the Full List | ||
| mod site | chr12:56344065-56344066:- | [8] | |
| Sequence | CTGGAGTCATTAGAGCTGGAACTAGGGCTGGTGCCAGAGCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; fibroblasts; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651339.1; ENST00000652624.1; ENST00000652398.1; ENST00000652741.1; ENST00000651967.1; ENST00000651301.1; ENST00000652091.1; ENST00000556140.6; ENST00000557235.5; ENST00000651934.1; ENST00000651805.1; ENST00000651078.1; ENST00000650805.1; ENST00000651915.1; ENST00000556539.5; ENST00000314128.9 | ||
| External Link | RMBase: m6A_site_193456 | ||
| mod ID: M6ASITE013428 | Click to Show/Hide the Full List | ||
| mod site | chr12:56344116-56344117:- | [6] | |
| Sequence | AGACAGGTGGATGAACTGCAACAACCGCTGGAGCTTAAGCC | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000652091.1; ENST00000651078.1; ENST00000651339.1; ENST00000557235.5; ENST00000650805.1; ENST00000314128.9; ENST00000555488.1; ENST00000652741.1; ENST00000556140.6; ENST00000651915.1; ENST00000651967.1; ENST00000651805.1; ENST00000652624.1; ENST00000556539.5; ENST00000652398.1; ENST00000651301.1; ENST00000651934.1 | ||
| External Link | RMBase: m6A_site_193457 | ||
| mod ID: M6ASITE013429 | Click to Show/Hide the Full List | ||
| mod site | chr12:56344122-56344123:- | [8] | |
| Sequence | GTATCCAGACAGGTGGATGAACTGCAACAACCGCTGGAGCT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; Huh7; Jurkat; HEK293A-TOA; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651805.1; ENST00000651078.1; ENST00000557235.5; ENST00000651339.1; ENST00000556539.5; ENST00000555488.1; ENST00000652741.1; ENST00000556140.6; ENST00000651934.1; ENST00000651301.1; ENST00000651967.1; ENST00000314128.9; ENST00000652624.1; ENST00000652091.1; ENST00000652398.1; ENST00000651915.1; ENST00000650805.1 | ||
| External Link | RMBase: m6A_site_193458 | ||
| mod ID: M6ASITE013430 | Click to Show/Hide the Full List | ||
| mod site | chr12:56346171-56346172:- | [8] | |
| Sequence | GAACGGAGGAAATACCTGAAACACAGGCTCATTGTGGTCTC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; HEK293A-TOA | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651934.1; ENST00000651301.1; ENST00000652741.1; ENST00000652624.1; ENST00000651967.1; ENST00000652091.1; ENST00000556539.5; ENST00000556140.6; ENST00000650805.1; ENST00000652398.1; ENST00000651339.1; ENST00000651078.1; ENST00000651805.1; ENST00000555488.1; ENST00000314128.9; ENST00000557235.5; ENST00000651915.1 | ||
| External Link | RMBase: m6A_site_193459 | ||
| mod ID: M6ASITE013431 | Click to Show/Hide the Full List | ||
| mod site | chr12:56346593-56346594:- | [6] | |
| Sequence | CATCTACTCTGTGCAACCGTACACGAAGGAGGTGCTGCAGT | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000556140.6; ENST00000652741.1; ENST00000651301.1; ENST00000314128.9; ENST00000651934.1; ENST00000651078.1; ENST00000650805.1; ENST00000557235.5; ENST00000652091.1; ENST00000555488.1; ENST00000652398.1; ENST00000556539.5; ENST00000651805.1; ENST00000652624.1; ENST00000651339.1; ENST00000651967.1; ENST00000651915.1 | ||
| External Link | RMBase: m6A_site_193460 | ||
| mod ID: M6ASITE013432 | Click to Show/Hide the Full List | ||
| mod site | chr12:56346700-56346701:- | [9] | |
| Sequence | AATCCCTCAGCTGGTTTGGGACTGGGCAGCCAGAGCAGAGA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HEK293A-TOA | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000557199.1; ENST00000651339.1; ENST00000652091.1; ENST00000651934.1; ENST00000650805.1; ENST00000652741.1; ENST00000652398.1; ENST00000651805.1; ENST00000651301.1; ENST00000555488.1; ENST00000556140.6; ENST00000556539.5; ENST00000652624.1; ENST00000651967.1; ENST00000651078.1; ENST00000651915.1; ENST00000314128.9; ENST00000557235.5 | ||
| External Link | RMBase: m6A_site_193461 | ||
| mod ID: M6ASITE013433 | Click to Show/Hide the Full List | ||
| mod site | chr12:56346724-56346725:- | [9] | |
| Sequence | CTTGGCTTCCCTGGCTCTGAACTGAATCCCTCAGCTGGTTT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HEK293A-TOA | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000650805.1; ENST00000555488.1; ENST00000557235.5; ENST00000314128.9; ENST00000651339.1; ENST00000556140.6; ENST00000651934.1; ENST00000651078.1; ENST00000557199.1; ENST00000652624.1; ENST00000652398.1; ENST00000556539.5; ENST00000652741.1; ENST00000651915.1; ENST00000651805.1; ENST00000652091.1; ENST00000651301.1; ENST00000651967.1 | ||
| External Link | RMBase: m6A_site_193462 | ||
| mod ID: M6ASITE013434 | Click to Show/Hide the Full List | ||
| mod site | chr12:56346902-56346903:- | [8] | |
| Sequence | AGCGCCGGCTGCTGAAGAAGACCATGTCTGGCACCTTTCTA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000651915.1; ENST00000651078.1; ENST00000556539.5; ENST00000651339.1; ENST00000651805.1; ENST00000651934.1; ENST00000652741.1; ENST00000652624.1; ENST00000557199.1; ENST00000652091.1; ENST00000314128.9; ENST00000651967.1; ENST00000652398.1; ENST00000557235.5; ENST00000556140.6; ENST00000651301.1; ENST00000650805.1 | ||
| External Link | RMBase: m6A_site_193463 | ||
| mod ID: M6ASITE013435 | Click to Show/Hide the Full List | ||
| mod site | chr12:56348560-56348561:- | [10] | |
| Sequence | GACAAAATTCTGGAGTTGGTACATGACCACCTGAAGGATCT | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000651915.1; ENST00000556539.5; ENST00000557199.1; ENST00000651301.1; ENST00000557235.5; ENST00000314128.9; ENST00000652398.1; ENST00000651967.1; ENST00000652091.1; ENST00000651805.1; ENST00000651078.1; ENST00000651934.1; ENST00000652741.1; ENST00000556140.6; ENST00000650805.1; ENST00000652624.1; ENST00000651339.1 | ||
| External Link | RMBase: m6A_site_193464 | ||
| mod ID: M6ASITE013436 | Click to Show/Hide the Full List | ||
| mod site | chr12:56348579-56348580:- | [11] | |
| Sequence | ACCATTCTGGACATGGCTGGACAAAATTCTGGAGTTGGTAC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000650805.1; ENST00000314128.9; ENST00000557235.5; ENST00000556539.5; ENST00000556140.6; ENST00000651339.1; ENST00000652398.1; ENST00000652091.1; ENST00000652741.1; ENST00000651915.1; ENST00000651805.1; ENST00000652624.1; ENST00000651078.1; ENST00000651301.1; ENST00000557199.1; ENST00000651934.1; ENST00000651967.1 | ||
| External Link | RMBase: m6A_site_193465 | ||
| mod ID: M6ASITE013437 | Click to Show/Hide the Full List | ||
| mod site | chr12:56348589-56348590:- | [10] | |
| Sequence | CTGGCAAGTTACCATTCTGGACATGGCTGGACAAAATTCTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | kidney; endometrial | ||
| Seq Type List | m6A-REF-seq; m6A-seq | ||
| Transcript ID List | ENST00000314128.9; ENST00000556140.6; ENST00000557199.1; ENST00000651915.1; ENST00000651934.1; ENST00000652091.1; ENST00000651805.1; ENST00000652741.1; ENST00000650805.1; ENST00000651078.1; ENST00000556539.5; ENST00000651967.1; ENST00000652398.1; ENST00000557235.5; ENST00000651339.1; ENST00000652624.1; ENST00000651301.1 | ||
| External Link | RMBase: m6A_site_193466 | ||
| mod ID: M6ASITE013438 | Click to Show/Hide the Full List | ||
| mod site | chr12:56349485-56349486:- | [12] | |
| Sequence | CCACTAGGTGTGACAGAGGAACTGCACATCATCAGCTTCAC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | MT4; Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000651805.1; ENST00000418572.7; ENST00000557235.5; ENST00000652624.1; ENST00000556539.5; ENST00000651078.1; ENST00000651934.1; ENST00000650805.1; ENST00000314128.9; ENST00000651967.1; ENST00000651915.1; ENST00000652091.1; ENST00000651301.1; ENST00000652398.1; ENST00000556140.6; ENST00000652741.1 | ||
| External Link | RMBase: m6A_site_193467 | ||
| mod ID: M6ASITE013439 | Click to Show/Hide the Full List | ||
| mod site | chr12:56349635-56349636:- | [12] | |
| Sequence | TCCTTCCCTTCAATTCACAGACTCTGGTGGAGCAACGTTCA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | MT4; Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000556539.5; ENST00000418572.7; ENST00000557235.5; ENST00000652741.1; ENST00000651805.1; ENST00000555519.5; ENST00000651934.1; ENST00000314128.9; ENST00000556140.6; ENST00000652624.1; ENST00000651078.1; ENST00000651301.1; ENST00000651967.1; ENST00000652091.1; ENST00000652398.1; ENST00000650805.1; ENST00000651915.1 | ||
| External Link | RMBase: m6A_site_193468 | ||
| mod ID: M6ASITE013440 | Click to Show/Hide the Full List | ||
| mod site | chr12:56349685-56349686:- | [12] | |
| Sequence | GCCAAACAGGGGTTCCAGGGACACTAGGGTGCCCACTCTGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | MT4 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000557235.5; ENST00000650805.1; ENST00000651915.1; ENST00000556140.6; ENST00000651301.1; ENST00000652741.1; ENST00000555519.5; ENST00000652398.1; ENST00000418572.7; ENST00000314128.9; ENST00000651934.1; ENST00000651967.1; ENST00000652091.1; ENST00000556539.5; ENST00000651805.1; ENST00000651078.1; ENST00000652624.1 | ||
| External Link | RMBase: m6A_site_193469 | ||
| mod ID: M6ASITE013441 | Click to Show/Hide the Full List | ||
| mod site | chr12:56349700-56349701:- | [12] | |
| Sequence | TTGAGAGGTCTTGAAGCCAAACAGGGGTTCCAGGGACACTA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | MT4 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000651967.1; ENST00000651934.1; ENST00000651915.1; ENST00000418572.7; ENST00000652741.1; ENST00000652091.1; ENST00000555519.5; ENST00000652398.1; ENST00000651805.1; ENST00000556539.5; ENST00000651301.1; ENST00000652624.1; ENST00000556140.6; ENST00000314128.9; ENST00000651078.1; ENST00000650805.1; ENST00000557235.5 | ||
| External Link | RMBase: m6A_site_193470 | ||
| mod ID: M6ASITE013442 | Click to Show/Hide the Full List | ||
| mod site | chr12:56350301-56350302:- | [13] | |
| Sequence | GAGGGGGATTTGGGATATGGACAAAGGGAGATGGCGAGATC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000652091.1; ENST00000651934.1; ENST00000557252.1; ENST00000652741.1; ENST00000651915.1; ENST00000651805.1; ENST00000651078.1; ENST00000418572.7; ENST00000314128.9; ENST00000651301.1; ENST00000651967.1; ENST00000555519.5; ENST00000557235.5; ENST00000652398.1; ENST00000650805.1; ENST00000556140.6; ENST00000652624.1 | ||
| External Link | RMBase: m6A_site_193471 | ||
| mod ID: M6ASITE013443 | Click to Show/Hide the Full List | ||
| mod site | chr12:56350329-56350330:- | [13] | |
| Sequence | CGGCAGCCCTGGTGGCACAAACAAGGAAGAGGGGGATTTGG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | fibroblasts | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000652741.1; ENST00000651301.1; ENST00000555519.5; ENST00000418572.7; ENST00000652398.1; ENST00000650805.1; ENST00000314128.9; ENST00000651078.1; ENST00000651805.1; ENST00000557252.1; ENST00000652624.1; ENST00000651915.1; ENST00000651967.1; ENST00000557235.5; ENST00000652091.1; ENST00000556140.6; ENST00000651934.1 | ||
| External Link | RMBase: m6A_site_193472 | ||
| mod ID: M6ASITE013444 | Click to Show/Hide the Full List | ||
| mod site | chr12:56350875-56350876:- | [8] | |
| Sequence | TCCCCCAGGCTGCTGGTGAGACTCCAGGAAGGCAATGAGTC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; MT4; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000652398.1; ENST00000651934.1; ENST00000556140.6; ENST00000652624.1; ENST00000557235.5; ENST00000418572.7; ENST00000555519.5; ENST00000652741.1; ENST00000652091.1; ENST00000651805.1; ENST00000651078.1; ENST00000314128.9; ENST00000651967.1; ENST00000557252.1; ENST00000651915.1; ENST00000651301.1; ENST00000650805.1 | ||
| External Link | RMBase: m6A_site_193473 | ||
| mod ID: M6ASITE013445 | Click to Show/Hide the Full List | ||
| mod site | chr12:56351101-56351102:- | [8] | |
| Sequence | GCAGCAAGTTCACCGTCCGAACAAGGTTGGCATTCCAGAAC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; MT4; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000555519.5; ENST00000651967.1; ENST00000651915.1; ENST00000650805.1; ENST00000556140.6; ENST00000652741.1; ENST00000651301.1; ENST00000651078.1; ENST00000652091.1; ENST00000651805.1; ENST00000651934.1; ENST00000652624.1; ENST00000418572.7; ENST00000652398.1; ENST00000557235.5; ENST00000557252.1; ENST00000314128.9 | ||
| External Link | RMBase: m6A_site_193474 | ||
| mod ID: M6ASITE013446 | Click to Show/Hide the Full List | ||
| mod site | chr12:56351125-56351126:- | [8] | |
| Sequence | ATCGACCCCTCATCCTCAAGACTGGCAGCAAGTTCACCGTC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; MT4; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000652398.1; ENST00000652624.1; ENST00000557252.1; ENST00000557235.5; ENST00000651967.1; ENST00000556140.6; ENST00000651915.1; ENST00000555519.5; ENST00000652091.1; ENST00000652741.1; ENST00000651301.1; ENST00000418572.7; ENST00000651078.1; ENST00000651805.1; ENST00000650805.1; ENST00000314128.9; ENST00000651934.1 | ||
| External Link | RMBase: m6A_site_193475 | ||
| mod ID: M6ASITE013447 | Click to Show/Hide the Full List | ||
| mod site | chr12:56351152-56351153:- | [8] | |
| Sequence | CCCAGCCCTGCATGCCCCAAACTCCCCATCGACCCCTCATC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; MT4; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000557252.1; ENST00000651805.1; ENST00000650805.1; ENST00000418572.7; ENST00000556140.6; ENST00000651078.1; ENST00000652624.1; ENST00000557235.5; ENST00000314128.9; ENST00000651967.1; ENST00000652091.1; ENST00000652398.1; ENST00000652741.1; ENST00000651915.1; ENST00000651934.1; ENST00000555519.5; ENST00000651301.1 | ||
| External Link | RMBase: m6A_site_193476 | ||
| mod ID: M6ASITE013448 | Click to Show/Hide the Full List | ||
| mod site | chr12:56351173-56351174:- | [8] | |
| Sequence | TCAGAGCCTTTGTGGTAGAAACCCAGCCCTGCATGCCCCAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; MT4; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651967.1; ENST00000652624.1; ENST00000651301.1; ENST00000314128.9; ENST00000556140.6; ENST00000555519.5; ENST00000650805.1; ENST00000557252.1; ENST00000652741.1; ENST00000652398.1; ENST00000651934.1; ENST00000651078.1; ENST00000652091.1; ENST00000418572.7; ENST00000651915.1; ENST00000557235.5; ENST00000651805.1 | ||
| External Link | RMBase: m6A_site_193477 | ||
| mod ID: M6ASITE013449 | Click to Show/Hide the Full List | ||
| mod site | chr12:56351252-56351253:- | [11] | |
| Sequence | AACCCTGGGGGAAAGAAGGAACAAGGGAAGCCATTCTTACA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000652741.1; ENST00000651301.1; ENST00000555519.5; ENST00000650805.1; ENST00000557235.5; ENST00000651078.1; ENST00000314128.9; ENST00000418572.7; ENST00000557156.1; ENST00000651915.1; ENST00000556140.6; ENST00000652091.1; ENST00000651967.1; ENST00000651805.1; ENST00000651934.1; ENST00000652624.1; ENST00000652398.1 | ||
| External Link | RMBase: m6A_site_193478 | ||
| mod ID: M6ASITE013450 | Click to Show/Hide the Full List | ||
| mod site | chr12:56351271-56351272:- | [11] | |
| Sequence | GGTCTAGAGGCCAGGCAGGAACCCTGGGGGAAAGAAGGAAC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000651915.1; ENST00000557235.5; ENST00000652624.1; ENST00000314128.9; ENST00000652398.1; ENST00000652741.1; ENST00000651078.1; ENST00000555519.5; ENST00000651301.1; ENST00000652091.1; ENST00000557156.1; ENST00000418572.7; ENST00000651967.1; ENST00000651934.1; ENST00000651805.1; ENST00000556140.6; ENST00000650805.1 | ||
| External Link | RMBase: m6A_site_193479 | ||
| mod ID: M6ASITE013451 | Click to Show/Hide the Full List | ||
| mod site | chr12:56351339-56351340:- | [8] | |
| Sequence | CCCTCTGACCAAAGGGGTGGACCTACGCAACGCCCAGGTCA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; CD4T; endometrial; NB4; MM6 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000650805.1; ENST00000652398.1; ENST00000651934.1; ENST00000652741.1; ENST00000557235.5; ENST00000651915.1; ENST00000556140.6; ENST00000314128.9; ENST00000652624.1; ENST00000555519.5; ENST00000652091.1; ENST00000651967.1; ENST00000651805.1; ENST00000651301.1; ENST00000557156.1; ENST00000651078.1; ENST00000418572.7 | ||
| External Link | RMBase: m6A_site_193480 | ||
| mod ID: M6ASITE013452 | Click to Show/Hide the Full List | ||
| mod site | chr12:56351389-56351390:- | [8] | |
| Sequence | CTGCTGAAGGAGCTGAAGGGACTGAGTTGCCTGGTTAGCTA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; CD4T; endometrial; NB4; MM6 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000651967.1; ENST00000314128.9; ENST00000651934.1; ENST00000651078.1; ENST00000652624.1; ENST00000651301.1; ENST00000418572.7; ENST00000557156.1; ENST00000650805.1; ENST00000652091.1; ENST00000651915.1; ENST00000652741.1; ENST00000557235.5; ENST00000651805.1; ENST00000652398.1; ENST00000555519.5; ENST00000556140.6 | ||
| External Link | RMBase: m6A_site_193481 | ||
| mod ID: M6ASITE013453 | Click to Show/Hide the Full List | ||
| mod site | chr12:56353274-56353275:- | [8] | |
| Sequence | TTTTAATTAGGCATGTCCGGACACAGTGGCTCACACATGTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; CD4T; endometrial; NB4; MM6 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000651915.1; ENST00000651805.1; ENST00000651078.1; ENST00000557235.5; ENST00000650805.1; ENST00000651934.1; ENST00000652741.1; ENST00000651967.1; ENST00000557156.1; ENST00000314128.9; ENST00000652091.1; ENST00000652398.1; ENST00000651301.1; ENST00000418572.7; ENST00000555519.5; ENST00000556140.6; rmsk_3798953; ENST00000652624.1 | ||
| External Link | RMBase: m6A_site_193482 | ||
| mod ID: M6ASITE013454 | Click to Show/Hide the Full List | ||
| mod site | chr12:56354469-56354470:- | [8] | |
| Sequence | ACGGGTTGGAACAGCTGGAGACATGGTGAGAGGTACCACCC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; Jurkat; CD4T; endometrial; NB4; MM6 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000555519.5; ENST00000651915.1; ENST00000651934.1; ENST00000652398.1; ENST00000651301.1; ENST00000557235.5; ENST00000651967.1; ENST00000652091.1; ENST00000418572.7; ENST00000556140.6; ENST00000652741.1; ENST00000314128.9; ENST00000652624.1; ENST00000651805.1; ENST00000557156.1; ENST00000651078.1; ENST00000650805.1 | ||
| External Link | RMBase: m6A_site_193483 | ||
| mod ID: M6ASITE013455 | Click to Show/Hide the Full List | ||
| mod site | chr12:56354479-56354480:- | [8] | |
| Sequence | CCCATTGACCACGGGTTGGAACAGCTGGAGACATGGTGAGA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; Jurkat; CD4T; endometrial; NB4; MM6 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000314128.9; ENST00000556140.6; ENST00000651967.1; ENST00000651805.1; ENST00000557156.1; ENST00000418572.7; ENST00000652398.1; ENST00000555519.5; ENST00000652741.1; ENST00000557235.5; ENST00000650805.1; ENST00000652624.1; ENST00000651915.1; ENST00000652091.1; ENST00000651078.1; ENST00000651934.1; ENST00000651301.1 | ||
| External Link | RMBase: m6A_site_193484 | ||
| mod ID: M6ASITE013456 | Click to Show/Hide the Full List | ||
| mod site | chr12:56354574-56354575:- | [14] | |
| Sequence | AAGCACTGCTAGGCCGATTAACTACCCTAATCGAGCTACTG | ||
| Motif Score | 2.590089286 | ||
| Cell/Tissue List | AML | ||
| Seq Type List | miCLIP | ||
| Transcript ID List | ENST00000652741.1; ENST00000651915.1; ENST00000652398.1; ENST00000651078.1; ENST00000651805.1; ENST00000314128.9; ENST00000557417.5; ENST00000652091.1; ENST00000651967.1; ENST00000418572.7; ENST00000652624.1; ENST00000556140.6; ENST00000651934.1; ENST00000650805.1; ENST00000557235.5; ENST00000651301.1; ENST00000557156.1 | ||
| External Link | RMBase: m6A_site_193485 | ||
| mod ID: M6ASITE013457 | Click to Show/Hide the Full List | ||
| mod site | chr12:56354790-56354791:- | [8] | |
| Sequence | GGAAACTCTCAATGAACTGGACAAAAGGAGAAAGGTGGGAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; MT4; Jurkat; HEK293A-TOA; endometrial; NB4; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651805.1; ENST00000652398.1; ENST00000314128.9; ENST00000652091.1; ENST00000556140.6; ENST00000652624.1; ENST00000651934.1; ENST00000651915.1; ENST00000651301.1; ENST00000651967.1; ENST00000557235.5; ENST00000418572.7; ENST00000557417.5; ENST00000650805.1; ENST00000557156.1; ENST00000651078.1; ENST00000652741.1 | ||
| External Link | RMBase: m6A_site_193486 | ||
| mod ID: M6ASITE013458 | Click to Show/Hide the Full List | ||
| mod site | chr12:56354795-56354796:- | [8] | |
| Sequence | CTGCAGGAAACTCTCAATGAACTGGACAAAAGGAGAAAGGT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; MT4; Jurkat; HEK293A-TOA; endometrial; NB4; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000557156.1; ENST00000557235.5; ENST00000557417.5; ENST00000651934.1; ENST00000651805.1; ENST00000650805.1; ENST00000651915.1; ENST00000652741.1; ENST00000651967.1; ENST00000556140.6; ENST00000418572.7; ENST00000314128.9; ENST00000652091.1; ENST00000652398.1; ENST00000652624.1; ENST00000651078.1; ENST00000651301.1 | ||
| External Link | RMBase: m6A_site_193487 | ||
| mod ID: M6ASITE013459 | Click to Show/Hide the Full List | ||
| mod site | chr12:56354806-56354807:- | [8] | |
| Sequence | AGCAGAAGATTCTGCAGGAAACTCTCAATGAACTGGACAAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; MT4; Jurkat; HEK293A-TOA; endometrial; NB4; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000314128.9; ENST00000557156.1; ENST00000652398.1; ENST00000557417.5; ENST00000652091.1; ENST00000651967.1; ENST00000651934.1; ENST00000418572.7; ENST00000557235.5; ENST00000652741.1; ENST00000651301.1; ENST00000651805.1; ENST00000556140.6; ENST00000651915.1; ENST00000650805.1; ENST00000652624.1; ENST00000651078.1 | ||
| External Link | RMBase: m6A_site_193488 | ||
| mod ID: M6ASITE013460 | Click to Show/Hide the Full List | ||
| mod site | chr12:56354833-56354834:- | [8] | |
| Sequence | CCTCTCTGGACCCCCATCAGACCAAAGAGCAGAAGATTCTG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; MT4; Jurkat; HEK293A-TOA; endometrial; NB4; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000557156.1; ENST00000651915.1; ENST00000652624.1; ENST00000314128.9; ENST00000652091.1; ENST00000651078.1; ENST00000651934.1; ENST00000650805.1; ENST00000652741.1; ENST00000418572.7; ENST00000652398.1; ENST00000557235.5; ENST00000557417.5; ENST00000651967.1; ENST00000651301.1; ENST00000651805.1; ENST00000556140.6 | ||
| External Link | RMBase: m6A_site_193489 | ||
| mod ID: M6ASITE013461 | Click to Show/Hide the Full List | ||
| mod site | chr12:56354844-56354845:- | [8] | |
| Sequence | AGGGAAGACACCCTCTCTGGACCCCCATCAGACCAAAGAGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; MT4; Jurkat; HEK293A-TOA; endometrial; NB4; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000314128.9; ENST00000651967.1; ENST00000652091.1; ENST00000652398.1; ENST00000556140.6; ENST00000650805.1; ENST00000557417.5; ENST00000557235.5; ENST00000557156.1; ENST00000651078.1; ENST00000651805.1; ENST00000651934.1; ENST00000651301.1; ENST00000418572.7; ENST00000651915.1; ENST00000652741.1; ENST00000652624.1 | ||
| External Link | RMBase: m6A_site_193490 | ||
| mod ID: M6ASITE013462 | Click to Show/Hide the Full List | ||
| mod site | chr12:56354857-56354858:- | [8] | |
| Sequence | GTTCCCACCATCCAGGGAAGACACCCTCTCTGGACCCCCAT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; MT4; Jurkat; HEK293A-TOA; endometrial; NB4; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000652741.1; ENST00000651915.1; ENST00000557156.1; ENST00000652624.1; ENST00000652398.1; ENST00000651934.1; ENST00000651967.1; ENST00000651805.1; ENST00000557235.5; ENST00000650805.1; ENST00000651301.1; ENST00000557417.5; ENST00000556140.6; ENST00000651078.1; ENST00000418572.7; ENST00000652091.1; ENST00000314128.9 | ||
| External Link | RMBase: m6A_site_193491 | ||
| mod ID: M6ASITE013463 | Click to Show/Hide the Full List | ||
| mod site | chr12:56354887-56354888:- | [8] | |
| Sequence | GGAGAGGAAAGAACCCCTGGACTGACTCCTGTTCCCACCAT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; MT4; Jurkat; HEK293A-TOA; endometrial; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651805.1; ENST00000556140.6; ENST00000418572.7; ENST00000652624.1; ENST00000652091.1; ENST00000650805.1; ENST00000652398.1; ENST00000652741.1; ENST00000651967.1; ENST00000651078.1; ENST00000557417.5; ENST00000651934.1; ENST00000651915.1; ENST00000651301.1; ENST00000557235.5; ENST00000314128.9 | ||
| External Link | RMBase: m6A_site_193492 | ||
| mod ID: M6ASITE013464 | Click to Show/Hide the Full List | ||
| mod site | chr12:56354895-56354896:- | [8] | |
| Sequence | GTCAGGAAGGAGAGGAAAGAACCCCTGGACTGACTCCTGTT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; Jurkat; HEK293A-TOA; endometrial; NB4 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000556140.6; ENST00000650805.1; ENST00000557235.5; ENST00000652091.1; ENST00000557417.5; ENST00000652741.1; ENST00000418572.7; ENST00000651967.1; ENST00000651301.1; ENST00000314128.9; ENST00000651078.1; ENST00000651934.1; ENST00000651915.1; ENST00000652624.1; ENST00000652398.1; ENST00000651805.1 | ||
| External Link | RMBase: m6A_site_193493 | ||
| mod ID: M6ASITE013465 | Click to Show/Hide the Full List | ||
| mod site | chr12:56354921-56354922:- | [8] | |
| Sequence | CCTTCCTGACTCTGACTGAGACCCCAGTCAGGAAGGAGAGG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000556140.6; ENST00000650805.1; ENST00000652741.1; ENST00000651078.1; ENST00000557417.5; ENST00000651301.1; ENST00000652398.1; ENST00000651934.1; ENST00000651805.1; ENST00000652091.1; ENST00000651967.1; ENST00000314128.9; ENST00000651915.1; ENST00000557235.5; ENST00000418572.7; ENST00000652624.1 | ||
| External Link | RMBase: m6A_site_193494 | ||
| mod ID: M6ASITE013466 | Click to Show/Hide the Full List | ||
| mod site | chr12:56355319-56355320:- | [8] | |
| Sequence | ATCCATCAGCCAACTGAAAGACCAGCAGGATGTCTTCTGCT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000557417.5; ENST00000418572.7; ENST00000650805.1; ENST00000651915.1; ENST00000651078.1; ENST00000652741.1; ENST00000556140.6; ENST00000557235.5; ENST00000651805.1; ENST00000652398.1; ENST00000314128.9; ENST00000651934.1; ENST00000651301.1; ENST00000651967.1; ENST00000555646.1; ENST00000652624.1; ENST00000652091.1 | ||
| External Link | RMBase: m6A_site_193495 | ||
| mod ID: M6ASITE013467 | Click to Show/Hide the Full List | ||
| mod site | chr12:56355507-56355508:- | [8] | |
| Sequence | AAGGAGAGCCAGTTCTCGAAACACCTGTGGAGAGCCAGCAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000652741.1; ENST00000651805.1; ENST00000418572.7; ENST00000651915.1; ENST00000651934.1; ENST00000651078.1; ENST00000555646.1; ENST00000314128.9; ENST00000652091.1; ENST00000652624.1; ENST00000556140.6; ENST00000652398.1; ENST00000650805.1; ENST00000651967.1; ENST00000557417.5; ENST00000651301.1; ENST00000557235.5 | ||
| External Link | RMBase: m6A_site_193496 | ||
| mod ID: M6ASITE013468 | Click to Show/Hide the Full List | ||
| mod site | chr12:56355529-56355530:- | [8] | |
| Sequence | CAGAGCCTCTTTTTTCAGGAACAAGGAGAGCCAGTTCTCGA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000555646.1; ENST00000557417.5; ENST00000650805.1; ENST00000652091.1; ENST00000557235.5; ENST00000651301.1; ENST00000556140.6; ENST00000314128.9; ENST00000651805.1; ENST00000651915.1; ENST00000652741.1; ENST00000651967.1; ENST00000652624.1; ENST00000652398.1; ENST00000651078.1; ENST00000651934.1; ENST00000418572.7 | ||
| External Link | RMBase: m6A_site_193497 | ||
| mod ID: M6ASITE013469 | Click to Show/Hide the Full List | ||
| mod site | chr12:56356138-56356139:- | [8] | |
| Sequence | TTTGCGGAAATTCTGCCGGGACATTCAGGTACTTGGAACGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000418572.7; ENST00000652091.1; ENST00000651967.1; ENST00000557417.5; ENST00000651078.1; ENST00000651805.1; ENST00000652398.1; ENST00000556140.6; ENST00000557235.5; ENST00000651934.1; ENST00000652741.1; ENST00000651915.1; ENST00000652624.1; ENST00000314128.9; ENST00000651301.1; ENST00000650805.1; ENST00000555646.1 | ||
| External Link | RMBase: m6A_site_193498 | ||
| mod ID: M6ASITE013470 | Click to Show/Hide the Full List | ||
| mod site | chr12:56356186-56356187:- | [8] | |
| Sequence | GTGTGGCCGTTGCAGCCAGGACCCAGAGTCCTTGTTGCTGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000651078.1; ENST00000651967.1; ENST00000556140.6; ENST00000314128.9; ENST00000651934.1; ENST00000650805.1; ENST00000652091.1; ENST00000652624.1; ENST00000652398.1; ENST00000651301.1; ENST00000557417.5; ENST00000652741.1; ENST00000418572.7; ENST00000651805.1; ENST00000555646.1; ENST00000651915.1; ENST00000557235.5 | ||
| External Link | RMBase: m6A_site_193499 | ||
| mod ID: M6ASITE013471 | Click to Show/Hide the Full List | ||
| mod site | chr12:56356213-56356214:- | [8] | |
| Sequence | CCACTTCTTGGATCAGCTGAACTATGAGTGTGGCCGTTGCA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000651967.1; ENST00000650805.1; ENST00000418572.7; ENST00000651934.1; ENST00000652091.1; ENST00000651805.1; ENST00000314128.9; ENST00000555646.1; ENST00000651078.1; ENST00000652624.1; ENST00000652398.1; ENST00000557235.5; ENST00000556140.6; ENST00000651301.1; ENST00000652741.1; ENST00000557417.5; ENST00000651915.1 | ||
| External Link | RMBase: m6A_site_193500 | ||
| mod ID: M6ASITE013472 | Click to Show/Hide the Full List | ||
| mod site | chr12:56356443-56356444:- | [8] | |
| Sequence | TGTCTGGATTGAAGACCAGAACTGGTGAGGCCTTCAGGAAG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; A549; CD4T; peripheral-blood; iSLK; endometrial; HEC-1-A; NB4; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000418572.7; ENST00000652398.1; ENST00000650805.1; ENST00000651805.1; ENST00000651078.1; ENST00000652091.1; ENST00000651915.1; ENST00000557235.5; ENST00000652741.1; ENST00000652624.1; ENST00000651301.1; ENST00000556140.6; ENST00000651934.1; ENST00000557417.5; ENST00000555646.1; ENST00000314128.9 | ||
| External Link | RMBase: m6A_site_193501 | ||
| mod ID: M6ASITE013473 | Click to Show/Hide the Full List | ||
| mod site | chr12:56356449-56356450:- | [8] | |
| Sequence | CTTGGCTGTCTGGATTGAAGACCAGAACTGGTGAGGCCTTC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; A549; CD4T; peripheral-blood; iSLK; endometrial; HEC-1-A; NB4; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000652398.1; ENST00000556140.6; ENST00000652741.1; ENST00000651915.1; ENST00000555646.1; ENST00000652624.1; ENST00000557417.5; ENST00000650805.1; ENST00000651078.1; ENST00000652091.1; ENST00000418572.7; ENST00000557235.5; ENST00000651301.1; ENST00000314128.9; ENST00000651805.1; ENST00000651934.1 | ||
| External Link | RMBase: m6A_site_193502 | ||
| mod ID: M6ASITE013474 | Click to Show/Hide the Full List | ||
| mod site | chr12:56356482-56356483:- | [8] | |
| Sequence | GCACAGCCTCCTGCCTGTGGACATTCGACAGTACTTGGCTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; A549; Jurkat; CD4T; peripheral-blood; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000651078.1; ENST00000652091.1; ENST00000314128.9; ENST00000651301.1; ENST00000557417.5; ENST00000557235.5; ENST00000650805.1; ENST00000556140.6; ENST00000652398.1; ENST00000418572.7; ENST00000651915.1; ENST00000651805.1; ENST00000651934.1; ENST00000652624.1; ENST00000555646.1; ENST00000652741.1 | ||
| External Link | RMBase: m6A_site_193503 | ||
| mod ID: M6ASITE013475 | Click to Show/Hide the Full List | ||
| mod site | chr12:56360073-56360074:- | [8] | |
| Sequence | AGCCATTGGAGGGCGCGGGGACTGCAACCCTAATCAGGTAC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; A549; fibroblasts; LCLs; Jurkat; CD4T; GSC-11; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000555646.1; ENST00000418572.7; ENST00000651078.1; ENST00000652741.1; ENST00000651934.1; ENST00000556140.6; ENST00000652398.1; ENST00000651301.1; ENST00000651805.1; ENST00000651915.1; ENST00000557417.5; ENST00000557235.5; ENST00000652624.1; ENST00000314128.9; ENST00000652091.1; ENST00000650805.1 | ||
| External Link | RMBase: m6A_site_193504 | ||
| mod ID: M6ASITE013476 | Click to Show/Hide the Full List | ||
| mod site | chr12:56360098-56360099:- | [15] | |
| Sequence | ACTAGGGACGGGAAGTCGCGACCAGAGCCATTGGAGGGCGC | ||
| Motif Score | 2.844928571 | ||
| Cell/Tissue List | CD8T | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000418572.7; ENST00000557417.5; ENST00000557235.5; ENST00000651078.1; ENST00000651915.1; ENST00000556140.6; ENST00000652624.1; ENST00000650805.1; ENST00000652091.1; ENST00000651301.1; ENST00000651934.1; ENST00000314128.9; ENST00000555646.1; ENST00000651805.1; ENST00000652398.1 | ||
| External Link | RMBase: m6A_site_193505 | ||
References

