m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00796)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
PDCD1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Fat mass and obesity-associated protein (FTO) [ERASER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including Programmed cell death 1 (PD-1) (PDCD1), CXCR4, and SOX10, leading to increased RNA decay through the m6A reader YTHDF2. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Melanoma | ICD-11: 2C30 | ||
| Responsed Drug | PMID31239444-anti-PD1 antibody | Investigative | ||
| Pathway Response | PD-L1 expression and PD-1 checkpoint pathway in cancer | hsa05235 | ||
| Cell Process | mRNA decay | |||
| In-vitro Model | B16-F10 | Mouse melanoma | Mus musculus | CVCL_0159 |
| CHL-1 | Melanoma | Homo sapiens | CVCL_1122 | |
| 624-mel | Melanoma | Homo sapiens | CVCL_8054 | |
| NHEM (Normal Human Epidermal Melanocytes) | ||||
| SK-MEL-30 | Cutaneous melanoma | Homo sapiens | CVCL_0039 | |
| WM115 | Melanoma | Homo sapiens | CVCL_0040 | |
| WM35 | Melanoma | Homo sapiens | CVCL_0580 | |
| WM3670 | Melanoma | Homo sapiens | CVCL_6799 | |
| WM793 | Melanoma | Homo sapiens | CVCL_8787 | |
| In-vivo Model | When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation. | |||
YTH domain-containing family protein 2 (YTHDF2) [READER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including Programmed cell death 1 (PD-1) (PDCD1), CXCR4, and SOX10, leading to increased RNA decay through the m6A reader YTHDF2. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Melanoma | ICD-11: 2C30 | ||
| Responsed Drug | PMID31239444-anti-PD1 antibody | Investigative | ||
| Pathway Response | PD-L1 expression and PD-1 checkpoint pathway in cancer | hsa05235 | ||
| Cell Process | mRNA decay | |||
| In-vitro Model | B16-F10 | Mouse melanoma | Mus musculus | CVCL_0159 |
| CHL-1 | Melanoma | Homo sapiens | CVCL_1122 | |
| 624-mel | Melanoma | Homo sapiens | CVCL_8054 | |
| NHEM (Normal Human Epidermal Melanocytes) | ||||
| SK-MEL-30 | Cutaneous melanoma | Homo sapiens | CVCL_0039 | |
| WM115 | Melanoma | Homo sapiens | CVCL_0040 | |
| WM35 | Melanoma | Homo sapiens | CVCL_0580 | |
| WM3670 | Melanoma | Homo sapiens | CVCL_6799 | |
| WM793 | Melanoma | Homo sapiens | CVCL_8787 | |
| In-vivo Model | When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation. | |||
Melanoma [ICD-11: 2C30]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including Programmed cell death 1 (PD-1) (PDCD1), CXCR4, and SOX10, leading to increased RNA decay through the m6A reader YTHDF2. | |||
| Responsed Disease | Melanoma [ICD-11: 2C30] | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Target Regulation | Up regulation | |||
| Responsed Drug | PMID31239444-anti-PD1 antibody | Investigative | ||
| Pathway Response | PD-L1 expression and PD-1 checkpoint pathway in cancer | hsa05235 | ||
| Cell Process | mRNA decay | |||
| In-vitro Model | B16-F10 | Mouse melanoma | Mus musculus | CVCL_0159 |
| CHL-1 | Melanoma | Homo sapiens | CVCL_1122 | |
| 624-mel | Melanoma | Homo sapiens | CVCL_8054 | |
| NHEM (Normal Human Epidermal Melanocytes) | ||||
| SK-MEL-30 | Cutaneous melanoma | Homo sapiens | CVCL_0039 | |
| WM115 | Melanoma | Homo sapiens | CVCL_0040 | |
| WM35 | Melanoma | Homo sapiens | CVCL_0580 | |
| WM3670 | Melanoma | Homo sapiens | CVCL_6799 | |
| WM793 | Melanoma | Homo sapiens | CVCL_8787 | |
| In-vivo Model | When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation. | |||
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including Programmed cell death 1 (PD-1) (PDCD1), CXCR4, and SOX10, leading to increased RNA decay through the m6A reader YTHDF2. | |||
| Responsed Disease | Melanoma [ICD-11: 2C30] | |||
| Target Regulator | YTH domain-containing family protein 2 (YTHDF2) | READER | ||
| Target Regulation | Down regulation | |||
| Responsed Drug | PMID31239444-anti-PD1 antibody | Investigative | ||
| Pathway Response | PD-L1 expression and PD-1 checkpoint pathway in cancer | hsa05235 | ||
| Cell Process | mRNA decay | |||
| In-vitro Model | B16-F10 | Mouse melanoma | Mus musculus | CVCL_0159 |
| CHL-1 | Melanoma | Homo sapiens | CVCL_1122 | |
| 624-mel | Melanoma | Homo sapiens | CVCL_8054 | |
| NHEM (Normal Human Epidermal Melanocytes) | ||||
| SK-MEL-30 | Cutaneous melanoma | Homo sapiens | CVCL_0039 | |
| WM115 | Melanoma | Homo sapiens | CVCL_0040 | |
| WM35 | Melanoma | Homo sapiens | CVCL_0580 | |
| WM3670 | Melanoma | Homo sapiens | CVCL_6799 | |
| WM793 | Melanoma | Homo sapiens | CVCL_8787 | |
| In-vivo Model | When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation. | |||
PMID31239444-anti-PD1 antibody
[Investigative]
| In total 2 item(s) under this drug | ||||
| Experiment 1 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including Programmed cell death 1 (PD-1) (PDCD1), CXCR4, and SOX10, leading to increased RNA decay through the m6A reader YTHDF2. | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Target Regulation | Up regulation | |||
| Responsed Disease | Melanoma | ICD-11: 2C30 | ||
| Pathway Response | PD-L1 expression and PD-1 checkpoint pathway in cancer | hsa05235 | ||
| Cell Process | mRNA decay | |||
| In-vitro Model | B16-F10 | Mouse melanoma | Mus musculus | CVCL_0159 |
| CHL-1 | Melanoma | Homo sapiens | CVCL_1122 | |
| 624-mel | Melanoma | Homo sapiens | CVCL_8054 | |
| NHEM (Normal Human Epidermal Melanocytes) | ||||
| SK-MEL-30 | Cutaneous melanoma | Homo sapiens | CVCL_0039 | |
| WM115 | Melanoma | Homo sapiens | CVCL_0040 | |
| WM35 | Melanoma | Homo sapiens | CVCL_0580 | |
| WM3670 | Melanoma | Homo sapiens | CVCL_6799 | |
| WM793 | Melanoma | Homo sapiens | CVCL_8787 | |
| In-vivo Model | When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation. | |||
| Experiment 2 Reporting the m6A-centered Drug Response | [1] | |||
| Response Summary | These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including Programmed cell death 1 (PD-1) (PDCD1), CXCR4, and SOX10, leading to increased RNA decay through the m6A reader YTHDF2. | |||
| Target Regulator | YTH domain-containing family protein 2 (YTHDF2) | READER | ||
| Target Regulation | Down regulation | |||
| Responsed Disease | Melanoma | ICD-11: 2C30 | ||
| Pathway Response | PD-L1 expression and PD-1 checkpoint pathway in cancer | hsa05235 | ||
| Cell Process | mRNA decay | |||
| In-vitro Model | B16-F10 | Mouse melanoma | Mus musculus | CVCL_0159 |
| CHL-1 | Melanoma | Homo sapiens | CVCL_1122 | |
| 624-mel | Melanoma | Homo sapiens | CVCL_8054 | |
| NHEM (Normal Human Epidermal Melanocytes) | ||||
| SK-MEL-30 | Cutaneous melanoma | Homo sapiens | CVCL_0039 | |
| WM115 | Melanoma | Homo sapiens | CVCL_0040 | |
| WM35 | Melanoma | Homo sapiens | CVCL_0580 | |
| WM3670 | Melanoma | Homo sapiens | CVCL_6799 | |
| WM793 | Melanoma | Homo sapiens | CVCL_8787 | |
| In-vivo Model | When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation. | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00796)
| In total 3 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE050935 | Click to Show/Hide the Full List | ||
| mod site | chr2:241850662-241850663:- | [2] | |
| Sequence | CCCCGGAGCCTCCTGCCTGAACTTGGGGGCTGGTTGGAGAT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | CD8T | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000334409.10 | ||
| External Link | RMBase: m6A_site_519308 | ||
| mod ID: M6ASITE050936 | Click to Show/Hide the Full List | ||
| mod site | chr2:241850685-241850686:- | [2] | |
| Sequence | AGGCGCCGTGGCCCTGCCTGACGCCCCGGAGCCTCCTGCCT | ||
| Motif Score | 2.833690476 | ||
| Cell/Tissue List | CD8T | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000334409.10 | ||
| External Link | RMBase: m6A_site_519309 | ||
| mod ID: M6ASITE050938 | Click to Show/Hide the Full List | ||
| mod site | chr2:241850881-241850882:- | [2] | |
| Sequence | AGGCACAGCCCCACCACAGGACTCATGTCTCAATGCCCACA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | CD8T | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000418831.1; ENST00000334409.10 | ||
| External Link | RMBase: m6A_site_519310 | ||
References