General Information of the m6A Target Gene (ID: M6ATAR00796)
Target Name Programmed cell death 1 (PD-1)
Synonyms
Programmed cell death protein 1; Protein PD-1; hPD-1; CD279
    Click to Show/Hide
Gene Name PDCD1
Chromosomal Location 2q37.3
Function
Inhibitory receptor on antigen activated T-cells that plays a critical role in induction and maintenance of immune tolerance to self. Delivers inhibitory signals upon binding to ligands CD274/PDCD1L1 and CD273/PDCD1LG2. Following T-cell receptor (TCR) engagement, PDCD1 associates with CD3-TCR in the immunological synapse and directly inhibits T-cell activation (By similarity). Suppresses T-cell activation through the recruitment of PTPN11/SHP-2: following ligand-binding, PDCD1 is phosphorylated within the ITSM motif, leading to the recruitment of the protein tyrosine phosphatase PTPN11/SHP-2 that mediates dephosphorylation of key TCR proximal signaling molecules, such as ZAP70, PRKCQ/PKCtheta and CD247/CD3zeta (By similarity). The PDCD1-mediated inhibitory pathway is exploited by tumors to attenuate anti-tumor immunity and escape destruction by the immune system, thereby facilitating tumor survival. The interaction with CD274/PDCD1L1 inhibits cytotoxic T lymphocytes (CTLs) effector function. The blockage of the PDCD1-mediated pathway results in the reversal of the exhausted T-cell phenotype and the normalization of the anti-tumor response, providing a rationale for cancer immunotherapy.
    Click to Show/Hide
Gene ID 5133
Uniprot ID
PDCD1_HUMAN
HGNC ID
HGNC:8760
KEGG ID
hsa:5133
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
PDCD1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Fat mass and obesity-associated protein (FTO) [ERASER]
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including Programmed cell death 1 (PD-1) (PDCD1), CXCR4, and SOX10, leading to increased RNA decay through the m6A reader YTHDF2.
Target Regulation Up regulation
Responsed Disease Melanoma ICD-11: 2C30
Responsed Drug PMID31239444-anti-PD1 antibody Investigative
Pathway Response PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Cell Process mRNA decay
In-vitro Model B16-F10 Mouse melanoma Mus musculus CVCL_0159
CHL-1 Melanoma Homo sapiens CVCL_1122
624-mel Melanoma Homo sapiens CVCL_8054
NHEM (Normal Human Epidermal Melanocytes)
SK-MEL-30 Cutaneous melanoma Homo sapiens CVCL_0039
WM115 Melanoma Homo sapiens CVCL_0040
WM35 Melanoma Homo sapiens CVCL_0580
WM3670 Melanoma Homo sapiens CVCL_6799
WM793 Melanoma Homo sapiens CVCL_8787
In-vivo Model When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.
YTH domain-containing family protein 2 (YTHDF2) [READER]
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including Programmed cell death 1 (PD-1) (PDCD1), CXCR4, and SOX10, leading to increased RNA decay through the m6A reader YTHDF2.
Target Regulation Down regulation
Responsed Disease Melanoma ICD-11: 2C30
Responsed Drug PMID31239444-anti-PD1 antibody Investigative
Pathway Response PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Cell Process mRNA decay
In-vitro Model B16-F10 Mouse melanoma Mus musculus CVCL_0159
CHL-1 Melanoma Homo sapiens CVCL_1122
624-mel Melanoma Homo sapiens CVCL_8054
NHEM (Normal Human Epidermal Melanocytes)
SK-MEL-30 Cutaneous melanoma Homo sapiens CVCL_0039
WM115 Melanoma Homo sapiens CVCL_0040
WM35 Melanoma Homo sapiens CVCL_0580
WM3670 Melanoma Homo sapiens CVCL_6799
WM793 Melanoma Homo sapiens CVCL_8787
In-vivo Model When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.
Melanoma [ICD-11: 2C30]
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including Programmed cell death 1 (PD-1) (PDCD1), CXCR4, and SOX10, leading to increased RNA decay through the m6A reader YTHDF2.
Responsed Disease Melanoma [ICD-11: 2C30]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
Target Regulation Up regulation
Responsed Drug PMID31239444-anti-PD1 antibody Investigative
Pathway Response PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Cell Process mRNA decay
In-vitro Model B16-F10 Mouse melanoma Mus musculus CVCL_0159
CHL-1 Melanoma Homo sapiens CVCL_1122
624-mel Melanoma Homo sapiens CVCL_8054
NHEM (Normal Human Epidermal Melanocytes)
SK-MEL-30 Cutaneous melanoma Homo sapiens CVCL_0039
WM115 Melanoma Homo sapiens CVCL_0040
WM35 Melanoma Homo sapiens CVCL_0580
WM3670 Melanoma Homo sapiens CVCL_6799
WM793 Melanoma Homo sapiens CVCL_8787
In-vivo Model When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including Programmed cell death 1 (PD-1) (PDCD1), CXCR4, and SOX10, leading to increased RNA decay through the m6A reader YTHDF2.
Responsed Disease Melanoma [ICD-11: 2C30]
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
Target Regulation Down regulation
Responsed Drug PMID31239444-anti-PD1 antibody Investigative
Pathway Response PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Cell Process mRNA decay
In-vitro Model B16-F10 Mouse melanoma Mus musculus CVCL_0159
CHL-1 Melanoma Homo sapiens CVCL_1122
624-mel Melanoma Homo sapiens CVCL_8054
NHEM (Normal Human Epidermal Melanocytes)
SK-MEL-30 Cutaneous melanoma Homo sapiens CVCL_0039
WM115 Melanoma Homo sapiens CVCL_0040
WM35 Melanoma Homo sapiens CVCL_0580
WM3670 Melanoma Homo sapiens CVCL_6799
WM793 Melanoma Homo sapiens CVCL_8787
In-vivo Model When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.
PMID31239444-anti-PD1 antibody [Investigative]
In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including Programmed cell death 1 (PD-1) (PDCD1), CXCR4, and SOX10, leading to increased RNA decay through the m6A reader YTHDF2.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
Target Regulation Up regulation
Responsed Disease Melanoma ICD-11: 2C30
Pathway Response PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Cell Process mRNA decay
In-vitro Model B16-F10 Mouse melanoma Mus musculus CVCL_0159
CHL-1 Melanoma Homo sapiens CVCL_1122
624-mel Melanoma Homo sapiens CVCL_8054
NHEM (Normal Human Epidermal Melanocytes)
SK-MEL-30 Cutaneous melanoma Homo sapiens CVCL_0039
WM115 Melanoma Homo sapiens CVCL_0040
WM35 Melanoma Homo sapiens CVCL_0580
WM3670 Melanoma Homo sapiens CVCL_6799
WM793 Melanoma Homo sapiens CVCL_8787
In-vivo Model When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.
Experiment 2 Reporting the m6A-centered Drug Response [1]
Response Summary These findings demonstrate a crucial role of FTO as an m6A demethylase in promoting melanoma tumorigenesis and anti-PD-1 resistance, and suggest that the combination of FTO inhibition with anti-PD-1 blockade reduces the resistance to immunotherapy in melanoma. Knockdown of FTO increases m6A methylation in the critical protumorigenic melanoma cell-intrinsic genes including Programmed cell death 1 (PD-1) (PDCD1), CXCR4, and SOX10, leading to increased RNA decay through the m6A reader YTHDF2.
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
Target Regulation Down regulation
Responsed Disease Melanoma ICD-11: 2C30
Pathway Response PD-L1 expression and PD-1 checkpoint pathway in cancer hsa05235
Cell Process mRNA decay
In-vitro Model B16-F10 Mouse melanoma Mus musculus CVCL_0159
CHL-1 Melanoma Homo sapiens CVCL_1122
624-mel Melanoma Homo sapiens CVCL_8054
NHEM (Normal Human Epidermal Melanocytes)
SK-MEL-30 Cutaneous melanoma Homo sapiens CVCL_0039
WM115 Melanoma Homo sapiens CVCL_0040
WM35 Melanoma Homo sapiens CVCL_0580
WM3670 Melanoma Homo sapiens CVCL_6799
WM793 Melanoma Homo sapiens CVCL_8787
In-vivo Model When the tumors reached a volume of 80-100 mm3, mice were treated with anti-PD-1 or isotype control antibody (200 ug/mouse) by i.p. injection, every other day for three times. For IFNγ blockade treatment, C57BL/6 mice were treated with anti-IFNγ antibody or isotype control IgG (250 ug/mouse) every other day after tumor cell inoculation.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00796)
Programmed cell death 1 (PD-1)
N6-methyladenosine (m6A)
In total 3 m6A sequence/site(s) in this target gene
mod ID: M6ASITE050935 Click to Show/Hide the Full List
mod site chr2:241850662-241850663:- [2]
Sequence CCCCGGAGCCTCCTGCCTGAACTTGGGGGCTGGTTGGAGAT
Motif Score 3.373380952
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000334409.10
External Link RMBase: m6A_site_519308
mod ID: M6ASITE050936 Click to Show/Hide the Full List
mod site chr2:241850685-241850686:- [2]
Sequence AGGCGCCGTGGCCCTGCCTGACGCCCCGGAGCCTCCTGCCT
Motif Score 2.833690476
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000334409.10
External Link RMBase: m6A_site_519309
mod ID: M6ASITE050938 Click to Show/Hide the Full List
mod site chr2:241850881-241850882:- [2]
Sequence AGGCACAGCCCCACCACAGGACTCATGTCTCAATGCCCACA
Motif Score 4.065041667
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000418831.1; ENST00000334409.10
External Link RMBase: m6A_site_519310