m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00792)

Target Name	KRT7-AS
Gene Name	KRT7-AS
Chromosomal Location	12q13.13
Gene ID	109729127
HGNC ID	HGNC:52643

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

KRT7-AS can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	HUVEC cell line	Homo sapiens
Treatment: shMETTL3 HUVEC cells Control: shScramble HUVEC cells		GSE157544
Regulation		logFC: -5.89E-01 p-value: 3.54E-03
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between KRT7-AS and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 8.95E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Specifically, increased METTL3 methylated KRT7-AS at A877 to increase the stability of a KRT7-AS/KRT7 mRNA duplex via IGF2BP1/HuR complexes. m6A promotes breast cancer lung metastasis by increasing the stability of a KRT7-AS/KRT7 mRNA duplex and translation of KRT7.
Target Regulation	Up regulation
Responsed Disease	Breast cancer		ICD-11: 2C60	Disease Info
Cell Process	Lung Metastasis
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
In-vitro Model	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
In-vivo Model	First, subcutaneous transplanted model was used to evaluate the growth of BT-549LMF3 and BT-549 cells. Cells (5 × 10⁶ per mouse, n = 5 for each group) were diluted in 200 ul PBS + 200 ul Matrigel (BD Biosciences) and subcutaneously injected into immunodeficient female mice. Second, subcutaneous transplanted model was used to evaluate the metastasis potential of BT-549LMF3 and BT-549 cells. Cells (5 × 10⁶ per mouse, n = 5 for each group) were diluted in 200 ul PBS + 200 ul Matrigel (BD Biosciences) and subcutaneously injected into immunodeficient female mice. Third, the in vivo lung metastasis model was established by injecting with BT-549, BT-549LMF3, FTO stable BT-549LMF3, sh-METTL3 BT-549LMF3, and sh-KRT7 BT-549LMF3 stable cells (1 × 10⁶ per mouse, n = 5 for each group).

Breast cancer [ICD-11: 2C60]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Specifically, increased METTL3 methylated KRT7-AS at A877 to increase the stability of a KRT7-AS/KRT7 mRNA duplex via IGF2BP1/HuR complexes. m6A promotes breast cancer lung metastasis by increasing the stability of a KRT7-AS/KRT7 mRNA duplex and translation of KRT7.
Responsed Disease	Breast cancer [ICD-11: 2C60]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Lung Metastasis
In-vitro Model	MDA-MB-231	Breast adenocarcinoma	Homo sapiens	CVCL_0062
In-vitro Model	BT-549	Invasive breast carcinoma	Homo sapiens	CVCL_1092
In-vivo Model	First, subcutaneous transplanted model was used to evaluate the growth of BT-549LMF3 and BT-549 cells. Cells (5 × 10⁶ per mouse, n = 5 for each group) were diluted in 200 ul PBS + 200 ul Matrigel (BD Biosciences) and subcutaneously injected into immunodeficient female mice. Second, subcutaneous transplanted model was used to evaluate the metastasis potential of BT-549LMF3 and BT-549 cells. Cells (5 × 10⁶ per mouse, n = 5 for each group) were diluted in 200 ul PBS + 200 ul Matrigel (BD Biosciences) and subcutaneously injected into immunodeficient female mice. Third, the in vivo lung metastasis model was established by injecting with BT-549, BT-549LMF3, FTO stable BT-549LMF3, sh-METTL3 BT-549LMF3, and sh-KRT7 BT-549LMF3 stable cells (1 × 10⁶ per mouse, n = 5 for each group).

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05565		Crosstalk Info
Epigenetic Regulator	KRT7-AS
Regulated Target	Keratin, type II cytoskeletal 7 (KRT7)
Crosstalk relationship	m6A → ncRNA
Disease	Breast cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00792)

KRT7-AS

N6-methyladenosine (m6A)

In total 6 m6A sequence/site(s) in this target gene
mod ID: M6ASITE012509		Click to Show/Hide the Full List
mod site	chr12:52245263-52245264:-		[2]
Sequence	CAGAGAATCCTAAGGGTTAAACACATAGGTTTGGATATCCA
Motif Score	2.20572619
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	rmsk_3791110; ENST00000546686.1
External Link	RMBase: m6A_site_189110
mod ID: M6ASITE012513		Click to Show/Hide the Full List
mod site	chr12:52245680-52245681:-		[3]
Sequence	GGATGAATGTCAAGCCCCAAACCCCACGGAGCCCTAGAAGC
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; GSC-11; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000546686.1
External Link	RMBase: m6A_site_189114
mod ID: M6ASITE012514		Click to Show/Hide the Full List
mod site	chr12:52245863-52245864:-		[2]
Sequence	GAAGCCGCACACACAAAGGGACTGTTATCATTTCAACCTGC
Motif Score	4.065041667
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000546686.1
External Link	RMBase: m6A_site_189115
mod ID: M6ASITE012515		Click to Show/Hide the Full List
mod site	chr12:52246192-52246193:-		[2]
Sequence	CATGAAGAATGTGCTATCAGACTCCCCCATTCCAGCCTCCT
Motif Score	3.319380952
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000546686.1
External Link	RMBase: m6A_site_189116
mod ID: M6ASITE012516		Click to Show/Hide the Full List
mod site	chr12:52246231-52246232:-		[2]
Sequence	ATGAAGGCCCAGCTGCATAGACAGAGGTGGCATGCGGTTCA
Motif Score	2.897386905
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000546686.1
External Link	RMBase: m6A_site_189117
mod ID: M6ASITE012517		Click to Show/Hide the Full List
mod site	chr12:52247239-52247240:-		[4]
Sequence	TCTGGTACGATGCCTAAGGAACTCAGACGGAAGAGGCCTGA
Motif Score	3.373380952
Cell/Tissue List	MT4; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000546686.1; rmsk_3791116
External Link	RMBase: m6A_site_189118

Ref 1	N(6) -Methyladenosine Regulates mRNA Stability and Translation Efficiency of KRT7 to Promote Breast Cancer Lung Metastasis. Cancer Res. 2021 Jun 1;81(11):2847-2860. doi: 10.1158/0008-5472.CAN-20-3779. Epub 2021 Apr 1.
Ref 2	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 3	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 4	Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat Microbiol. 2016 Feb 22;1:16011. doi: 10.1038/nmicrobiol.2016.11.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map