m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00773)
Target Name RAD51-associated protein 1 (RAD51AP1)
Synonyms
PIR51; RAD51-associated protein 1; HsRAD51AP1 ; RAD51-interacting protein
    Click to Show/Hide
Gene Name RAD51AP1
Chromosomal Location 12p13.32
Function
Structure-specific DNA-binding protein involved in DNA repair by promoting RAD51-mediated homologous recombination. Acts by stimulating D-Loop formation by RAD51: specifically enhances joint molecule formation through its structure-specific DNA interaction and its interaction with RAD51. Binds single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) and secondary DNA structures, such as D-loop structures: has a strong preference for branched-DNA structures that are obligatory intermediates during joint molecule formation. Cooperates with WDR48/UAF1 to stimulate RAD51-mediated homologous recombination: both WDR48/UAF1 and RAD51AP1 have coordinated role in DNA-binding during homologous recombination and DNA repair. WDR48/UAF1 and RAD51AP1 also have a coordinated role in DNA-binding to promote USP1-mediated deubiquitination of FANCD2 . Also involved in meiosis by promoting DMC1-mediated homologous meiotic recombination. Key mediator of alternative lengthening of telomeres (ALT) pathway, a homology-directed repair mechanism of telomere elongation that controls proliferation in aggressive cancers, by stimulating homologous recombination. May also bind RNA; additional evidences are however required to confirm RNA-binding in vivo.
    Click to Show/Hide
Gene ID 10635
Uniprot ID
R51A1_HUMAN
HGNC ID
HGNC:16956
KEGG ID
hsa:10635
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
RAD51AP1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3 augmented 5 FU induced DNA damage and overcame 5 FU resistance in HCT 8R cells, which could be mimicked by inhibition of RAD51-associated protein 1 (RAD51AP1). The present study revealed that the METTL3/RAD51AP1 axis plays an important role in the acquisition of 5 FU resistance in CRC.
Target Regulation Up regulation
Responsed Disease Colorectal cancer ICD-11: 2B91
 Disease Info 
Responsed Drug Fluorouracil Approved
 Drug Info 
In-vitro Model HCT 8 Colon adenocarcinoma Homo sapiens CVCL_2478
Colorectal cancer [ICD-11: 2B91]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3 augmented 5 FU induced DNA damage and overcame 5 FU resistance in HCT 8R cells, which could be mimicked by inhibition of RAD51-associated protein 1 (RAD51AP1). The present study revealed that the METTL3/RAD51AP1 axis plays an important role in the acquisition of 5 FU resistance in CRC.
Responsed Disease Colorectal cancer [ICD-11: 2B91]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Fluorouracil Approved
 Drug Info 
In-vitro Model HCT 8 Colon adenocarcinoma Homo sapiens CVCL_2478
Fluorouracil [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary METTL3 augmented 5 FU induced DNA damage and overcame 5 FU resistance in HCT 8R cells, which could be mimicked by inhibition of RAD51-associated protein 1 (RAD51AP1). The present study revealed that the METTL3/RAD51AP1 axis plays an important role in the acquisition of 5 FU resistance in CRC.
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Colorectal cancer ICD-11: 2B91
 Disease Info 
In-vitro Model HCT 8 Colon adenocarcinoma Homo sapiens CVCL_2478
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03564
 Crosstalk Info 
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
 Disease Info 
Drug Fluorouracil
 Drug Info 
Crosstalk ID: M6ACROT03609
 Crosstalk Info 
Epigenetic Regulator N-lysine methyltransferase SMYD2 (SMYD2)
Regulated Target Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
 Disease Info 
Drug Fluorouracil
 Drug Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00773)
RAD51-associated protein 1 (RAD51AP1)
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE005344 Click to Show/Hide the Full List
mod site chr12:4551374-4551375:+ [2]
Sequence CGTGGTGTTGTGTGCCTGTAATCCCAGCTACTTGGGAGGCT
Transcript ID List ENST00000535558.5; ENST00000398012.7; ENST00000442992.6; ENST00000544029.1; ENST00000544931.1; ENST00000536117.5; ENST00000352618.8; ENST00000544927.5; ENST00000536886.5; ENST00000228843.13; rmsk_3710463; ENST00000544110.5
External Link RMBase: RNA-editing_site_26494
N6-methyladenosine (m6A)
In total 45 m6A sequence/site(s) in this target gene
mod ID: M6ASITE010186 Click to Show/Hide the Full List
mod site chr12:4538896-4538897:+ [3]
Sequence TGAAACCGCCGCTGAAGCCAACAAGAATTTGAGAACTGTAA
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000536886.5; ENST00000228843.13; ENST00000536346.5; ENST00000442992.6; ENST00000398012.7; ENST00000544110.5; ENST00000352618.8; ENST00000535558.5
External Link RMBase: m6A_site_173466
mod ID: M6ASITE010187 Click to Show/Hide the Full List
mod site chr12:4541883-4541884:+ [3]
Sequence AAATTCTGTTTTGGTCATAGACATAAGAAACCAGTCAATTA
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000352618.8; ENST00000535558.5; ENST00000544110.5; ENST00000544927.5; ENST00000536346.5; ENST00000538817.5; ENST00000442992.6; ENST00000398012.7; ENST00000536886.5; ENST00000228843.13; ENST00000536117.5
External Link RMBase: m6A_site_173467
mod ID: M6ASITE010188 Click to Show/Hide the Full List
mod site chr12:4541924-4541925:+ [4]
Sequence CTCACAGTTTGACCACTCTGACAGTGATGGTAAGTAAAGCT
Motif Score 2.859755952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000442992.6; ENST00000352618.8; ENST00000228843.13; ENST00000535558.5; ENST00000536886.5; ENST00000536346.5; ENST00000544110.5; ENST00000398012.7; ENST00000544173.5; ENST00000538817.5; ENST00000544927.5; ENST00000536117.5
External Link RMBase: m6A_site_173468
mod ID: M6ASITE010189 Click to Show/Hide the Full List
mod site chr12:4543806-4543807:+ [5]
Sequence CTTTAAACAAGAAATCCAGAACAGCACCAAAGGAGTTAAAA
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000442992.6; ENST00000536886.5; ENST00000538817.5; ENST00000544110.5; ENST00000536346.5; ENST00000398012.7; ENST00000544927.5; ENST00000535558.5; ENST00000544029.1; ENST00000536117.5; ENST00000544173.5; ENST00000352618.8; ENST00000228843.13
External Link RMBase: m6A_site_173469
mod ID: M6ASITE010190 Click to Show/Hide the Full List
mod site chr12:4543826-4543827:+ [5]
Sequence ACAGCACCAAAGGAGTTAAAACAAGATAAACCAAAACCTAA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000398012.7; ENST00000352618.8; ENST00000228843.13; ENST00000544173.5; ENST00000544110.5; ENST00000538817.5; ENST00000544029.1; ENST00000544927.5; ENST00000442992.6; ENST00000536886.5; ENST00000535558.5; ENST00000536117.5; ENST00000536346.5
External Link RMBase: m6A_site_173470
mod ID: M6ASITE010191 Click to Show/Hide the Full List
mod site chr12:4543835-4543836:+ [5]
Sequence AAGGAGTTAAAACAAGATAAACCAAAACCTAACTTGAACAA
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000442992.6; ENST00000544029.1; ENST00000536117.5; ENST00000544173.5; ENST00000536886.5; ENST00000544110.5; ENST00000352618.8; ENST00000536346.5; ENST00000228843.13; ENST00000535558.5; ENST00000544927.5; ENST00000398012.7; ENST00000538817.5
External Link RMBase: m6A_site_173471
mod ID: M6ASITE010192 Click to Show/Hide the Full List
mod site chr12:4543841-4543842:+ [5]
Sequence TTAAAACAAGATAAACCAAAACCTAACTTGAACAATCTCCG
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000352618.8; ENST00000544110.5; ENST00000398012.7; ENST00000544173.5; ENST00000544927.5; ENST00000538817.5; ENST00000442992.6; ENST00000536346.5; ENST00000228843.13; ENST00000535558.5; ENST00000536886.5; ENST00000536117.5; ENST00000544029.1
External Link RMBase: m6A_site_173472
mod ID: M6ASITE010193 Click to Show/Hide the Full List
mod site chr12:4543852-4543853:+ [5]
Sequence TAAACCAAAACCTAACTTGAACAATCTCCGGAAAGAAGAAA
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000538817.5; ENST00000544029.1; ENST00000544173.5; ENST00000544110.5; ENST00000352618.8; ENST00000536886.5; ENST00000535558.5; ENST00000398012.7; ENST00000442992.6; ENST00000536117.5; ENST00000228843.13; ENST00000536346.5; ENST00000544927.5
External Link RMBase: m6A_site_173473
mod ID: M6ASITE010194 Click to Show/Hide the Full List
mod site chr12:4543890-4543891:+ [5]
Sequence AAATCCCAGTACAAGAGAAAACCCCTAAAAAAAGGTGAGAG
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000544029.1; ENST00000544110.5; ENST00000398012.7; ENST00000352618.8; ENST00000538817.5; ENST00000536117.5; ENST00000544927.5; ENST00000535558.5; ENST00000442992.6; ENST00000536346.5; ENST00000536886.5; ENST00000544173.5; ENST00000228843.13
External Link RMBase: m6A_site_173474
mod ID: M6ASITE010195 Click to Show/Hide the Full List
mod site chr12:4545269-4545270:+ [5]
Sequence ATATACTGCAATATGGATGAACCTTGGAAACATCATTCTGA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000228843.13; rmsk_3710451; ENST00000536117.5; ENST00000398012.7; ENST00000536886.5; ENST00000442992.6; ENST00000536346.5; ENST00000544029.1; ENST00000544173.5; ENST00000544110.5; ENST00000538817.5; ENST00000544927.5; ENST00000535558.5; ENST00000352618.8
External Link RMBase: m6A_site_173475
mod ID: M6ASITE010196 Click to Show/Hide the Full List
mod site chr12:4546322-4546323:+ [3]
Sequence TTTTAGGATGGCTTTAGATGACAAGCTCTACCAGAGAGACT
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000538817.5; ENST00000544173.5; ENST00000536346.5; ENST00000442992.6; ENST00000398012.7; ENST00000536117.5; ENST00000352618.8; ENST00000228843.13; ENST00000544110.5; ENST00000544029.1; ENST00000535558.5; ENST00000544927.5; ENST00000536886.5
External Link RMBase: m6A_site_173476
mod ID: M6ASITE010197 Click to Show/Hide the Full List
mod site chr12:4546374-4546375:+ [5]
Sequence CTAGCTTTATCAGTGAAGGAACTTCCAACAGTCACCACTAA
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000536117.5; ENST00000442992.6; ENST00000544029.1; ENST00000536346.5; ENST00000538817.5; ENST00000544927.5; ENST00000536886.5; ENST00000544173.5; ENST00000544110.5; ENST00000352618.8; ENST00000535558.5; ENST00000228843.13; ENST00000398012.7
External Link RMBase: m6A_site_173477
mod ID: M6ASITE010198 Click to Show/Hide the Full List
mod site chr12:4546403-4546404:+ [5]
Sequence AGTCACCACTAATGTGCAGAACTCTCAAGATAAAAGTAACT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000442992.6; ENST00000538817.5; ENST00000352618.8; ENST00000536117.5; ENST00000544110.5; ENST00000536886.5; ENST00000398012.7; ENST00000544029.1; ENST00000228843.13; ENST00000544173.5; ENST00000535558.5; ENST00000536346.5; ENST00000544927.5
External Link RMBase: m6A_site_173478
mod ID: M6ASITE010199 Click to Show/Hide the Full List
mod site chr12:4548101-4548102:+ [5]
Sequence TTATATTTAGGCATTGAAAAACATGGCAGTAGTAAAATAGA
Motif Score 2.20572619
Cell/Tissue List HeLa; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000536346.5; ENST00000352618.8; ENST00000536886.5; ENST00000535558.5; ENST00000228843.13; ENST00000544927.5; ENST00000538817.5; ENST00000398012.7; ENST00000544029.1; ENST00000544173.5; ENST00000544110.5; ENST00000536117.5; ENST00000442992.6
External Link RMBase: m6A_site_173479
mod ID: M6ASITE010200 Click to Show/Hide the Full List
mod site chr12:4548123-4548124:+ [5]
Sequence ATGGCAGTAGTAAAATAGAAACAATGAATAAGTCTCCTCAT
Motif Score 2.20572619
Cell/Tissue List HeLa; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000536346.5; ENST00000228843.13; ENST00000538817.5; ENST00000536886.5; ENST00000442992.6; ENST00000544927.5; ENST00000536117.5; ENST00000544029.1; ENST00000398012.7; ENST00000352618.8; ENST00000544110.5; ENST00000544173.5; ENST00000535558.5
External Link RMBase: m6A_site_173480
mod ID: M6ASITE010201 Click to Show/Hide the Full List
mod site chr12:4548812-4548813:+ [3]
Sequence TGATGGTGATAGTGCTAATGACACTGAACCAGACTTTGCAC
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000535558.5; ENST00000544110.5; ENST00000228843.13; ENST00000442992.6; ENST00000536346.5; ENST00000544029.1; ENST00000398012.7; ENST00000536886.5; ENST00000352618.8; ENST00000544927.5; ENST00000536117.5
External Link RMBase: m6A_site_173481
mod ID: M6ASITE010202 Click to Show/Hide the Full List
mod site chr12:4553030-4553031:+ [4]
Sequence TTGTGAGAGTGAGGATAATGACGAAGACTTCTCTATGAGAA
Motif Score 2.833690476
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000544029.1; ENST00000544110.5; ENST00000535558.5; ENST00000228843.13; ENST00000536886.5; ENST00000536117.5; ENST00000352618.8; ENST00000442992.6; ENST00000398012.7; ENST00000544931.1; ENST00000544927.5
External Link RMBase: m6A_site_173482
mod ID: M6ASITE010203 Click to Show/Hide the Full List
mod site chr12:4553036-4553037:+ [6]
Sequence GAGTGAGGATAATGACGAAGACTTCTCTATGAGAAAAAGTA
Motif Score 3.319380952
Cell/Tissue List hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000398012.7; ENST00000544927.5; ENST00000535558.5; ENST00000228843.13; ENST00000352618.8; ENST00000544110.5; ENST00000442992.6; ENST00000536886.5; ENST00000536117.5; ENST00000544029.1; ENST00000544931.1
External Link RMBase: m6A_site_173483
mod ID: M6ASITE010204 Click to Show/Hide the Full List
mod site chr12:4556443-4556444:+ [5]
Sequence TCTTCAGATACCACTAGGAAACCATTAGAAATACGCAGTCC
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000536117.5; ENST00000544927.5; ENST00000535558.5; ENST00000352618.8; ENST00000398012.7; ENST00000228843.13; ENST00000544931.1; ENST00000442992.6; ENST00000536886.5
External Link RMBase: m6A_site_173484
mod ID: M6ASITE010205 Click to Show/Hide the Full List
mod site chr12:4556482-4556483:+ [5]
Sequence CCTTCAGCTGAAAGCAAGAAACCTAAATGGGTCCCACCAGG
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000544931.1; ENST00000536886.5; ENST00000536117.5; ENST00000535558.5; ENST00000228843.13; ENST00000352618.8; ENST00000442992.6; ENST00000544927.5; ENST00000398012.7
External Link RMBase: m6A_site_173485
mod ID: M6ASITE010206 Click to Show/Hide the Full List
mod site chr12:4559000-4559001:+ [7]
Sequence CACTAGCACCTGAGTGTGGTACAGGAGGAATGTTTGGTTGG
Motif Score 2.856142857
Cell/Tissue List HEK293
Seq Type List m6A-REF-seq
Transcript ID List ENST00000442992.6; ENST00000535558.5; ENST00000352618.8; ENST00000398012.7; ENST00000228843.13; ENST00000544931.1
External Link RMBase: m6A_site_173486
mod ID: M6ASITE010207 Click to Show/Hide the Full List
mod site chr12:4559028-4559029:+ [4]
Sequence AATGTTTGGTTGGGAGAATCACAGCTTTACAAGGGTGTTTA
Motif Score 2.047297619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000544931.1; ENST00000352618.8; ENST00000535558.5; ENST00000228843.13; ENST00000442992.6
External Link RMBase: m6A_site_173487
mod ID: M6ASITE010208 Click to Show/Hide the Full List
mod site chr12:4559036-4559037:+ [4]
Sequence GTTGGGAGAATCACAGCTTTACAAGGGTGTTTATATTTGAT
Motif Score 2.07285119
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000442992.6; ENST00000228843.13; ENST00000544931.1; ENST00000535558.5; ENST00000352618.8
External Link RMBase: m6A_site_173488
mod ID: M6ASITE010209 Click to Show/Hide the Full List
mod site chr12:4559155-4559156:+ [4]
Sequence ATGATTATGTTCTCTGTAAAACTCTTCAAGACTTCAATGAG
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000544931.1; ENST00000442992.6; ENST00000352618.8; ENST00000535558.5; ENST00000228843.13
External Link RMBase: m6A_site_173489
mod ID: M6ASITE010210 Click to Show/Hide the Full List
mod site chr12:4559165-4559166:+ [5]
Sequence TCTCTGTAAAACTCTTCAAGACTTCAATGAGAAGTTTGTTT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000228843.13; ENST00000352618.8; ENST00000442992.6; ENST00000535558.5; ENST00000544931.1
External Link RMBase: m6A_site_173490
mod ID: M6ASITE010211 Click to Show/Hide the Full List
mod site chr12:4559248-4559249:+ [4]
Sequence TCTGTTTTTCTATCAGTTCGACATGAAGTCCACATCACATG
Motif Score 2.865571429
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000544931.1; ENST00000442992.6; ENST00000228843.13; ENST00000352618.8; ENST00000535558.5
External Link RMBase: m6A_site_173491
mod ID: M6ASITE010212 Click to Show/Hide the Full List
mod site chr12:4559264-4559265:+ [4]
Sequence TTCGACATGAAGTCCACATCACATGCTGTTCTTTTCTAGTT
Motif Score 2.047297619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000228843.13; ENST00000442992.6; ENST00000352618.8; ENST00000535558.5; ENST00000544931.1
External Link RMBase: m6A_site_173492
mod ID: M6ASITE010213 Click to Show/Hide the Full List
mod site chr12:4559285-4559286:+ [3]
Sequence CATGCTGTTCTTTTCTAGTTACATGATGTGCCTTTCTAGCT
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000544931.1; ENST00000228843.13; ENST00000535558.5; ENST00000352618.8; ENST00000442992.6
External Link RMBase: m6A_site_173493
mod ID: M6ASITE010214 Click to Show/Hide the Full List
mod site chr12:4559328-4559329:+ [4]
Sequence GTCTAGTTTATAGCACCTTAACTTTAACTGTTCAGTTTTAT
Motif Score 2.590089286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000442992.6; ENST00000228843.13; ENST00000544931.1; ENST00000535558.5; ENST00000352618.8
External Link RMBase: m6A_site_173494
mod ID: M6ASITE010215 Click to Show/Hide the Full List
mod site chr12:4559334-4559335:+ [4]
Sequence TTTATAGCACCTTAACTTTAACTGTTCAGTTTTATCTGGCA
Motif Score 2.590089286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000544931.1; ENST00000228843.13; ENST00000442992.6; ENST00000352618.8
External Link RMBase: m6A_site_173495
mod ID: M6ASITE010216 Click to Show/Hide the Full List
mod site chr12:4559362-4559363:+ [3]
Sequence GTTTTATCTGGCAGAGGAAAACATTCTTATTTCTTTCAGAA
Motif Score 2.20572619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000442992.6; ENST00000352618.8; ENST00000228843.13; ENST00000544931.1
External Link RMBase: m6A_site_173496
mod ID: M6ASITE010217 Click to Show/Hide the Full List
mod site chr12:4559384-4559385:+ [7]
Sequence ATTCTTATTTCTTTCAGAAGACATTTCTGAAATCTTATAAG
Motif Score 2.897386905
Cell/Tissue List HEK293; HEK293T; hESC-HEK293T
Seq Type List m6A-REF-seq; DART-seq; MAZTER-seq
Transcript ID List ENST00000442992.6; ENST00000544931.1; ENST00000352618.8; ENST00000228843.13
External Link RMBase: m6A_site_173497
mod ID: M6ASITE010218 Click to Show/Hide the Full List
mod site chr12:4559407-4559408:+ [4]
Sequence TTTCTGAAATCTTATAAGCTACTTAAGCTACGTTGTCAGTT
Motif Score 2.500660714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000228843.13; ENST00000544931.1; ENST00000352618.8; ENST00000442992.6
External Link RMBase: m6A_site_173498
mod ID: M6ASITE010219 Click to Show/Hide the Full List
mod site chr12:4559472-4559473:+ [4]
Sequence TAGCCAAATCTTTTTATAGTACAAACTTAGAATTATTTTAC
Motif Score 2.856142857
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000228843.13; ENST00000442992.6; ENST00000544931.1; ENST00000352618.8
External Link RMBase: m6A_site_173499
mod ID: M6ASITE010220 Click to Show/Hide the Full List
mod site chr12:4559476-4559477:+ [4]
Sequence CAAATCTTTTTATAGTACAAACTTAGAATTATTTTACACAC
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000352618.8; ENST00000228843.13; ENST00000442992.6; ENST00000544931.1
External Link RMBase: m6A_site_173500
mod ID: M6ASITE010221 Click to Show/Hide the Full List
mod site chr12:4559491-4559492:+ [4]
Sequence TACAAACTTAGAATTATTTTACACACTAAAATGGTTGCAGT
Motif Score 2.07285119
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000544931.1; ENST00000352618.8; ENST00000228843.13; ENST00000442992.6
External Link RMBase: m6A_site_173501
mod ID: M6ASITE010222 Click to Show/Hide the Full List
mod site chr12:4559493-4559494:+ [4]
Sequence CAAACTTAGAATTATTTTACACACTAAAATGGTTGCAGTTT
Motif Score 2.084928571
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000228843.13; ENST00000352618.8; ENST00000544931.1; ENST00000442992.6
External Link RMBase: m6A_site_173502
mod ID: M6ASITE010223 Click to Show/Hide the Full List
mod site chr12:4559495-4559496:+ [4]
Sequence AACTTAGAATTATTTTACACACTAAAATGGTTGCAGTTTTA
Motif Score 2.506922619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000228843.13; ENST00000352618.8; ENST00000442992.6; ENST00000544931.1
External Link RMBase: m6A_site_173503
mod ID: M6ASITE010224 Click to Show/Hide the Full List
mod site chr12:4559568-4559569:+ [4]
Sequence CTAGAAAATAGTATTTAAAGACATTTTATGAAATCTTCATT
Motif Score 2.897386905
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000228843.13; ENST00000442992.6; ENST00000352618.8; ENST00000544931.1
External Link RMBase: m6A_site_173504
mod ID: M6ASITE010225 Click to Show/Hide the Full List
mod site chr12:4559670-4559671:+ [3]
Sequence CCACGTGTTCCTGATTGTCCACATTTCATGATAAAATGAGA
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000228843.13; ENST00000352618.8; ENST00000442992.6; ENST00000544931.1
External Link RMBase: m6A_site_173505
mod ID: M6ASITE010226 Click to Show/Hide the Full List
mod site chr12:4559780-4559781:+ [4]
Sequence TTAGAAAGTAGTTGTCAAGTACTTAGTCATCCCTATTATGA
Motif Score 3.278136905
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000442992.6; ENST00000352618.8; ENST00000228843.13
External Link RMBase: m6A_site_173506
mod ID: M6ASITE010227 Click to Show/Hide the Full List
mod site chr12:4559843-4559844:+ [4]
Sequence GGAAGCTTAGATCTGAATTTACTTTGAAAAACAATTGTAAT
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000228843.13; ENST00000442992.6; ENST00000352618.8
External Link RMBase: m6A_site_173507
mod ID: M6ASITE010228 Click to Show/Hide the Full List
mod site chr12:4559853-4559854:+ [4]
Sequence ATCTGAATTTACTTTGAAAAACAATTGTAATGAATATTTTA
Motif Score 2.20572619
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000228843.13; ENST00000352618.8; ENST00000442992.6
External Link RMBase: m6A_site_173508
mod ID: M6ASITE010229 Click to Show/Hide the Full List
mod site chr12:4559879-4559880:+ [4]
Sequence GTAATGAATATTTTATATTTACATTGAGAATTTCAACTAGC
Motif Score 2.07285119
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000228843.13; ENST00000352618.8; ENST00000442992.6
External Link RMBase: m6A_site_173509
mod ID: M6ASITE010230 Click to Show/Hide the Full List
mod site chr12:4559894-4559895:+ [4]
Sequence TATTTACATTGAGAATTTCAACTAGCTTCTGATCAATTTTT
Motif Score 2.595904762
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000442992.6; ENST00000352618.8; ENST00000228843.13
External Link RMBase: m6A_site_173510