m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00769)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
KRT7
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RIP-seq result supporting the interaction between KRT7 and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 1.21E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Specifically, increased METTL3 methylated KRT7-AS at A877 to increase the stability of a KRT7-AS/Keratin, type II cytoskeletal 7 (KRT7) mRNA duplex via IGF2BP1/HuR complexes. m6A promotes breast cancer lung metastasis by increasing the stability of a KRT7-AS/KRT7 mRNA duplex and translation of KRT7. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Cell Process | Lung Metastasis | |||
| In-vitro Model | MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 |
| BT-549 | Invasive breast carcinoma | Homo sapiens | CVCL_1092 | |
| In-vivo Model | First, subcutaneous transplanted model was used to evaluate the growth of BT-549LMF3 and BT-549 cells. Cells (5 × 106 per mouse, n = 5 for each group) were diluted in 200 ul PBS + 200 ul Matrigel (BD Biosciences) and subcutaneously injected into immunodeficient female mice. Second, subcutaneous transplanted model was used to evaluate the metastasis potential of BT-549LMF3 and BT-549 cells. Cells (5 × 106 per mouse, n = 5 for each group) were diluted in 200 ul PBS + 200 ul Matrigel (BD Biosciences) and subcutaneously injected into immunodeficient female mice. Third, the in vivo lung metastasis model was established by injecting with BT-549, BT-549LMF3, FTO stable BT-549LMF3, sh-METTL3 BT-549LMF3, and sh-KRT7 BT-549LMF3 stable cells (1 × 106 per mouse, n = 5 for each group). | |||
Breast cancer [ICD-11: 2C60]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | Specifically, increased METTL3 methylated KRT7-AS at A877 to increase the stability of a KRT7-AS/Keratin, type II cytoskeletal 7 (KRT7) mRNA duplex via IGF2BP1/HuR complexes. m6A promotes breast cancer lung metastasis by increasing the stability of a KRT7-AS/KRT7 mRNA duplex and translation of KRT7. | |||
| Responsed Disease | Breast cancer [ICD-11: 2C60] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Lung Metastasis | |||
| In-vitro Model | MDA-MB-231 | Breast adenocarcinoma | Homo sapiens | CVCL_0062 |
| BT-549 | Invasive breast carcinoma | Homo sapiens | CVCL_1092 | |
| In-vivo Model | First, subcutaneous transplanted model was used to evaluate the growth of BT-549LMF3 and BT-549 cells. Cells (5 × 106 per mouse, n = 5 for each group) were diluted in 200 ul PBS + 200 ul Matrigel (BD Biosciences) and subcutaneously injected into immunodeficient female mice. Second, subcutaneous transplanted model was used to evaluate the metastasis potential of BT-549LMF3 and BT-549 cells. Cells (5 × 106 per mouse, n = 5 for each group) were diluted in 200 ul PBS + 200 ul Matrigel (BD Biosciences) and subcutaneously injected into immunodeficient female mice. Third, the in vivo lung metastasis model was established by injecting with BT-549, BT-549LMF3, FTO stable BT-549LMF3, sh-METTL3 BT-549LMF3, and sh-KRT7 BT-549LMF3 stable cells (1 × 106 per mouse, n = 5 for each group). | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00769)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: 2OMSITE000051 | Click to Show/Hide the Full List | ||
| mod site | chr12:52241616-52241617:+ | [2] | |
| Sequence | ATGCAGCCGGGCTGAGGCTGAAGCCTGGTACCAGACCAAGG | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | Nm-seq | ||
| Transcript ID List | ENST00000548088.1; ENST00000638501.1; ENST00000331817.6; ENST00000552183.1; ENST00000551130.1; ENST00000546856.5 | ||
| External Link | RMBase: Nm_site_1337 | ||
| mod ID: 2OMSITE000050 | Click to Show/Hide the Full List | ||
| mod site | chr12:52235326-52235327:+ | [2] | |
| Sequence | GGGCCGCCTGGAGGCGGAGCTGCGGAGCATGCAGGATGTGG | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | Nm-seq | ||
| Transcript ID List | ENST00000547613.1; ENST00000331817.6 | ||
| External Link | RMBase: Nm_site_1336 | ||
5-methylcytidine (m5C)
| In total 19 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE000003 | Click to Show/Hide the Full List | ||
| mod site | chr12:52233235-52233236:+ | [3] | |
| Sequence | TAAAAGGCGCGGAGTGTCCCCGAGGTCAGCGAGTGCGCGCT | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m5C-RIP-seq; Bisulfite-seq | ||
| Transcript ID List | ENST00000546666.1 | ||
| External Link | RMBase: m5C_site_10079 | ||
| mod ID: M5CSITE000004 | Click to Show/Hide the Full List | ||
| mod site | chr12:52241464-52241465:+ | [3] | |
| Sequence | TCCTGATGTCCCGTCTGGTCCCTACAGGAGTTGACAGAGCT | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000548088.1; ENST00000546856.5; ENST00000547613.1; ENST00000638501.1 | ||
| External Link | RMBase: m5C_site_10080 | ||
| mod ID: M5CSITE000005 | Click to Show/Hide the Full List | ||
| mod site | chr12:52241465-52241466:+ | [3] | |
| Sequence | CCTGATGTCCCGTCTGGTCCCTACAGGAGTTGACAGAGCTG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000547613.1; ENST00000548088.1; ENST00000546856.5; ENST00000331817.6; ENST00000638501.1 | ||
| External Link | RMBase: m5C_site_10081 | ||
| mod ID: M5CSITE000006 | Click to Show/Hide the Full List | ||
| mod site | chr12:52241468-52241469:+ | [3] | |
| Sequence | GATGTCCCGTCTGGTCCCTACAGGAGTTGACAGAGCTGCAG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000546856.5; ENST00000547613.1; ENST00000331817.6; ENST00000548088.1; ENST00000638501.1 | ||
| External Link | RMBase: m5C_site_10082 | ||
| mod ID: M5CSITE000007 | Click to Show/Hide the Full List | ||
| mod site | chr12:52241593-52241594:+ | ||
| Sequence | GCGCAGTATGAGGAGATGGCCAAATGCAGCCGGGCTGAGGC | ||
| Cell/Tissue List | testis; HeLa | ||
| Seq Type List | Bisulfite-seq; m5C-RIP-seq | ||
| Transcript ID List | ENST00000638501.1; ENST00000552183.1; ENST00000546856.5; ENST00000331817.6; ENST00000548088.1; ENST00000551130.1 | ||
| External Link | RMBase: m5C_site_10084 | ||
| mod ID: M5CSITE000008 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243055-52243056:+ | ||
| Sequence | GGGAAGCATGGGGACGACCTCCGGAATACCCGGAATGAGAT | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000638501.1; ENST00000551130.1; ENST00000552183.1; ENST00000546856.5 | ||
| External Link | RMBase: m5C_site_10085 | ||
| mod ID: M5CSITE000009 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243056-52243057:+ | ||
| Sequence | GGAAGCATGGGGACGACCTCCGGAATACCCGGAATGAGATT | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000551130.1; ENST00000546856.5; ENST00000638501.1; ENST00000331817.6; ENST00000552183.1 | ||
| External Link | RMBase: m5C_site_10086 | ||
| mod ID: M5CSITE000010 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243088-52243089:+ | ||
| Sequence | AATGAGATTTCAGAGATGAACCGGGCCATCCAGAGGCTGCA | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000552183.1; ENST00000551130.1; ENST00000546856.5; ENST00000638501.1; ENST00000549127.5; ENST00000331817.6 | ||
| External Link | RMBase: m5C_site_10087 | ||
| mod ID: M5CSITE000011 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243124-52243125:+ | ||
| Sequence | CTGCAGGCTGAGATCGACAACATCAAGAACCAGGTGGGACA | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000546856.5; ENST00000552183.1; ENST00000551130.1; ENST00000638501.1; ENST00000331817.6; ENST00000549127.5 | ||
| External Link | RMBase: m5C_site_10088 | ||
| mod ID: M5CSITE000012 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243127-52243128:+ | ||
| Sequence | CAGGCTGAGATCGACAACATCAAGAACCAGGTGGGACAAGT | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000551130.1; ENST00000552183.1; ENST00000331817.6; ENST00000549127.5; ENST00000546856.5; ENST00000638501.1 | ||
| External Link | RMBase: m5C_site_10089 | ||
| mod ID: M5CSITE000013 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243133-52243134:+ | ||
| Sequence | GAGATCGACAACATCAAGAACCAGGTGGGACAAGTCCTCCT | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000638501.1; ENST00000549127.5; ENST00000552183.1; ENST00000546856.5; ENST00000551130.1 | ||
| External Link | RMBase: m5C_site_10090 | ||
| mod ID: M5CSITE000014 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243134-52243135:+ | ||
| Sequence | AGATCGACAACATCAAGAACCAGGTGGGACAAGTCCTCCTG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000551130.1; ENST00000638501.1; ENST00000331817.6; ENST00000552183.1; ENST00000549127.5; ENST00000546856.5 | ||
| External Link | RMBase: m5C_site_10091 | ||
| mod ID: M5CSITE000015 | Click to Show/Hide the Full List | ||
| mod site | chr12:52246395-52246396:+ | [3] | |
| Sequence | AAACATCCACAGAGGAAACCCCCAGAGACCAGTAACTTACA | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000548657.5; ENST00000549127.5; ENST00000552322.5 | ||
| External Link | RMBase: m5C_site_10092 | ||
| mod ID: M5CSITE000016 | Click to Show/Hide the Full List | ||
| mod site | chr12:52247042-52247043:+ | [4] | |
| Sequence | ACTCTGAGAGGATATGGTTCCCCCAACCCTGGGGGGATATG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000552322.5; ENST00000549127.5; ENST00000331817.6; ENST00000548657.5 | ||
| External Link | RMBase: m5C_site_10093 | ||
| mod ID: M5CSITE000017 | Click to Show/Hide the Full List | ||
| mod site | chr12:52247043-52247044:+ | [4] | |
| Sequence | CTCTGAGAGGATATGGTTCCCCCAACCCTGGGGGGATATGG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000548657.5; ENST00000552322.5; ENST00000549127.5 | ||
| External Link | RMBase: m5C_site_10094 | ||
| mod ID: M5CSITE000018 | Click to Show/Hide the Full List | ||
| mod site | chr12:52247044-52247045:+ | [4] | |
| Sequence | TCTGAGAGGATATGGTTCCCCCAACCCTGGGGGGATATGGA | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000549127.5; ENST00000548657.5; ENST00000552322.5 | ||
| External Link | RMBase: m5C_site_10095 | ||
| mod ID: M5CSITE000019 | Click to Show/Hide the Full List | ||
| mod site | chr12:52247045-52247046:+ | [4] | |
| Sequence | CTGAGAGGATATGGTTCCCCCAACCCTGGGGGGATATGGAG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000552322.5; ENST00000548657.5; ENST00000549127.5 | ||
| External Link | RMBase: m5C_site_10096 | ||
| mod ID: M5CSITE000020 | Click to Show/Hide the Full List | ||
| mod site | chr12:52247230-52247231:+ | [3] | |
| Sequence | CTTGGACATTCAGGCCTCTTCCGTCTGAGTTCCTTAGGCAT | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000548657.5; ENST00000552322.5; ENST00000549127.5 | ||
| External Link | RMBase: m5C_site_10097 | ||
| mod ID: M5CSITE000021 | Click to Show/Hide the Full List | ||
| mod site | chr12:52250547-52250548:+ | [3] | |
| Sequence | TGCTCACCGCCACGTTCCCGCTGCAGGGGGCACTGCAGACG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000548657.5; ENST00000553310.6 | ||
| External Link | RMBase: m5C_site_10100 | ||
N6-methyladenosine (m6A)
| In total 47 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE012476 | Click to Show/Hide the Full List | ||
| mod site | chr12:52232708-52232709:+ | [5] | |
| Sequence | GAAGGAACGCAGCCAGGGAAACTAGCTGGGCCAGGAGGGGT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; A549; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000552400.1; ENST00000546666.1 | ||
| External Link | RMBase: m6A_site_189080 | ||
| mod ID: M6ASITE012477 | Click to Show/Hide the Full List | ||
| mod site | chr12:52232732-52232733:+ | [5] | |
| Sequence | GCTGGGCCAGGAGGGGTCAGACCCCTGAACAAGTGAGCTGA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; A549; MSC; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000552400.1; ENST00000546666.1 | ||
| External Link | RMBase: m6A_site_189081 | ||
| mod ID: M6ASITE012478 | Click to Show/Hide the Full List | ||
| mod site | chr12:52232740-52232741:+ | [5] | |
| Sequence | AGGAGGGGTCAGACCCCTGAACAAGTGAGCTGATCTCTCAA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; A549; MSC; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000546666.1; ENST00000552400.1 | ||
| External Link | RMBase: m6A_site_189082 | ||
| mod ID: M6ASITE012479 | Click to Show/Hide the Full List | ||
| mod site | chr12:52233064-52233065:+ | [5] | |
| Sequence | GGCGCTCCTGCCTACTCCGGACCATCCCTGCTTGGACTGAA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; A549; HepG2; MSC; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000546666.1; ENST00000552400.1 | ||
| External Link | RMBase: m6A_site_189083 | ||
| mod ID: M6ASITE012480 | Click to Show/Hide the Full List | ||
| mod site | chr12:52233079-52233080:+ | [5] | |
| Sequence | TCCGGACCATCCCTGCTTGGACTGAAAGCCTGGGCTTCGGC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; A549; HepG2; MSC; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000546666.1; ENST00000552400.1 | ||
| External Link | RMBase: m6A_site_189084 | ||
| mod ID: M6ASITE012481 | Click to Show/Hide the Full List | ||
| mod site | chr12:52233584-52233585:+ | [5] | |
| Sequence | AGGAGAGCGAGCAGATCAAGACCCTCAACAACAAGTTTGCC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; A549; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000331817.6 | ||
| External Link | RMBase: m6A_site_189085 | ||
| mod ID: M6ASITE012482 | Click to Show/Hide the Full List | ||
| mod site | chr12:52235176-52235177:+ | [5] | |
| Sequence | GCGGTTTCTGGAGCAGCAGAACAAGCTGCTGGAGACCAAGT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; A549; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000547613.1 | ||
| External Link | RMBase: m6A_site_189086 | ||
| mod ID: M6ASITE012483 | Click to Show/Hide the Full List | ||
| mod site | chr12:52235190-52235191:+ | [5] | |
| Sequence | AGCAGAACAAGCTGCTGGAGACCAAGTGGACGCTGCTGCAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; A549; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000547613.1 | ||
| External Link | RMBase: m6A_site_189087 | ||
| mod ID: M6ASITE012484 | Click to Show/Hide the Full List | ||
| mod site | chr12:52235245-52235246:+ | [5] | |
| Sequence | CAAGAGCAGCCGCCTCCCAGACATCTTTGAGGCCCAGATTG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; A549; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000547613.1; ENST00000331817.6 | ||
| External Link | RMBase: m6A_site_189088 | ||
| mod ID: M6ASITE012485 | Click to Show/Hide the Full List | ||
| mod site | chr12:52235353-52235354:+ | [5] | |
| Sequence | CATGCAGGATGTGGTGGAGGACTTCAAGAATAAGTAATGCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; A549; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000547613.1; ENST00000331817.6 | ||
| External Link | RMBase: m6A_site_189089 | ||
| mod ID: M6ASITE012487 | Click to Show/Hide the Full List | ||
| mod site | chr12:52237582-52237583:+ | [5] | |
| Sequence | GAAGAAGGTGAGTGGGAAAGACAGGCTCGAGGAGGGTTGTC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; A549; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000547613.1 | ||
| External Link | RMBase: m6A_site_189090 | ||
| mod ID: M6ASITE012488 | Click to Show/Hide the Full List | ||
| mod site | chr12:52237608-52237609:+ | [5] | |
| Sequence | TCGAGGAGGGTTGTCTGAAAACATGGGACAAAGGACCACAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HepG2; A549; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000547613.1 | ||
| External Link | RMBase: m6A_site_189091 | ||
| mod ID: M6ASITE012489 | Click to Show/Hide the Full List | ||
| mod site | chr12:52237615-52237616:+ | [5] | |
| Sequence | GGGTTGTCTGAAAACATGGGACAAAGGACCACAGGATCCTC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; A549; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000547613.1 | ||
| External Link | RMBase: m6A_site_189092 | ||
| mod ID: M6ASITE012490 | Click to Show/Hide the Full List | ||
| mod site | chr12:52237622-52237623:+ | [5] | |
| Sequence | CTGAAAACATGGGACAAAGGACCACAGGATCCTCTCACCTG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; A549; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000547613.1 | ||
| External Link | RMBase: m6A_site_189093 | ||
| mod ID: M6ASITE012491 | Click to Show/Hide the Full List | ||
| mod site | chr12:52237657-52237658:+ | [5] | |
| Sequence | CACCTGAGCAGCCCATGGGGACCTCTGGCCAAGGCCTGCCT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; A549; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000547613.1; ENST00000331817.6 | ||
| External Link | RMBase: m6A_site_189094 | ||
| mod ID: M6ASITE012492 | Click to Show/Hide the Full List | ||
| mod site | chr12:52238760-52238761:+ | [6] | |
| Sequence | ATGAGATCAACTTCCTCAGGACCCTCAATGAGACGGTGAGG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HepG2; A549; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000548088.1; ENST00000638501.1; ENST00000331817.6; ENST00000546856.5; ENST00000547613.1 | ||
| External Link | RMBase: m6A_site_189095 | ||
| mod ID: M6ASITE012493 | Click to Show/Hide the Full List | ||
| mod site | chr12:52241526-52241527:+ | [6] | |
| Sequence | ATCTGTGGTGCTGTCCATGGACAACAGTCGCTCCCTGGACC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HepG2; A549; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000638501.1; ENST00000548088.1; ENST00000546856.5 | ||
| External Link | RMBase: m6A_site_189096 | ||
| mod ID: M6ASITE012494 | Click to Show/Hide the Full List | ||
| mod site | chr12:52241544-52241545:+ | [7] | |
| Sequence | GGACAACAGTCGCTCCCTGGACCTGGACGGCATCATCGCTG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; A549; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000638501.1; ENST00000546856.5; ENST00000548088.1; ENST00000552183.1; ENST00000331817.6; ENST00000551130.1 | ||
| External Link | RMBase: m6A_site_189097 | ||
| mod ID: M6ASITE012495 | Click to Show/Hide the Full List | ||
| mod site | chr12:52241630-52241631:+ | [7] | |
| Sequence | AGGCTGAAGCCTGGTACCAGACCAAGGTGTGAGGCCACCAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000548088.1; ENST00000546856.5; ENST00000552183.1; ENST00000331817.6; ENST00000551130.1; ENST00000638501.1 | ||
| External Link | RMBase: m6A_site_189098 | ||
| mod ID: M6ASITE012496 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243017-52243018:+ | [5] | |
| Sequence | TATGGCCCCTCCAGTTTGAGACCCTCCAGGCCCAGGCTGGG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000551130.1; ENST00000638501.1; ENST00000552183.1; ENST00000331817.6; ENST00000546856.5 | ||
| External Link | RMBase: m6A_site_189099 | ||
| mod ID: M6ASITE012498 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243087-52243088:+ | [5] | |
| Sequence | GAATGAGATTTCAGAGATGAACCGGGCCATCCAGAGGCTGC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; A549; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000638501.1; ENST00000551130.1; ENST00000552183.1; ENST00000549127.5; ENST00000331817.6; ENST00000546856.5 | ||
| External Link | RMBase: m6A_site_189100 | ||
| mod ID: M6ASITE012499 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243132-52243133:+ | [5] | |
| Sequence | TGAGATCGACAACATCAAGAACCAGGTGGGACAAGTCCTCC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; A549; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000638501.1; ENST00000552183.1; ENST00000331817.6; ENST00000546856.5; ENST00000549127.5; ENST00000551130.1 | ||
| External Link | RMBase: m6A_site_189101 | ||
| mod ID: M6ASITE012500 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243142-52243143:+ | [5] | |
| Sequence | AACATCAAGAACCAGGTGGGACAAGTCCTCCTGGCTTCCCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; A549; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000552183.1; ENST00000638501.1; ENST00000331817.6; ENST00000546856.5; ENST00000551130.1; ENST00000549127.5 | ||
| External Link | RMBase: m6A_site_189102 | ||
| mod ID: M6ASITE012501 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243202-52243203:+ | [5] | |
| Sequence | GGGTGGCCAGCTGAGGCCAAACTCAGGATGTGGAGCAGGAG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; A549; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000638501.1; ENST00000551130.1; ENST00000552183.1; ENST00000331817.6; ENST00000546856.5; ENST00000549127.5 | ||
| External Link | RMBase: m6A_site_189103 | ||
| mod ID: M6ASITE012502 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243262-52243263:+ | [5] | |
| Sequence | AGCTGGTGCCACTGTCTCAGACCCCCTTGTGAGATCTCCAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; A549; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000638501.1; ENST00000551130.1; ENST00000331817.6; ENST00000552183.1; ENST00000549127.5; ENST00000546856.5 | ||
| External Link | RMBase: m6A_site_189104 | ||
| mod ID: M6ASITE012503 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243362-52243363:+ | [5] | |
| Sequence | CACAGAGCCTGTGGAGGGAGACTCAGGCTGGCTGGCCAGAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; A549; HepG2; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000551130.1; ENST00000546856.5; ENST00000549127.5; ENST00000638501.1; ENST00000331817.6; ENST00000552183.1 | ||
| External Link | RMBase: m6A_site_189105 | ||
| mod ID: M6ASITE012504 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243482-52243483:+ | [5] | |
| Sequence | GCTCATCATTCATTGCAGGGACAGAGGACAGCAGAAGACCT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; A549; HepG2; hESCs; MSC; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000638501.1; ENST00000331817.6; ENST00000552183.1; ENST00000549127.5; ENST00000546856.5 | ||
| External Link | RMBase: m6A_site_189106 | ||
| mod ID: M6ASITE012505 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243489-52243490:+ | [5] | |
| Sequence | ATTCATTGCAGGGACAGAGGACAGCAGAAGACCTTATAATG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; A549; HepG2; hESCs; MSC; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | rmsk_3791109; ENST00000546856.5; ENST00000331817.6; ENST00000638501.1; ENST00000552183.1; ENST00000549127.5 | ||
| External Link | RMBase: m6A_site_189107 | ||
| mod ID: M6ASITE012506 | Click to Show/Hide the Full List | ||
| mod site | chr12:52243499-52243500:+ | [5] | |
| Sequence | GGGACAGAGGACAGCAGAAGACCTTATAATGACTCACATGG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; A549; HepG2; hESCs; MSC; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000549127.5; ENST00000546856.5; ENST00000552183.1; ENST00000331817.6; ENST00000638501.1; rmsk_3791109 | ||
| External Link | RMBase: m6A_site_189108 | ||
| mod ID: M6ASITE012507 | Click to Show/Hide the Full List | ||
| mod site | chr12:52244566-52244567:+ | [5] | |
| Sequence | TGTCTCTGGCAGAGAGGCAGACTGCCTCCACTGAGGGAAGA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; A549; HepG2; U2OS; GM12878; MT4; CD4T; GSC-11; iSLK; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000549127.5; ENST00000552183.1; ENST00000552322.5; ENST00000638501.1 | ||
| External Link | RMBase: m6A_site_189109 | ||
| mod ID: M6ASITE012510 | Click to Show/Hide the Full List | ||
| mod site | chr12:52245371-52245372:+ | [5] | |
| Sequence | ATGGGCAGGCAGGAAGGCAGACTGGTGAGCCCCAGCTTACA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; U2OS; MT4; A549; CD4T; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000552322.5; ENST00000638501.1; ENST00000331817.6; ENST00000549127.5 | ||
| External Link | RMBase: m6A_site_189111 | ||
| mod ID: M6ASITE012511 | Click to Show/Hide the Full List | ||
| mod site | chr12:52245557-52245558:+ | [5] | |
| Sequence | CAGCTGCGTGAGTACCAGGAACTCATGAGCGTGAAGCTGGC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2; U2OS; MT4; A549; CD4T; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000548657.5; ENST00000549127.5; ENST00000552322.5; ENST00000331817.6 | ||
| External Link | RMBase: m6A_site_189112 | ||
| mod ID: M6ASITE012512 | Click to Show/Hide the Full List | ||
| mod site | chr12:52245583-52245584:+ | [5] | |
| Sequence | GAGCGTGAAGCTGGCCCTGGACATCGAGATCGCCACCTACC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; U2OS; MT4; A549; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000552322.5; ENST00000549127.5; ENST00000548657.5; ENST00000331817.6 | ||
| External Link | RMBase: m6A_site_189113 | ||
| mod ID: M6ASITE012518 | Click to Show/Hide the Full List | ||
| mod site | chr12:52247766-52247767:+ | [5] | |
| Sequence | AAAGTATCAATAGGCCACAGACACCTTTAGGATTTTATGAT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000548657.5; ENST00000552322.5; ENST00000550153.1; ENST00000549127.5 | ||
| External Link | RMBase: m6A_site_189119 | ||
| mod ID: M6ASITE012520 | Click to Show/Hide the Full List | ||
| mod site | chr12:52248652-52248653:+ | [6] | |
| Sequence | TTGGGCTGACCCTCGGGGGAACCATGGGCAGCAATGCCCTG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HepG2; HeLa; MT4; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000549127.5; ENST00000549638.1; ENST00000548657.5; ENST00000552322.5; ENST00000331817.6; ENST00000550153.1 | ||
| External Link | RMBase: m6A_site_189120 | ||
| mod ID: M6ASITE012521 | Click to Show/Hide the Full List | ||
| mod site | chr12:52248724-52248725:+ | [6] | |
| Sequence | TGAAGGCTTATTCCATCCGGACCGCATCCGCCAGTCGCAGG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HepG2; HeLa; MT4; A549; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000550153.1; ENST00000548657.5; ENST00000331817.6; ENST00000552322.5; ENST00000549638.1 | ||
| External Link | RMBase: m6A_site_189121 | ||
| mod ID: M6ASITE012522 | Click to Show/Hide the Full List | ||
| mod site | chr12:52248845-52248846:+ | [5] | |
| Sequence | CTCCCATGCCTGGTCCCAAGACAGTGAGACAGTCTGGAAAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; MT4; A549; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000550153.1; ENST00000548657.5; ENST00000331817.6; ENST00000549638.1; ENST00000552322.5 | ||
| External Link | RMBase: m6A_site_189122 | ||
| mod ID: M6ASITE012523 | Click to Show/Hide the Full List | ||
| mod site | chr12:52248853-52248854:+ | [5] | |
| Sequence | CCTGGTCCCAAGACAGTGAGACAGTCTGGAAAGTGATGTCA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; MT4; A549; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000331817.6; ENST00000548657.5; ENST00000552322.5; ENST00000550153.1; ENST00000549638.1 | ||
| External Link | RMBase: m6A_site_189123 | ||
| mod ID: M6ASITE012524 | Click to Show/Hide the Full List | ||
| mod site | chr12:52251785-52251786:+ | [5] | |
| Sequence | TTTCCTTTTAGAGTCTGCAAACTACGGCCACATGCAGGCTT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; A549; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000548657.5; rmsk_3791123; ENST00000553310.6 | ||
| External Link | RMBase: m6A_site_189125 | ||
| mod ID: M6ASITE012525 | Click to Show/Hide the Full List | ||
| mod site | chr12:52251833-52251834:+ | [8] | |
| Sequence | GTCAATCAAGTTTTCTTGGAACCCAGTCATACCGCTTCCTT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | rmsk_3791123; ENST00000548657.5; ENST00000553310.6 | ||
| External Link | RMBase: m6A_site_189126 | ||
| mod ID: M6ASITE012526 | Click to Show/Hide the Full List | ||
| mod site | chr12:52251891-52251892:+ | [9] | |
| Sequence | TGTGGCTGCTTTACATGACAACGGAGTGGAGCAGTTGAGGC | ||
| Motif Score | 2.147845238 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000553310.6; ENST00000548657.5; rmsk_3791123 | ||
| External Link | RMBase: m6A_site_189127 | ||
| mod ID: M6ASITE012527 | Click to Show/Hide the Full List | ||
| mod site | chr12:52251916-52251917:+ | [5] | |
| Sequence | GTGGAGCAGTTGAGGCAGAGACTACATGGCCCACGAGCCTA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; A549; MT4; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000548657.5; ENST00000553310.6; rmsk_3791123 | ||
| External Link | RMBase: m6A_site_189128 | ||
| mod ID: M6ASITE012528 | Click to Show/Hide the Full List | ||
| mod site | chr12:52251983-52251984:+ | [5] | |
| Sequence | AAAAAGTTTGCCTGCCCAGAACCCCAAGCTGTTATTTCAGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; A549; HepG2; GM12878; MSC; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000548657.5; ENST00000553310.6 | ||
| External Link | RMBase: m6A_site_189129 | ||
| mod ID: M6ASITE012530 | Click to Show/Hide the Full List | ||
| mod site | chr12:52252004-52252005:+ | [5] | |
| Sequence | CCCCAAGCTGTTATTTCAGGACCCACAAAATGGATTACTTA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; A549; HepG2; GM12878; MSC; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000548657.5; ENST00000553310.6 | ||
| External Link | RMBase: m6A_site_189130 | ||
| mod ID: M6ASITE012531 | Click to Show/Hide the Full List | ||
| mod site | chr12:52252028-52252029:+ | [5] | |
| Sequence | ACAAAATGGATTACTTACAGACATTTACAGCACCAACGCCC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; A549; HepG2; GM12878; MSC; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000548657.5; ENST00000553310.6 | ||
| External Link | RMBase: m6A_site_189131 | ||
| mod ID: M6ASITE012532 | Click to Show/Hide the Full List | ||
| mod site | chr12:52252078-52252079:+ | [5] | |
| Sequence | CTTATAGGGAAAGCAAAGAGACAGAAATTAGTTGTGGGGAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; A549; HepG2; GM12878; MSC; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000548657.5; ENST00000553310.6 | ||
| External Link | RMBase: m6A_site_189132 | ||
| mod ID: M6ASITE012533 | Click to Show/Hide the Full List | ||
| mod site | chr12:52252180-52252181:+ | [10] | |
| Sequence | TCCAAGTAAATAATATGCAGACATGCTCCTGGGTGTTGAAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; A549; GM12878; MSC; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000548657.5; ENST00000553310.6 | ||
| External Link | RMBase: m6A_site_189133 | ||
References