m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00765)

Target Name	Cytokine-responsive protein CR6 (GADD45-Gamma)
Synonyms	CR6; DDIT2; Growth arrest and DNA damage-inducible protein GADD45 gamma ; Cytokine-responsive protein CR6 ; DNA damage-inducible transcript 2 protein; DDIT-2 Click to Show/Hide
Gene Name	GADD45-Gamma
Chromosomal Location	9q22.2
Family	GADD45 family
Function	Involved in the regulation of growth and apoptosis. Mediates activation of stress-responsive MTK1/MEKK4 MAPKKK. Click to Show/Hide
Gene ID	10912
Uniprot ID	GA45G_HUMAN
HGNC ID	HGNC:4097
KEGG ID	hsa:10912

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

GADD45-Gamma can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[1]
Response Summary	METTL3 promotes tumor growth and hormone secretion by increasing expression of GNAS and Cytokine-responsive protein CR6 (GADD45-Gamma) in a m6A-dependent manner. Thus, METTL3 and the methylated RNAs constitute suitable targets for clinical treatment of Pituitary growth hormone-secreting-pituitary adenomas(GH-PAs).
Target Regulation	Up regulation
Responsed Disease	Endocrine glands benign cancer	ICD-11: 2F37	Disease Info

Endocrine glands benign cancer [ICD-11: 2F37]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[1]
Response Summary	METTL3 promotes tumor growth and hormone secretion by increasing expression of GNAS and Cytokine-responsive protein CR6 (GADD45-Gamma) in a m6A-dependent manner. Thus, METTL3 and the methylated RNAs constitute suitable targets for clinical treatment of Pituitary growth hormone-secreting-pituitary adenomas(GH-PAs).
Responsed Disease	Endocrine glands benign cancer [ICD-11: 2F37]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00765)

Cytokine-responsive protein CR6 (GADD45-Gamma)

N6-methyladenosine (m6A)

In total 11 m6A sequence/site(s) in this target gene
mod ID: M6ASITE088582		Click to Show/Hide the Full List
mod site	chr9:89605149-89605150:+		[2]
Sequence	GGAAGAAGTCCGCGGCCAGGACACAGTTCCGGAAAGCACAG
Motif Score	3.643047619
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000375769.1; ENST00000494726.1; ENST00000252506.11
External Link	RMBase: m6A_site_826982
mod ID: M6ASITE088583		Click to Show/Hide the Full List
mod site	chr9:89605668-89605669:+		[2]
Sequence	CCCGCCTTGCCCTCGCAGGGACCCCGACAATGTGACCTTCT
Motif Score	3.622404762
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000375769.1; ENST00000252506.11; ENST00000494726.1
External Link	RMBase: m6A_site_826983
mod ID: M6ASITE088584		Click to Show/Hide the Full List
mod site	chr9:89606092-89606093:+		[3]
Sequence	CGAGTGACAGCCCGGCGGGGACCTTGGTCTGATCGACGTGG
Motif Score	3.622404762
Cell/Tissue List	H1A; H1B; CD4T; GSC-11; HEK293T; HEK293A-TOA; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000252506.11; ENST00000375769.1; ENST00000494726.1
External Link	RMBase: m6A_site_826984
mod ID: M6ASITE088585		Click to Show/Hide the Full List
mod site	chr9:89606188-89606189:+		[3]
Sequence	TGCCCGAGTGCGGCGTGGAGACTGGCAGGCGGGGGGGGCGC
Motif Score	3.319380952
Cell/Tissue List	H1A; H1B; hNPCs; hESCs; HEK293T; CD4T; GSC-11; HEK293A-TOA; TIME; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000375769.1; ENST00000252506.11
External Link	RMBase: m6A_site_826985
mod ID: M6ASITE088586		Click to Show/Hide the Full List
mod site	chr9:89606282-89606283:+		[4]
Sequence	CAGGCTGGTCCGAGCTGAGGACTCTGCAAGTGTCTGGAGCG
Motif Score	4.065041667
Cell/Tissue List	A549; H1A; H1B; hNPCs; hESCs; HEK293T; GM12878; Jurkat; CD4T; GSC-11; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000252506.11
External Link	RMBase: m6A_site_826986
mod ID: M6ASITE088587		Click to Show/Hide the Full List
mod site	chr9:89606332-89606333:+		[5]
Sequence	CCAGGAAGGCCTAGGCTAGGACGTTGGCCTCAGGGCCAGGA
Motif Score	3.616982143
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000252506.11
External Link	RMBase: m6A_site_826987
mod ID: M6ASITE088588		Click to Show/Hide the Full List
mod site	chr9:89606356-89606357:+		[6]
Sequence	TGGCCTCAGGGCCAGGAAGGACAGACTGGCCGGGCAGGCGT
Motif Score	3.643047619
Cell/Tissue List	HEK293T; liver; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; Jurkat; CD4T; GSC-11; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List	MeRIP-seq; m6A-REF-seq; m6A-seq
Transcript ID List	ENST00000252506.11
External Link	RMBase: m6A_site_826988
mod ID: M6ASITE088589		Click to Show/Hide the Full List
mod site	chr9:89606419-89606420:+		[4]
Sequence	AGGAAGGAGCGGCGCCCTGGACTTGGTACAGTTGCAGGAGC
Motif Score	4.065041667
Cell/Tissue List	HEK293T; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; Jurkat; CD4T; GSC-11; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000252506.11
External Link	RMBase: m6A_site_826989
mod ID: M6ASITE088590		Click to Show/Hide the Full List
mod site	chr9:89606447-89606448:+		[4]
Sequence	CAGTTGCAGGAGCGTGAAGGACTTAGCCGACTGCGCTGCTT
Motif Score	4.065041667
Cell/Tissue List	HEK293T; A549; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; Jurkat; CD4T; GSC-11; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A; GSCs
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000252506.11
External Link	RMBase: m6A_site_826990
mod ID: M6ASITE088591		Click to Show/Hide the Full List
mod site	chr9:89606540-89606541:+		[4]
Sequence	AGCTTTGAATTTTACAATAAACTTTTTGAAACAAACTTATG
Motif Score	2.627720238
Cell/Tissue List	A549; H1A; H1B; CD4T; GSC-11; HEK293A-TOA; TIME; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000252506.11
External Link	RMBase: m6A_site_826991
mod ID: M6ASITE088592		Click to Show/Hide the Full List
mod site	chr9:89606550-89606551:+		[4]
Sequence	TTTACAATAAACTTTTTGAAACAAACTTATGCTCTTTATTG
Motif Score	2.20572619
Cell/Tissue List	A549; H1A; H1B; CD4T; GSC-11; HEK293A-TOA; TIME; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000252506.11
External Link	RMBase: m6A_site_826992

Ref 1	METTL3-mediated RNA m6A Hypermethylation Promotes Tumorigenesis and GH Secretion of Pituitary Somatotroph Adenomas. J Clin Endocrinol Metab. 2022 Jan 1;107(1):136-149. doi: 10.1210/clinem/dgab652.
Ref 2	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 3	m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell. 2014 Dec 4;15(6):707-19. doi: 10.1016/j.stem.2014.09.019. Epub 2014 Oct 16.
Ref 4	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 5	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 6	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map