m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00762)

Target Name	Protein crumbs homolog 3 (CRB3)
Synonyms	Protein crumbs homolog 3 Click to Show/Hide
Gene Name	CRB3
Chromosomal Location	19p13.3
Function	Involved in the establishment of cell polarity in mammalian epithelial cells. Regulates the morphogenesis of tight junctions. Involved in promoting phosphorylation and cytoplasmic retention of transcriptional coactivators YAP1 and WWTR1/TAZ which leads to suppression of TGFB1-dependent transcription of target genes such as CCN2/CTGF, SERPINE1/PAI1, SNAI1/SNAIL1 and SMAD7 (By similarity). Click to Show/Hide
Gene ID	92359
Uniprot ID	CRUM3_HUMAN
HGNC ID	HGNC:20237
KEGG ID	hsa:92359

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CRB3 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A and METTL3 levels were substantially elevated in colorectal carcinoma(CRC) tissues, METTL3 knockdown substantially reduced the m6A level of Protein crumbs homolog 3 (CRB3), and inhibited the degradation of CRB3 mRNA to increase CRB3 expression. METTL3 regulated the progression of CRC by regulating the m6A-CRB3-Hippo pathway.
Target Regulation	Down regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	FHC	Normal	Homo sapiens	CVCL_3688
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A and METTL3 levels were substantially elevated in colorectal carcinoma(CRC) tissues, METTL3 knockdown substantially reduced the m6A level of Protein crumbs homolog 3 (CRB3), and inhibited the degradation of CRB3 mRNA to increase CRB3 expression. METTL3 regulated the progression of CRC by regulating the m6A-CRB3-Hippo pathway.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Hippo signaling pathway			hsa04390
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	FHC	Normal	Homo sapiens	CVCL_3688
	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
	SW620	Colon adenocarcinoma	Homo sapiens	CVCL_0547

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03562		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Crosstalk ID: M6ACROT03607		Crosstalk Info
Epigenetic Regulator	N-lysine methyltransferase SMYD2 (SMYD2)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00762)

Protein crumbs homolog 3 (CRB3)

N4-acetylcytidine (ac4C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000247		Click to Show/Hide the Full List
mod site	chr19:6466588-6466589:+		[2]
Sequence	GGCAGACGGAGGGCACCTACCGGCCCAGTAGCGAGGAGCAG
Cell/Tissue List	H1
Seq Type List	ac4C-seq
Transcript ID List	ENST00000598494.5; ENST00000308243.7; ENST00000356762.7; ENST00000600229.6
External Link	RMBase: ac4C_site_935

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE001690		Click to Show/Hide the Full List
mod site	chr19:6466985-6466986:+
Sequence	GAGGCCCGGGCCCCTCAGGACTCCAAGGAGACGGTGCAGGG
Cell/Tissue List	liver
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000600229.6; ENST00000598494.5; ENST00000356762.7
External Link	RMBase: m5C_site_22307

N6-methyladenosine (m6A)

In total 13 m6A sequence/site(s) in this target gene
mod ID: M6ASITE038868		Click to Show/Hide the Full List
mod site	chr19:6464286-6464287:+		[3]
Sequence	ACCCACAGAACGACCGACGGACCGAGGGTTCGAGGGAGGGA
Motif Score	3.622404762
Cell/Tissue List	H1A; H1B; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000598494.5; ENST00000600229.6; ENST00000356762.7
External Link	RMBase: m6A_site_414390
mod ID: M6ASITE038869		Click to Show/Hide the Full List
mod site	chr19:6464306-6464307:+		[3]
Sequence	ACCGAGGGTTCGAGGGAGGGACACGGACCAGGAACCTGAGC
Motif Score	3.643047619
Cell/Tissue List	H1A; H1B; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000356762.7; ENST00000598494.5; ENST00000600229.6
External Link	RMBase: m6A_site_414391
mod ID: M6ASITE038870		Click to Show/Hide the Full List
mod site	chr19:6464312-6464313:+		[3]
Sequence	GGTTCGAGGGAGGGACACGGACCAGGAACCTGAGCTAGGTC
Motif Score	3.622404762
Cell/Tissue List	H1A; H1B; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000600229.6; ENST00000356762.7; ENST00000598494.5
External Link	RMBase: m6A_site_414392
mod ID: M6ASITE038871		Click to Show/Hide the Full List
mod site	chr19:6464319-6464320:+		[3]
Sequence	GGGAGGGACACGGACCAGGAACCTGAGCTAGGTCAAAGACG
Motif Score	2.930744048
Cell/Tissue List	H1A; H1B; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000600229.6; ENST00000598494.5; ENST00000356762.7
External Link	RMBase: m6A_site_414393
mod ID: M6ASITE038872		Click to Show/Hide the Full List
mod site	chr19:6464708-6464709:+		[4]
Sequence	CGCCACCCAGCCCATGGCGAACCCCGGGCTGGGGCTGCTTC
Motif Score	2.930744048
Cell/Tissue List	HepG2; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000598494.5; ENST00000600229.6; ENST00000308243.7; ENST00000356762.7
External Link	RMBase: m6A_site_414394
mod ID: M6ASITE038873		Click to Show/Hide the Full List
mod site	chr19:6465549-6465550:+		[4]
Sequence	CTTCACCCTCCACAGTACAGACCACTTCTGCAAATGAGAAT
Motif Score	2.876744048
Cell/Tissue List	HepG2; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000356762.7; ENST00000598494.5; ENST00000600229.6; ENST00000308243.7
External Link	RMBase: m6A_site_414395
mod ID: M6ASITE038874		Click to Show/Hide the Full List
mod site	chr19:6466709-6466710:+		[5]
Sequence	AGCCACCAACACTGCCCAGGACTGCGGGTTGCTGGCTTGTA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; A549; H1A; H1B; hESCs; fibroblasts; iSLK; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000600229.6; ENST00000308243.7; ENST00000598494.5; ENST00000356762.7
External Link	RMBase: m6A_site_414396
mod ID: M6ASITE038875		Click to Show/Hide the Full List
mod site	chr19:6466749-6466750:+		[5]
Sequence	ACACCGCAGCTGCCACCGAGACACCAGCCTCTGATGGCTCA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; A549; H1A; H1B; hESCs; fibroblasts; iSLK; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000598494.5; ENST00000356762.7; ENST00000308243.7; ENST00000600229.6
External Link	RMBase: m6A_site_414397
mod ID: M6ASITE038876		Click to Show/Hide the Full List
mod site	chr19:6466775-6466776:+		[4]
Sequence	GCCTCTGATGGCTCAGGAGGACTTGTGGGGAGAGGCTGGGG
Motif Score	4.065041667
Cell/Tissue List	HepG2; HeLa; A549; H1A; H1B; hESCs; fibroblasts; iSLK; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000598494.5; ENST00000600229.6; ENST00000356762.7
External Link	RMBase: m6A_site_414398
mod ID: M6ASITE038877		Click to Show/Hide the Full List
mod site	chr19:6466873-6466874:+		[4]
Sequence	TCAGGGTGCTGGGGCTCGGGACCCACCCCCCTGCTTGCGGA
Motif Score	3.622404762
Cell/Tissue List	HepG2; A549; H1A; H1B; iSLK; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000356762.7; ENST00000598494.5; ENST00000600229.6
External Link	RMBase: m6A_site_414399
mod ID: M6ASITE038879		Click to Show/Hide the Full List
mod site	chr19:6466894-6466895:+		[4]
Sequence	CCCACCCCCCTGCTTGCGGAACCAACTTTTCTCTGTGTGTC
Motif Score	2.930744048
Cell/Tissue List	HepG2; A549; H1A; H1B; iSLK; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000600229.6; ENST00000598494.5; ENST00000356762.7
External Link	RMBase: m6A_site_414400
mod ID: M6ASITE038880		Click to Show/Hide the Full List
mod site	chr19:6466984-6466985:+		[3]
Sequence	CGAGGCCCGGGCCCCTCAGGACTCCAAGGAGACGGTGCAGG
Motif Score	4.065041667
Cell/Tissue List	H1A; H1B; A549; iSLK; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000356762.7; ENST00000600229.6; ENST00000598494.5
External Link	RMBase: m6A_site_414401
mod ID: M6ASITE038881		Click to Show/Hide the Full List
mod site	chr19:6467140-6467141:+		[6]
Sequence	GGGAAGAAGGTACTTCAAAGACTCTGCCCCTGAGGTCAAGA
Motif Score	3.319380952
Cell/Tissue List	Huh7; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000356762.7; ENST00000598494.5; ENST00000600229.6
External Link	RMBase: m6A_site_414402

Ref 1	METTL3 promotes colorectal carcinoma progression by regulating the m6A-CRB3-Hippo axis. J Exp Clin Cancer Res. 2022 Jan 10;41(1):19. doi: 10.1186/s13046-021-02227-8.
Ref 2	NAT10-mediated N4-acetylcytidine mRNA modification regulates self-renewal in human embryonic stem cells. Nucleic Acids Res. 2023 Sep 8;51(16):8514-8531. doi: 10.1093/nar/gkad628.
Ref 3	m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell. 2014 Dec 4;15(6):707-19. doi: 10.1016/j.stem.2014.09.019. Epub 2014 Oct 16.
Ref 4	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 5	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 6	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map