m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00757)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
BHLHE41
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL3 promoted Class E basic helix-loop-helix protein 41 (BHLHE41) expression in m6A-dependent manner, which subsequently induced CXCL1 transcription to enhance MDSC migration in vitro. METTL3 as a potential therapeutic target for CRC immunotherapy whose inhibition reverses immune suppression through m6A-BHLHE41-CXCL1 axis. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Colorectal cancer | ICD-11: 2B91 | ||
| Pathway Response | Cytokine-cytokine receptor interaction | hsa04060 | ||
| Chemokine signaling pathway | hsa04062 | |||
| Cell Process | Cell immunity | |||
| Cell growth | ||||
| Cell migration | ||||
| In-vitro Model | CT26 | Mouse colon adenocarcinoma | Mus musculus | CVCL_7254 |
| MC-38 | Mouse colon adenocarcinoma | Mus musculus | CVCL_B288 | |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| In-vivo Model | METTL3 knockout or control CT26 and MC38 cells were injected subcutaneously into the dorsal flank of each 4- to 6-week-old male immunocompetent BALB/c and C57BL/6 mice, respectively. Anti-Gr-1 (BE0075; Bio-X-Cell, Lebanon, NH) or immunoglobulin (Ig)G isotype control (BE0090, Bio-XCell) was given every other day via intraperitoneal injection (150 ug/mouse). SB-265610 (Tocris, Bristol, UK) or phosphate-buffered saline was administrated through intraperitoneal injections at a dosage of 2 mg/kg per day. Tumor sizes were measured every other day. To establish an orthotopic mouse model of CRC, 5- to 6-week-old male C57BL/6 mice were treated with 1.7% dextran sodium sulfate in drinking water for 5 days, and then allowed to recover for 3 days. After 24 hours of fasting, METTL3 knockout or control MC38 cells suspended in 50 ul of 1 mg/mL Matrigel-phosphate-buffered saline (Corning, Corning, NY) were instilled into the colon lumen of anesthetized mice, coated sparingly with Vaseline. | |||
Colorectal cancer [ICD-11: 2B91]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL3 promoted Class E basic helix-loop-helix protein 41 (BHLHE41) expression in m6A-dependent manner, which subsequently induced CXCL1 transcription to enhance MDSC migration in vitro. METTL3 as a potential therapeutic target for CRC immunotherapy whose inhibition reverses immune suppression through m6A-BHLHE41-CXCL1 axis. | |||
| Responsed Disease | Colorectal cancer [ICD-11: 2B91] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | Cytokine-cytokine receptor interaction | hsa04060 | ||
| Chemokine signaling pathway | hsa04062 | |||
| Cell Process | Cell immunity | |||
| Cell growth | ||||
| Cell migration | ||||
| In-vitro Model | CT26 | Mouse colon adenocarcinoma | Mus musculus | CVCL_7254 |
| MC-38 | Mouse colon adenocarcinoma | Mus musculus | CVCL_B288 | |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| In-vivo Model | METTL3 knockout or control CT26 and MC38 cells were injected subcutaneously into the dorsal flank of each 4- to 6-week-old male immunocompetent BALB/c and C57BL/6 mice, respectively. Anti-Gr-1 (BE0075; Bio-X-Cell, Lebanon, NH) or immunoglobulin (Ig)G isotype control (BE0090, Bio-XCell) was given every other day via intraperitoneal injection (150 ug/mouse). SB-265610 (Tocris, Bristol, UK) or phosphate-buffered saline was administrated through intraperitoneal injections at a dosage of 2 mg/kg per day. Tumor sizes were measured every other day. To establish an orthotopic mouse model of CRC, 5- to 6-week-old male C57BL/6 mice were treated with 1.7% dextran sodium sulfate in drinking water for 5 days, and then allowed to recover for 3 days. After 24 hours of fasting, METTL3 knockout or control MC38 cells suspended in 50 ul of 1 mg/mL Matrigel-phosphate-buffered saline (Corning, Corning, NY) were instilled into the colon lumen of anesthetized mice, coated sparingly with Vaseline. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 2 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03561 | ||
| Epigenetic Regulator | Histone acetyltransferase p300 (P300) | |
| Regulated Target | Histone H3 lysine 27 acetylation (H3K27ac) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Colorectal cancer | |
| Crosstalk ID: M6ACROT03606 | ||
| Epigenetic Regulator | N-lysine methyltransferase SMYD2 (SMYD2) | |
| Regulated Target | Histone H3 lysine 4 trimethylation (H3K4me3) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Colorectal cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00757)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: 2OMSITE000036 | Click to Show/Hide the Full List | ||
| mod site | chr12:26124785-26124786:- | [2] | |
| Sequence | AACAGAGGAAACGAACAGCAGTTGAACATGGACGAAGGAAT | ||
| Cell/Tissue List | HEK293 | ||
| Seq Type List | RiboMeth-seq | ||
| Transcript ID List | ENST00000242728.5; ENST00000541271.1 | ||
| External Link | RMBase: Nm_site_1270 | ||
5-methylcytidine (m5C)
N6-methyladenosine (m6A)
| In total 32 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE011259 | Click to Show/Hide the Full List | ||
| mod site | chr12:26121256-26121257:- | [3] | |
| Sequence | AATTGACCATGAATTAATGGACTCATCTTAATTTCTTCTAA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180154 | ||
| mod ID: M6ASITE011260 | Click to Show/Hide the Full List | ||
| mod site | chr12:26121717-26121718:- | [4] | |
| Sequence | CATTATCTCTTAAAATTGGAACCTAATTCGAGAGGAAGTAA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HEK293T; Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180155 | ||
| mod ID: M6ASITE011261 | Click to Show/Hide the Full List | ||
| mod site | chr12:26121795-26121796:- | [4] | |
| Sequence | TAAAAGATCCTATGCGAAAGACACTGGCTCTTTTTTTTAAT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HEK293T; Huh7; HEK293A-TOA; MSC | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180156 | ||
| mod ID: M6ASITE011262 | Click to Show/Hide the Full List | ||
| mod site | chr12:26121911-26121912:- | [4] | |
| Sequence | GCATAAACAAGAACAACAAAACAGGTGTTATGTGTACATTC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T; LCLs; Huh7; HEK293A-TOA | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180157 | ||
| mod ID: M6ASITE011263 | Click to Show/Hide the Full List | ||
| mod site | chr12:26121919-26121920:- | [4] | |
| Sequence | CACGACAGGCATAAACAAGAACAACAAAACAGGTGTTATGT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HEK293T; LCLs; Huh7; HEK293A-TOA | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180158 | ||
| mod ID: M6ASITE011264 | Click to Show/Hide the Full List | ||
| mod site | chr12:26121925-26121926:- | [4] | |
| Sequence | TAGATGCACGACAGGCATAAACAAGAACAACAAAACAGGTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T; LCLs; Huh7; HEK293A-TOA | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180159 | ||
| mod ID: M6ASITE011266 | Click to Show/Hide the Full List | ||
| mod site | chr12:26122120-26122121:- | [3] | |
| Sequence | CGGGCCCCGCGAGCCGGGGAACCCGGAGAGCTCTGCTCAGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; U2OS | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180162 | ||
| mod ID: M6ASITE011267 | Click to Show/Hide the Full List | ||
| mod site | chr12:26122411-26122412:- | [3] | |
| Sequence | CTACGTGCAGCCCTTCCTGGACAAGAGCGGCCTGGAGAAGT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; U2OS; GSC-11; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180163 | ||
| mod ID: M6ASITE011268 | Click to Show/Hide the Full List | ||
| mod site | chr12:26122563-26122564:- | [5] | |
| Sequence | GCCGCGGCCGCGCTGCTGAGACCCGACGCCGCCCTGCTCAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; U2OS; GSC-11 | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180164 | ||
| mod ID: M6ASITE011269 | Click to Show/Hide the Full List | ||
| mod site | chr12:26122696-26122697:- | [3] | |
| Sequence | GCAGGAGCCTCCCGGGGAGGACTCGCCGGCGCCCAAGAGGA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; U2OS; H1A; H1B; fibroblasts; LCLs; H1299; CD4T; GSC-11; HEK293A-TOA; MSC; TIME; iSLK; endometrial; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180165 | ||
| mod ID: M6ASITE011270 | Click to Show/Hide the Full List | ||
| mod site | chr12:26122762-26122763:- | [3] | |
| Sequence | CGAAGCCGAGGCCCGGCCGGACCGCGAGAAAGGCAAAGGCG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; LCLs; MT4; H1299; CD4T; GSC-11; HEK293A-TOA; MSC; TIME; iSLK; endometrial; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180166 | ||
| mod ID: M6ASITE011271 | Click to Show/Hide the Full List | ||
| mod site | chr12:26122804-26122805:- | [3] | |
| Sequence | CGCCGCCGAGAACGACACGGACACCGACAGCGGCTACGGCG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; LCLs; MT4; H1299; CD4T; GSC-11; HEK293A-TOA; MSC; TIME; iSLK; endometrial; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180167 | ||
| mod ID: M6ASITE011272 | Click to Show/Hide the Full List | ||
| mod site | chr12:26122844-26122845:- | [3] | |
| Sequence | GCGTGCCCGTCATCCAGCGGACTCAGCCCAGCGCCGAGCTC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; U2OS; H1A; H1B; fibroblasts; LCLs; H1299; CD4T; GSC-11; HEK293A-TOA; MSC; TIME; iSLK; endometrial; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180168 | ||
| mod ID: M6ASITE011273 | Click to Show/Hide the Full List | ||
| mod site | chr12:26123057-26123058:- | [3] | |
| Sequence | TCTCCCGGTTTGAGAGCTGGACACCCAGGGAGCCGCGGTGT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; U2OS; MT4; Huh7; CD4T; GSC-11; HEK293A-TOA; iSLK; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5; ENST00000394326.2 | ||
| External Link | RMBase: m6A_site_180169 | ||
| mod ID: M6ASITE011275 | Click to Show/Hide the Full List | ||
| mod site | chr12:26123105-26123106:- | [3] | |
| Sequence | CGTTCCACTCGGGATTTCAAACATGCGCCAAAGAAGTCTTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; U2OS | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000394326.2; ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180170 | ||
| mod ID: M6ASITE011276 | Click to Show/Hide the Full List | ||
| mod site | chr12:26123693-26123694:- | [3] | |
| Sequence | GTCTTGGAATTAACTTTGAAACACTTAAAAGCTTTAACCGC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5; ENST00000394326.2 | ||
| External Link | RMBase: m6A_site_180171 | ||
| mod ID: M6ASITE011277 | Click to Show/Hide the Full List | ||
| mod site | chr12:26123732-26123733:- | [3] | |
| Sequence | GCACCACTGCAGACTCTGGGACATCTGGAGAAAGCTGTAGT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; brain | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-REF-seq | ||
| Transcript ID List | ENST00000394326.2; ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180172 | ||
| mod ID: M6ASITE011278 | Click to Show/Hide the Full List | ||
| mod site | chr12:26123740-26123741:- | [3] | |
| Sequence | TCTTTTTTGCACCACTGCAGACTCTGGGACATCTGGAGAAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000394326.2; ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180173 | ||
| mod ID: M6ASITE011279 | Click to Show/Hide the Full List | ||
| mod site | chr12:26124086-26124087:- | [3] | |
| Sequence | CTGAAAGATTTACTGCCTGAACATCTGAAATTGACAGTAAG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000541271.1; ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180174 | ||
| mod ID: M6ASITE011280 | Click to Show/Hide the Full List | ||
| mod site | chr12:26124132-26124133:- | [3] | |
| Sequence | AATAGAAAAGAAAAGAAGAGACCGAATTAATGAATGCATTG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5; ENST00000541271.1 | ||
| External Link | RMBase: m6A_site_180175 | ||
| mod ID: M6ASITE011281 | Click to Show/Hide the Full List | ||
| mod site | chr12:26124551-26124552:- | [3] | |
| Sequence | TCCTCTTTGTATATGTGTAAACCCAAAAGGAGCATGAAACG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; LCLs; Huh7; CD4T; GSC-11; HEK293A-TOA; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5; ENST00000541271.1 | ||
| External Link | RMBase: m6A_site_180176 | ||
| mod ID: M6ASITE011282 | Click to Show/Hide the Full List | ||
| mod site | chr12:26124576-26124577:- | [3] | |
| Sequence | ATTTCTGTTTTGCAGACTGGACTATTCCTCTTTGTATATGT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; LCLs; Huh7; CD4T; GSC-11; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5; ENST00000541271.1 | ||
| External Link | RMBase: m6A_site_180177 | ||
| mod ID: M6ASITE011283 | Click to Show/Hide the Full List | ||
| mod site | chr12:26124734-26124735:- | [3] | |
| Sequence | CAAGAGAGACAGTTACTGGAACATAGAGATTTTATAGGGTA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; LCLs; Huh7; CD4T; GSC-11; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5; ENST00000541271.1 | ||
| External Link | RMBase: m6A_site_180178 | ||
| mod ID: M6ASITE011284 | Click to Show/Hide the Full List | ||
| mod site | chr12:26124746-26124747:- | [3] | |
| Sequence | ATTCCTCATTTGCAAGAGAGACAGTTACTGGAACATAGAGA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; LCLs; Huh7; CD4T; GSC-11; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5; ENST00000541271.1 | ||
| External Link | RMBase: m6A_site_180179 | ||
| mod ID: M6ASITE011286 | Click to Show/Hide the Full List | ||
| mod site | chr12:26124780-26124781:- | [3] | |
| Sequence | AGGAAACGAACAGCAGTTGAACATGGACGAAGGAATTCCTC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; LCLs; MT4; Huh7; CD4T; GSC-11; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000541271.1; ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180180 | ||
| mod ID: M6ASITE011287 | Click to Show/Hide the Full List | ||
| mod site | chr12:26124791-26124792:- | [3] | |
| Sequence | AATCGAAACAGAGGAAACGAACAGCAGTTGAACATGGACGA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; LCLs; MT4; Huh7; CD4T; GSC-11; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000541271.1; ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180181 | ||
| mod ID: M6ASITE011288 | Click to Show/Hide the Full List | ||
| mod site | chr12:26124804-26124805:- | [3] | |
| Sequence | ACAGAGCCCCAAAAATCGAAACAGAGGAAACGAACAGCAGT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; LCLs; MT4; Huh7; CD4T; GSC-11; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5; ENST00000541271.1 | ||
| External Link | RMBase: m6A_site_180182 | ||
| mod ID: M6ASITE011289 | Click to Show/Hide the Full List | ||
| mod site | chr12:26124883-26124884:- | [3] | |
| Sequence | AGAGGGAGAGCGAGAGAGAGACTGGAGACGCACAGATCCCC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; LCLs; MT4; Huh7; CD4T; GSC-11; HEK293A-TOA; MSC; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000541271.1; ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180183 | ||
| mod ID: M6ASITE011290 | Click to Show/Hide the Full List | ||
| mod site | chr12:26124915-26124916:- | [6] | |
| Sequence | CCAACTGCTTCACACTTTCAACACTGCACTGAAGAGGGAGA | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180184 | ||
| mod ID: M6ASITE011291 | Click to Show/Hide the Full List | ||
| mod site | chr12:26124936-26124937:- | [3] | |
| Sequence | GAGCGCGGTGGAGGGGGGGGACCAACTGCTTCACACTTTCA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293T; fibroblasts; MT4; Huh7; CD4T; GSC-11; HEK293A-TOA; MSC; TIME; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180185 | ||
| mod ID: M6ASITE011292 | Click to Show/Hide the Full List | ||
| mod site | chr12:26125011-26125012:- | [3] | |
| Sequence | ACTGCCTGGAGTGAGAGCAAACTACCAGCGCAGTGGGGCCG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180186 | ||
| mod ID: M6ASITE011293 | Click to Show/Hide the Full List | ||
| mod site | chr12:26125033-26125034:- | [3] | |
| Sequence | CGCGCGTGCCCTGTGGCCAAACACTGCCTGGAGTGAGAGCA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000242728.5 | ||
| External Link | RMBase: m6A_site_180187 | ||
References