m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00752)

Target Name	G2/mitotic-specific cyclin-B2 (CCNB2)
Gene Name	CCNB2
Chromosomal Location	15q22.2
Family	Cyclin family, Cyclin AB subfamily
Function	Essential for the control of the cell cycle at the G2/M (mitosis) transition. Click to Show/Hide
Gene ID	9133
Uniprot ID	CCNB2_HUMAN
HGNC ID	HGNC:1580
KEGG ID	hsa:9133

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CCNB2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

YTH domain-containing protein 2 (YTHDC2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Over-expression (OE) of YTHDC2 increased G2/mitotic-specific cyclin-B2 (CCNB2) levels, reduced cell cycle arrest, and improved reproductive toxicity after Mn exposure.
Target Regulation	Up regulation
Responsed Disease	Male infertility		ICD-11: GB04	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Block the G2/M phase
In-vitro Model	GC-1 spg	Normal	Mus musculus	CVCL_8872
In-vivo Model	Mice in the control group received an i.p. injections of 0.9% NaCl. Mice in the low, medium, and high Mn groups received i.p. injections of 12.5, 25, and 50 mg/kg MnCl₂. The volume of administration was 5 mL/kg body weight. The injection was given daily for 2 weeks.

Male infertility [ICD-11: GB04]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Over-expression (OE) of YTHDC2 increased G2/mitotic-specific cyclin-B2 (CCNB2) levels, reduced cell cycle arrest, and improved reproductive toxicity after Mn exposure.
Responsed Disease	Male infertility [ICD-11: GB04]
Target Regulator	YTH domain-containing protein 2 (YTHDC2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Cell cycle			hsa04110
Cell Process	Block the G2/M phase
In-vitro Model	GC-1 spg	Normal	Mus musculus	CVCL_8872
In-vivo Model	Mice in the control group received an i.p. injections of 0.9% NaCl. Mice in the low, medium, and high Mn groups received i.p. injections of 12.5, 25, and 50 mg/kg MnCl₂. The volume of administration was 5 mL/kg body weight. The injection was given daily for 2 weeks.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00752)

G2/mitotic-specific cyclin-B2 (CCNB2)

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000433		Click to Show/Hide the Full List
mod site	chr15:59114711-59114712:+		[2]
Sequence	TTTTAAACTTTTGATTCTACCCACAGGTTTTGCAGTCCATA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000559622.5; ENST00000621385.1; ENST00000288207.7
External Link	RMBase: m5C_site_14084

N6-methyladenosine (m6A)

In total 28 m6A sequence/site(s) in this target gene
mod ID: M6ASITE023399		Click to Show/Hide the Full List
mod site	chr15:59105129-59105130:+		[3]
Sequence	CGCGGTATTTGAATCCTGGAACAAGGCTACAGCGTCGAAGA
Motif Score	2.951386905
Cell/Tissue List	A549; iSLK; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000561077.1
External Link	RMBase: m6A_site_280622
mod ID: M6ASITE023400		Click to Show/Hide the Full List
mod site	chr15:59107346-59107347:+		[4]
Sequence	CAGTGATTTGGAGAATATTGACACAGGAGTTAATTCTAAAG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000288207.7; ENST00000621385.1; ENST00000561077.1; ENST00000559622.5
External Link	RMBase: m6A_site_280623
mod ID: M6ASITE023401		Click to Show/Hide the Full List
mod site	chr15:59107393-59107394:+		[5]
Sequence	GTCATGTGACTATTAGGCGAACTGTTTTAGAAGAAATTGGA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000288207.7; ENST00000559622.5; ENST00000621385.1; ENST00000561077.1
External Link	RMBase: m6A_site_280624
mod ID: M6ASITE023402		Click to Show/Hide the Full List
mod site	chr15:59107423-59107424:+		[4]
Sequence	AAGAAATTGGAAATAGAGTTACAACCAGAGCAGCACAAGTA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000561077.1; ENST00000559622.5; ENST00000621385.1; ENST00000288207.7
External Link	RMBase: m6A_site_280625
mod ID: M6ASITE023403		Click to Show/Hide the Full List
mod site	chr15:59107465-59107466:+		[5]
Sequence	CTAAGGTAACAATGATGAAGACTGAATGTGAATACAGAGGC
Motif Score	3.319380952
Cell/Tissue List	HeLa; hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000621385.1; ENST00000288207.7; ENST00000559622.5; ENST00000561077.1
External Link	RMBase: m6A_site_280626
mod ID: M6ASITE023404		Click to Show/Hide the Full List
mod site	chr15:59107566-59107567:+		[3]
Sequence	TTCCTTATAGAAAGCTCAGAACACCAAAGTTCCAGTTCAAC
Motif Score	2.951386905
Cell/Tissue List	hNPCs; H1299
Seq Type List	m6A-seq
Transcript ID List	ENST00000621385.1; ENST00000561077.1; ENST00000288207.7; ENST00000559622.5
External Link	RMBase: m6A_site_280627
mod ID: M6ASITE023405		Click to Show/Hide the Full List
mod site	chr15:59107595-59107596:+		[3]
Sequence	TTCCAGTTCAACCCACCAAAACAACAAATGTCAACAAACAA
Motif Score	2.20572619
Cell/Tissue List	hNPCs; LCLs; H1299
Seq Type List	m6A-seq
Transcript ID List	ENST00000559622.5; ENST00000561077.1; ENST00000288207.7; ENST00000621385.1
External Link	RMBase: m6A_site_280628
mod ID: M6ASITE023406		Click to Show/Hide the Full List
mod site	chr15:59107612-59107613:+		[6]
Sequence	AAAACAACAAATGTCAACAAACAACTGAAACCTACTGCTTC
Motif Score	2.20572619
Cell/Tissue List	LCLs; H1299
Seq Type List	m6A-seq
Transcript ID List	ENST00000559622.5; ENST00000288207.7; ENST00000561077.1; ENST00000621385.1
External Link	RMBase: m6A_site_280629
mod ID: M6ASITE023407		Click to Show/Hide the Full List
mod site	chr15:59107621-59107622:+		[6]
Sequence	AATGTCAACAAACAACTGAAACCTACTGCTTCTGTCAAACC
Motif Score	2.185083333
Cell/Tissue List	LCLs; H1299
Seq Type List	m6A-seq
Transcript ID List	ENST00000561077.1; ENST00000621385.1; ENST00000559622.5; ENST00000288207.7
External Link	RMBase: m6A_site_280630
mod ID: M6ASITE023408		Click to Show/Hide the Full List
mod site	chr15:59107639-59107640:+		[6]
Sequence	AAACCTACTGCTTCTGTCAAACCAGTACAGATGGAAAAGTT
Motif Score	2.185083333
Cell/Tissue List	LCLs; H1299
Seq Type List	m6A-seq
Transcript ID List	ENST00000288207.7; ENST00000561077.1; ENST00000621385.1; ENST00000559622.5
External Link	RMBase: m6A_site_280631
mod ID: M6ASITE023409		Click to Show/Hide the Full List
mod site	chr15:59114455-59114456:+		[4]
Sequence	TGGTGTAGGGTCCTTCTCCCACACCTGAGGATGTCTCCATG
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000621385.1; ENST00000559622.5; ENST00000561077.1; ENST00000288207.7
External Link	RMBase: m6A_site_280632
mod ID: M6ASITE023410		Click to Show/Hide the Full List
mod site	chr15:59114531-59114532:+		[4]
Sequence	CTTGCTCTGCAAAATCGAGGACATTGATAACGAAGATTGGG
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000559622.5; ENST00000288207.7; ENST00000561077.1; ENST00000621385.1
External Link	RMBase: m6A_site_280633
mod ID: M6ASITE023411		Click to Show/Hide the Full List
mod site	chr15:59114737-59114738:+		[4]
Sequence	GTTTTGCAGTCCATAAACCCACATTTCTTAGATGGAAGAGA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000559622.5; ENST00000621385.1; ENST00000288207.7
External Link	RMBase: m6A_site_280634
mod ID: M6ASITE023412		Click to Show/Hide the Full List
mod site	chr15:59114800-59114801:+		[4]
Sequence	ATCCTAGTGGATTGGCTGGTACAAGTCCACTCCAAGTTTAG
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000621385.1; ENST00000559622.5; ENST00000288207.7
External Link	RMBase: m6A_site_280635
mod ID: M6ASITE023413		Click to Show/Hide the Full List
mod site	chr15:59114841-59114842:+		[4]
Sequence	GCTTCTGCAGGAGACTCTGTACATGTGCGTTGGCATTATGG
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000559622.5; ENST00000288207.7; ENST00000621385.1
External Link	RMBase: m6A_site_280636
mod ID: M6ASITE023414		Click to Show/Hide the Full List
mod site	chr15:59116786-59116787:+		[5]
Sequence	GTTTTCTCCAAATATTGAAGACTTTGTTTACATCACAGACA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000621385.1; ENST00000559301.1; ENST00000288207.7; ENST00000559622.5
External Link	RMBase: m6A_site_280637
mod ID: M6ASITE023415		Click to Show/Hide the Full List
mod site	chr15:59116795-59116796:+		[4]
Sequence	AAATATTGAAGACTTTGTTTACATCACAGACAATGCTTATA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000559301.1; ENST00000621385.1; ENST00000288207.7; ENST00000559622.5
External Link	RMBase: m6A_site_280638
mod ID: M6ASITE023416		Click to Show/Hide the Full List
mod site	chr15:59116804-59116805:+		[5]
Sequence	AGACTTTGTTTACATCACAGACAATGCTTATACCAGTTCCC
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000621385.1; ENST00000559622.5; ENST00000559301.1; ENST00000288207.7
External Link	RMBase: m6A_site_280639
mod ID: M6ASITE023417		Click to Show/Hide the Full List
mod site	chr15:59116842-59116843:+		[5]
Sequence	CCCAAATCCGAGAAATGGAAACTCTAATTTTGAAAGAATTG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000559301.1; ENST00000621385.1; ENST00000288207.7; ENST00000559622.5
External Link	RMBase: m6A_site_280640
mod ID: M6ASITE023418		Click to Show/Hide the Full List
mod site	chr15:59116892-59116893:+		[4]
Sequence	TTGGGTCGACCCTTGCCACTACACTTCTTAAGGCGAGCATC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000559301.1; ENST00000288207.7; ENST00000559622.5; ENST00000621385.1
External Link	RMBase: m6A_site_280641
mod ID: M6ASITE023419		Click to Show/Hide the Full List
mod site	chr15:59117238-59117239:+		[5]
Sequence	CTTTCTTAGGTTGATGTTGAACAGCACACTTTAGCCAAGTA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000559622.5; ENST00000288207.7; ENST00000559301.1; ENST00000621385.1
External Link	RMBase: m6A_site_280642
mod ID: M6ASITE023420		Click to Show/Hide the Full List
mod site	chr15:59117243-59117244:+		[4]
Sequence	TTAGGTTGATGTTGAACAGCACACTTTAGCCAAGTATTTGA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000288207.7; ENST00000559622.5; ENST00000621385.1; ENST00000559301.1
External Link	RMBase: m6A_site_280643
mod ID: M6ASITE023421		Click to Show/Hide the Full List
mod site	chr15:59117272-59117273:+		[7]
Sequence	CCAAGTATTTGATGGAGCTGACTCTCATCGACTATGATATG
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000621385.1; ENST00000559622.5; ENST00000288207.7; ENST00000559301.1
External Link	RMBase: m6A_site_280644
mod ID: M6ASITE023422		Click to Show/Hide the Full List
mod site	chr15:59117355-59117356:+		[5]
Sequence	TTGTCTCAGAAGGTTCTAGGACAAGGAAAATGGGTGAGTGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000288207.7; ENST00000559622.5; ENST00000621385.1; ENST00000559301.1
External Link	RMBase: m6A_site_280645
mod ID: M6ASITE023423		Click to Show/Hide the Full List
mod site	chr15:59123577-59123578:+		[4]
Sequence	AGTATTGGAAGTCATGCAGCACATGGCCAAGAATGTGGTGA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000559026.1; ENST00000559622.5; ENST00000559301.1; ENST00000621385.1; ENST00000288207.7
External Link	RMBase: m6A_site_280646
mod ID: M6ASITE023424		Click to Show/Hide the Full List
mod site	chr15:59123610-59123611:+		[5]
Sequence	TGTGGTGAAAGTAAATGAAAACTTAACTAAATTCATCGTAA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000559622.5; ENST00000559026.1; ENST00000288207.7; ENST00000559301.1; ENST00000621385.1
External Link	RMBase: m6A_site_280647
mod ID: M6ASITE023425		Click to Show/Hide the Full List
mod site	chr15:59124949-59124950:+		[7]
Sequence	TTTAGAACTCTTGATTTTGTACATAGTCCTCTGGTCTATCT
Motif Score	2.856142857
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000288207.7; ENST00000559026.1; ENST00000621385.1; ENST00000559622.5
External Link	RMBase: m6A_site_280648
mod ID: M6ASITE023426		Click to Show/Hide the Full List
mod site	chr15:59125001-59125002:+		[4]
Sequence	TTCTCAGACCAGTTTTCTAAACATATATTGAGGAAAAATAA
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000288207.7; ENST00000559622.5; ENST00000621385.1; ENST00000559026.1
External Link	RMBase: m6A_site_280649

2'-O-Methylation (2'-O-Me)

In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000107		Click to Show/Hide the Full List
mod site	chr15:59124839-59124840:+		[8]
Sequence	TCAGCTGAACTCAAAAGCCGTCAAAGACCTTGCCTCCCCAC
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000288207.7; ENST00000559622.5; ENST00000559026.1; ENST00000621385.1
External Link	RMBase: Nm_site_1887

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000060		Click to Show/Hide the Full List
mod site	chr15:59114856-59114857:+		[9]
Sequence	TCTGTACATGTGCGTTGGCATTATGGATCGATTTTTACAGG
Transcript ID List	ENST00000288207.7; ENST00000621385.1; ENST00000559622.5
External Link	RMBase: Pseudo_site_1630

Ref 1	Protective role of m(6)A binding protein YTHDC2 on CCNB2 in manganese-induced spermatogenesis dysfunction. Chem Biol Interact. 2022 Jan 5;351:109754. doi: 10.1016/j.cbi.2021.109754. Epub 2021 Nov 22.
Ref 2	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 3	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 4	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 5	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 6	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 7	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 8	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.
Ref 9	Chemical pulldown reveals dynamic pseudouridylation of the mammalian transcriptome. Nat Chem Biol. 2015 Aug;11(8):592-7. doi: 10.1038/nchembio.1836. Epub 2015 Jun 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map