General Information of the m6A Target Gene (ID: M6ATAR00741)
Target Name Basic leucine zipper transcriptional factor ATF-like 2 (BATF2)
Synonyms
B-ATF-2; Suppressor of AP-1 regulated by IFN; SARI
    Click to Show/Hide
Gene Name BATF2
Chromosomal Location 11q13.1
Family BZIP family
Function
AP-1 family transcription factor that controls the differentiation of lineage-specific cells in the immune system. Following infection, participates in the differentiation of CD8(+) thymic conventional dendritic cells in the immune system. Acts via the formation of a heterodimer with JUN family proteins that recognizes and binds DNA sequence 5'-TGA[CG]TCA-3' and regulates expression of target genes (By similarity). Selectively suppresses CCN1 transcription and hence blocks the downstream cell proliferation signals produced by CCN1 and inhibits CCN1-induced anchorage-independent growth and invasion in several cancer types, such as breast cancer, malignant glioma and metastatic melanoma. Possibly acts by interfering with AP-1 binding to CCN1 promoter.
    Click to Show/Hide
Gene ID 116071
Uniprot ID
BATF2_HUMAN
HGNC ID
HGNC:25163
KEGG ID
hsa:116071
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
BATF2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line ARPE-19 cell line Homo sapiens
Treatment: shMETTL3 ARPE-19 cells
Control: shControl ARPE-19 cells
GSE202017
Regulation
logFC: -2.08E+00
p-value: 6.32E-06
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between BATF2 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 2.91E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary N6-methyladenosine (m6A) modification of Basic leucine zipper transcriptional factor ATF-like 2 (BATF2) mRNA by METTL3 repressed its expression in gastric cancer.
Target Regulation Down regulation
Responsed Disease Gastric cancer ICD-11: 2B72
Pathway Response p53 signaling pathway hsa04115
In-vitro Model SNU-216 Gastric tubular adenocarcinoma Homo sapiens CVCL_3946
HGC-27 Gastric carcinoma Homo sapiens CVCL_1279
In-vivo Model A total of 5 × 106 stably transfected HGC-27 cells were subcutaneously injected into the right axillary fossa of nude mice. Tumor volume was measured every 3 days and calculated with the following formula: V = (L × W2)/2 cm2 (V, tumor volume; L, length; W, width). The mice were sacrificed at 3-4 weeks after injection, and the tumors were weighed. For the lung metastasis model, 5 × 106 stably transfected HGC-27 cells were injected into the tail veins of nude mice. Forty-five days later, the mice were sacrificed, and the lungs were dissected to examine the histopathological metastatic loci. The peritoneal dissemination ability of GC cells was evaluated via intraperitoneal injection. A total of 5 × 106 stably transfected HGC-27 cells in 500 uL of PBS were injected into the peritoneal cavity of BALB/c nude mice. Mice were carefully monitored until they were killed at 4 weeks, at which point peritoneal metastases were examined and recorded.
Gastric cancer [ICD-11: 2B72]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary N6-methyladenosine (m6A) modification of Basic leucine zipper transcriptional factor ATF-like 2 (BATF2) mRNA by METTL3 repressed its expression in gastric cancer.
Responsed Disease Gastric cancer [ICD-11: 2B72]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Down regulation
Pathway Response p53 signaling pathway hsa04115
In-vitro Model SNU-216 Gastric tubular adenocarcinoma Homo sapiens CVCL_3946
HGC-27 Gastric carcinoma Homo sapiens CVCL_1279
In-vivo Model A total of 5 × 106 stably transfected HGC-27 cells were subcutaneously injected into the right axillary fossa of nude mice. Tumor volume was measured every 3 days and calculated with the following formula: V = (L × W2)/2 cm2 (V, tumor volume; L, length; W, width). The mice were sacrificed at 3-4 weeks after injection, and the tumors were weighed. For the lung metastasis model, 5 × 106 stably transfected HGC-27 cells were injected into the tail veins of nude mice. Forty-five days later, the mice were sacrificed, and the lungs were dissected to examine the histopathological metastatic loci. The peritoneal dissemination ability of GC cells was evaluated via intraperitoneal injection. A total of 5 × 106 stably transfected HGC-27 cells in 500 uL of PBS were injected into the peritoneal cavity of BALB/c nude mice. Mice were carefully monitored until they were killed at 4 weeks, at which point peritoneal metastases were examined and recorded.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03661
Epigenetic Regulator Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship Histone modification → m6A
Disease Gastric cancer
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00741)
Basic leucine zipper transcriptional factor ATF-like 2 (BATF2)
N6-methyladenosine (m6A)
In total 25 m6A sequence/site(s) in this target gene
mod ID: M6ASITE006609 Click to Show/Hide the Full List
mod site chr11:64988030-64988031:- [3]
Sequence TTCACACACATGTAAATGAAACACTATGTTAGTATCTAACA
Motif Score 2.20572619
Cell/Tissue List A549; iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000435842.2; ENST00000527454.1; ENST00000301887.9
External Link RMBase: m6A_site_146969
mod ID: M6ASITE006610 Click to Show/Hide the Full List
mod site chr11:64988071-64988072:- [3]
Sequence GAGGCGGGTGGGGGAGAGAAACCCTGGCTCTTCACCCAGGT
Motif Score 2.185083333
Cell/Tissue List A549; H1A; TIME; iSLK; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000527454.1; ENST00000435842.2; ENST00000301887.9
External Link RMBase: m6A_site_146970
mod ID: M6ASITE006611 Click to Show/Hide the Full List
mod site chr11:64988102-64988103:- [3]
Sequence TTTTACACTCTGATTCCAGGACAAGCACTCTGAGGCGGGTG
Motif Score 3.643047619
Cell/Tissue List A549; H1A; TIME; iSLK; MSC; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000435842.2; ENST00000301887.9; ENST00000527454.1
External Link RMBase: m6A_site_146971
mod ID: M6ASITE006612 Click to Show/Hide the Full List
mod site chr11:64988197-64988198:- [3]
Sequence GTTCCCTCATTGCTCTTTGGACTAGGCTGACAGCAGGAAGA
Motif Score 4.065041667
Cell/Tissue List A549; H1A; H1B; HEK293A-TOA; TIME; iSLK; MSC; endometrial; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000435842.2; ENST00000527454.1; ENST00000301887.9
External Link RMBase: m6A_site_146972
mod ID: M6ASITE006613 Click to Show/Hide the Full List
mod site chr11:64988231-64988232:- [3]
Sequence CAGGCCCTCATCACCCTCAGACCCCTCCTAAGCAGTTCCCT
Motif Score 2.876744048
Cell/Tissue List A549; H1A; H1B; HEK293A-TOA; TIME; iSLK; MSC; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000435842.2; ENST00000301887.9; ENST00000527454.1
External Link RMBase: m6A_site_146973
mod ID: M6ASITE006614 Click to Show/Hide the Full List
mod site chr11:64988320-64988321:- [3]
Sequence AGAGGAAAGAATGAGGAAGGACCCTGTGCAAGGTTATTTGC
Motif Score 3.622404762
Cell/Tissue List A549; HEK293A-TOA; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000435842.2; ENST00000301887.9; ENST00000527454.1
External Link RMBase: m6A_site_146974
mod ID: M6ASITE006615 Click to Show/Hide the Full List
mod site chr11:64988350-64988351:- [3]
Sequence AAGAGCCATTCATCTCATAAACAAAAAGGAAGAGGAAAGAA
Motif Score 2.20572619
Cell/Tissue List A549; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000527454.1; ENST00000435842.2; ENST00000301887.9
External Link RMBase: m6A_site_146975
mod ID: M6ASITE006616 Click to Show/Hide the Full List
mod site chr11:64988500-64988501:- [3]
Sequence GGGGAGAGGTCTGGAAGAGGACCATCTGGGATTTCTACAGC
Motif Score 3.622404762
Cell/Tissue List A549
Seq Type List MeRIP-seq
Transcript ID List ENST00000435842.2; ENST00000527454.1; ENST00000301887.9
External Link RMBase: m6A_site_146976
mod ID: M6ASITE006617 Click to Show/Hide the Full List
mod site chr11:64988536-64988537:- [3]
Sequence TTCAGTGCCAAGAAGCTGAAACTGTGAGCTGGAGTTGGGGA
Motif Score 2.627720238
Cell/Tissue List A549; TIME; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000527454.1; ENST00000435842.2; ENST00000301887.9
External Link RMBase: m6A_site_146977
mod ID: M6ASITE006618 Click to Show/Hide the Full List
mod site chr11:64988580-64988581:- [3]
Sequence AAGCAGAAGCCCTGAAGTGGACTCTTGCTTCCCCTAGTAGT
Motif Score 4.065041667
Cell/Tissue List A549; iSLK; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000527454.1; ENST00000435842.2; ENST00000301887.9
External Link RMBase: m6A_site_146978
mod ID: M6ASITE006619 Click to Show/Hide the Full List
mod site chr11:64988653-64988654:- [3]
Sequence AGAGCCATGCAGTCCCAGAAACCCCAACCTAGCTGGGGCAG
Motif Score 2.185083333
Cell/Tissue List A549; iSLK; endometrial; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000301887.9; ENST00000435842.2; ENST00000527454.1
External Link RMBase: m6A_site_146979
mod ID: M6ASITE006620 Click to Show/Hide the Full List
mod site chr11:64988750-64988751:- [3]
Sequence TAGGGGCTGAAATCCTGGAAACCGTGGGCTGGTGTGAGAAG
Motif Score 2.185083333
Cell/Tissue List A549; iSLK; endometrial; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000435842.2; ENST00000301887.9; ENST00000527454.1
External Link RMBase: m6A_site_146980
mod ID: M6ASITE006621 Click to Show/Hide the Full List
mod site chr11:64989346-64989347:- [4]
Sequence AGCCCAGCCTCACGGCCCAAACTGCCCCTCCACAGCCCCTC
Motif Score 2.627720238
Cell/Tissue List iSLK
Seq Type List MeRIP-seq
Transcript ID List ENST00000301887.9; ENST00000527716.1; ENST00000527454.1; ENST00000435842.2
External Link RMBase: m6A_site_146981
mod ID: M6ASITE006622 Click to Show/Hide the Full List
mod site chr11:64989458-64989459:- [5]
Sequence GGCCCCGCTGTGGTTGCTGAACCTCCTGTCCAGCTGTCCCC
Motif Score 2.930744048
Cell/Tissue List HepG2; A549; CD4T; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000301887.9; ENST00000527454.1; ENST00000435842.2; ENST00000527716.1
External Link RMBase: m6A_site_146982
mod ID: M6ASITE006623 Click to Show/Hide the Full List
mod site chr11:64989577-64989578:- [5]
Sequence AGCAGCTGGAGCTGTTCCAGACCCCGGGTTCCTGTTACCCA
Motif Score 2.876744048
Cell/Tissue List HepG2; HeLa; A549; CD4T; GSC-11; HEK293T; TIME; iSLK; MSC; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000527454.1; ENST00000534177.1; ENST00000527716.1; ENST00000435842.2; ENST00000301887.9
External Link RMBase: m6A_site_146983
mod ID: M6ASITE006624 Click to Show/Hide the Full List
mod site chr11:64989614-64989615:- [5]
Sequence CTGGGCCCTGGCCCACAGGGACAACATGGCTGCCGGGAGCA
Motif Score 3.643047619
Cell/Tissue List HepG2; HeLa; A549; H1A; CD4T; GSC-11; HEK293T; TIME; iSLK; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000301887.9; ENST00000527454.1; ENST00000435842.2; ENST00000527716.1; ENST00000534177.1
External Link RMBase: m6A_site_146984
mod ID: M6ASITE006625 Click to Show/Hide the Full List
mod site chr11:64989651-64989652:- [5]
Sequence AGGGCTCCTGGGCTGCTGGGACCAGGCTGAGGGGCTCCTGG
Motif Score 3.622404762
Cell/Tissue List HepG2; HeLa; A549; CD4T; GSC-11; HEK293T; TIME; iSLK; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000527716.1; ENST00000301887.9; ENST00000435842.2; ENST00000527454.1; ENST00000534177.1
External Link RMBase: m6A_site_146985
mod ID: M6ASITE006626 Click to Show/Hide the Full List
mod site chr11:64989727-64989728:- [6]
Sequence AGCTGGCGTGGTGGAGCCGGACCCTGCACGTGCATGAGCGC
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; A549; CD4T; GSC-11; TIME; iSLK; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000527716.1; ENST00000534177.1; ENST00000435842.2; ENST00000527454.1; ENST00000301887.9
External Link RMBase: m6A_site_146986
mod ID: M6ASITE006627 Click to Show/Hide the Full List
mod site chr11:64989789-64989790:- [5]
Sequence GCACGAGTCTCTGGAAAAAGACAACCTCGCCCTGCGGAAGG
Motif Score 2.897386905
Cell/Tissue List HepG2; HeLa; A549; CD4T; GSC-11; HEK293T; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000527454.1; ENST00000534177.1; ENST00000301887.9; ENST00000527716.1; ENST00000435842.2
External Link RMBase: m6A_site_146987
mod ID: M6ASITE006628 Click to Show/Hide the Full List
mod site chr11:64989891-64989892:- [3]
Sequence TCTTTCTCCTGAAGTTGAGGACCCTGGAAGGGGCTAAGGCT
Motif Score 3.622404762
Cell/Tissue List A549
Seq Type List MeRIP-seq
Transcript ID List ENST00000527454.1; ENST00000534177.1; ENST00000435842.2; ENST00000527716.1; ENST00000301887.9
External Link RMBase: m6A_site_146988
mod ID: M6ASITE006629 Click to Show/Hide the Full List
mod site chr11:64990495-64990496:- [5]
Sequence TCATGCTGTCAACCTGTAAAACAATCCCCTGAATCCTCCCA
Motif Score 2.20572619
Cell/Tissue List HepG2; HeLa; A549; CD4T; GSC-11; HEK293T; iSLK; TIME; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000527454.1; ENST00000301887.9; ENST00000534177.1
External Link RMBase: m6A_site_146989
mod ID: M6ASITE006630 Click to Show/Hide the Full List
mod site chr11:64994469-64994470:- [6]
Sequence AAGCCGGCAGAAGCACACAGACAAGGCAGACGCCCTGCACC
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; A549; CD4T; GSC-11; HEK293T; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000301887.9; ENST00000534177.1
External Link RMBase: m6A_site_146990
mod ID: M6ASITE006631 Click to Show/Hide the Full List
mod site chr11:64994508-64994509:- [6]
Sequence GCAGCTGAAGAAGCAGAAGAACCGGGCAGCCGCCCAGCGAA
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; A549; CD4T; GSC-11; HEK293T; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000534177.1; ENST00000301887.9
External Link RMBase: m6A_site_146991
mod ID: M6ASITE006632 Click to Show/Hide the Full List
mod site chr11:64996877-64996878:- [6]
Sequence GCAATGGGCTGCTGACCCAGACAGTGAGTACAGGGGATTGG
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; A549; CD4T; GSC-11; HEK293T; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000534177.1; ENST00000301887.9
External Link RMBase: m6A_site_146992
mod ID: M6ASITE006633 Click to Show/Hide the Full List
mod site chr11:64996938-64996939:- [5]
Sequence GAAGTCACAGCTGCTGAGGGACCACTCTGCTCCCCCGCCTA
Motif Score 3.622404762
Cell/Tissue List HepG2; HeLa; A549; CD4T; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000534177.1; ENST00000301887.9
External Link RMBase: m6A_site_146993