m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00741)

Target Name	Basic leucine zipper transcriptional factor ATF-like 2 (BATF2)
Synonyms	B-ATF-2; Suppressor of AP-1 regulated by IFN; SARI Click to Show/Hide
Gene Name	BATF2
Chromosomal Location	11q13.1
Family	BZIP family
Function	AP-1 family transcription factor that controls the differentiation of lineage-specific cells in the immune system. Following infection, participates in the differentiation of CD8(+) thymic conventional dendritic cells in the immune system. Acts via the formation of a heterodimer with JUN family proteins that recognizes and binds DNA sequence 5'-TGA[CG]TCA-3' and regulates expression of target genes (By similarity). Selectively suppresses CCN1 transcription and hence blocks the downstream cell proliferation signals produced by CCN1 and inhibits CCN1-induced anchorage-independent growth and invasion in several cancer types, such as breast cancer, malignant glioma and metastatic melanoma. Possibly acts by interfering with AP-1 binding to CCN1 promoter. Click to Show/Hide
Gene ID	116071
Uniprot ID	BATF2_HUMAN
HGNC ID	HGNC:25163
KEGG ID	hsa:116071

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

BATF2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	ARPE-19 cell line	Homo sapiens
Treatment: shMETTL3 ARPE-19 cells Control: shControl ARPE-19 cells		GSE202017
Regulation		logFC: -2.08E+00 p-value: 6.32E-06
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between BATF2 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 2.91E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	N6-methyladenosine (m6A) modification of Basic leucine zipper transcriptional factor ATF-like 2 (BATF2) mRNA by METTL3 repressed its expression in gastric cancer.
Target Regulation	Down regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Pathway Response	p53 signaling pathway			hsa04115
In-vitro Model	SNU-216	Gastric tubular adenocarcinoma	Homo sapiens	CVCL_3946
In-vitro Model	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
In-vivo Model	A total of 5 × 10⁶ stably transfected HGC-27 cells were subcutaneously injected into the right axillary fossa of nude mice. Tumor volume was measured every 3 days and calculated with the following formula: V = (L × W2)/2 cm² (V, tumor volume; L, length; W, width). The mice were sacrificed at 3-4 weeks after injection, and the tumors were weighed. For the lung metastasis model, 5 × 10⁶ stably transfected HGC-27 cells were injected into the tail veins of nude mice. Forty-five days later, the mice were sacrificed, and the lungs were dissected to examine the histopathological metastatic loci. The peritoneal dissemination ability of GC cells was evaluated via intraperitoneal injection. A total of 5 × 10⁶ stably transfected HGC-27 cells in 500 uL of PBS were injected into the peritoneal cavity of BALB/c nude mice. Mice were carefully monitored until they were killed at 4 weeks, at which point peritoneal metastases were examined and recorded.

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	N6-methyladenosine (m6A) modification of Basic leucine zipper transcriptional factor ATF-like 2 (BATF2) mRNA by METTL3 repressed its expression in gastric cancer.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	p53 signaling pathway			hsa04115
In-vitro Model	SNU-216	Gastric tubular adenocarcinoma	Homo sapiens	CVCL_3946
In-vitro Model	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
In-vivo Model	A total of 5 × 10⁶ stably transfected HGC-27 cells were subcutaneously injected into the right axillary fossa of nude mice. Tumor volume was measured every 3 days and calculated with the following formula: V = (L × W2)/2 cm² (V, tumor volume; L, length; W, width). The mice were sacrificed at 3-4 weeks after injection, and the tumors were weighed. For the lung metastasis model, 5 × 10⁶ stably transfected HGC-27 cells were injected into the tail veins of nude mice. Forty-five days later, the mice were sacrificed, and the lungs were dissected to examine the histopathological metastatic loci. The peritoneal dissemination ability of GC cells was evaluated via intraperitoneal injection. A total of 5 × 10⁶ stably transfected HGC-27 cells in 500 uL of PBS were injected into the peritoneal cavity of BALB/c nude mice. Mice were carefully monitored until they were killed at 4 weeks, at which point peritoneal metastases were examined and recorded.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03661		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship	Histone modification → m6A
Disease	Gastric cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00741)

Basic leucine zipper transcriptional factor ATF-like 2 (BATF2)

N6-methyladenosine (m6A)

In total 25 m6A sequence/site(s) in this target gene
mod ID: M6ASITE006609		Click to Show/Hide the Full List
mod site	chr11:64988030-64988031:-		[3]
Sequence	TTCACACACATGTAAATGAAACACTATGTTAGTATCTAACA
Motif Score	2.20572619
Cell/Tissue List	A549; iSLK
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000435842.2; ENST00000527454.1; ENST00000301887.9
External Link	RMBase: m6A_site_146969
mod ID: M6ASITE006610		Click to Show/Hide the Full List
mod site	chr11:64988071-64988072:-		[3]
Sequence	GAGGCGGGTGGGGGAGAGAAACCCTGGCTCTTCACCCAGGT
Motif Score	2.185083333
Cell/Tissue List	A549; H1A; TIME; iSLK; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000527454.1; ENST00000435842.2; ENST00000301887.9
External Link	RMBase: m6A_site_146970
mod ID: M6ASITE006611		Click to Show/Hide the Full List
mod site	chr11:64988102-64988103:-		[3]
Sequence	TTTTACACTCTGATTCCAGGACAAGCACTCTGAGGCGGGTG
Motif Score	3.643047619
Cell/Tissue List	A549; H1A; TIME; iSLK; MSC; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000435842.2; ENST00000301887.9; ENST00000527454.1
External Link	RMBase: m6A_site_146971
mod ID: M6ASITE006612		Click to Show/Hide the Full List
mod site	chr11:64988197-64988198:-		[3]
Sequence	GTTCCCTCATTGCTCTTTGGACTAGGCTGACAGCAGGAAGA
Motif Score	4.065041667
Cell/Tissue List	A549; H1A; H1B; HEK293A-TOA; TIME; iSLK; MSC; endometrial; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000435842.2; ENST00000527454.1; ENST00000301887.9
External Link	RMBase: m6A_site_146972
mod ID: M6ASITE006613		Click to Show/Hide the Full List
mod site	chr11:64988231-64988232:-		[3]
Sequence	CAGGCCCTCATCACCCTCAGACCCCTCCTAAGCAGTTCCCT
Motif Score	2.876744048
Cell/Tissue List	A549; H1A; H1B; HEK293A-TOA; TIME; iSLK; MSC; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000435842.2; ENST00000301887.9; ENST00000527454.1
External Link	RMBase: m6A_site_146973
mod ID: M6ASITE006614		Click to Show/Hide the Full List
mod site	chr11:64988320-64988321:-		[3]
Sequence	AGAGGAAAGAATGAGGAAGGACCCTGTGCAAGGTTATTTGC
Motif Score	3.622404762
Cell/Tissue List	A549; HEK293A-TOA; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000435842.2; ENST00000301887.9; ENST00000527454.1
External Link	RMBase: m6A_site_146974
mod ID: M6ASITE006615		Click to Show/Hide the Full List
mod site	chr11:64988350-64988351:-		[3]
Sequence	AAGAGCCATTCATCTCATAAACAAAAAGGAAGAGGAAAGAA
Motif Score	2.20572619
Cell/Tissue List	A549; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000527454.1; ENST00000435842.2; ENST00000301887.9
External Link	RMBase: m6A_site_146975
mod ID: M6ASITE006616		Click to Show/Hide the Full List
mod site	chr11:64988500-64988501:-		[3]
Sequence	GGGGAGAGGTCTGGAAGAGGACCATCTGGGATTTCTACAGC
Motif Score	3.622404762
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000435842.2; ENST00000527454.1; ENST00000301887.9
External Link	RMBase: m6A_site_146976
mod ID: M6ASITE006617		Click to Show/Hide the Full List
mod site	chr11:64988536-64988537:-		[3]
Sequence	TTCAGTGCCAAGAAGCTGAAACTGTGAGCTGGAGTTGGGGA
Motif Score	2.627720238
Cell/Tissue List	A549; TIME; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000527454.1; ENST00000435842.2; ENST00000301887.9
External Link	RMBase: m6A_site_146977
mod ID: M6ASITE006618		Click to Show/Hide the Full List
mod site	chr11:64988580-64988581:-		[3]
Sequence	AAGCAGAAGCCCTGAAGTGGACTCTTGCTTCCCCTAGTAGT
Motif Score	4.065041667
Cell/Tissue List	A549; iSLK; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000527454.1; ENST00000435842.2; ENST00000301887.9
External Link	RMBase: m6A_site_146978
mod ID: M6ASITE006619		Click to Show/Hide the Full List
mod site	chr11:64988653-64988654:-		[3]
Sequence	AGAGCCATGCAGTCCCAGAAACCCCAACCTAGCTGGGGCAG
Motif Score	2.185083333
Cell/Tissue List	A549; iSLK; endometrial; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000301887.9; ENST00000435842.2; ENST00000527454.1
External Link	RMBase: m6A_site_146979
mod ID: M6ASITE006620		Click to Show/Hide the Full List
mod site	chr11:64988750-64988751:-		[3]
Sequence	TAGGGGCTGAAATCCTGGAAACCGTGGGCTGGTGTGAGAAG
Motif Score	2.185083333
Cell/Tissue List	A549; iSLK; endometrial; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000435842.2; ENST00000301887.9; ENST00000527454.1
External Link	RMBase: m6A_site_146980
mod ID: M6ASITE006621		Click to Show/Hide the Full List
mod site	chr11:64989346-64989347:-		[4]
Sequence	AGCCCAGCCTCACGGCCCAAACTGCCCCTCCACAGCCCCTC
Motif Score	2.627720238
Cell/Tissue List	iSLK
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000301887.9; ENST00000527716.1; ENST00000527454.1; ENST00000435842.2
External Link	RMBase: m6A_site_146981
mod ID: M6ASITE006622		Click to Show/Hide the Full List
mod site	chr11:64989458-64989459:-		[5]
Sequence	GGCCCCGCTGTGGTTGCTGAACCTCCTGTCCAGCTGTCCCC
Motif Score	2.930744048
Cell/Tissue List	HepG2; A549; CD4T; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000301887.9; ENST00000527454.1; ENST00000435842.2; ENST00000527716.1
External Link	RMBase: m6A_site_146982
mod ID: M6ASITE006623		Click to Show/Hide the Full List
mod site	chr11:64989577-64989578:-		[5]
Sequence	AGCAGCTGGAGCTGTTCCAGACCCCGGGTTCCTGTTACCCA
Motif Score	2.876744048
Cell/Tissue List	HepG2; HeLa; A549; CD4T; GSC-11; HEK293T; TIME; iSLK; MSC; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527454.1; ENST00000534177.1; ENST00000527716.1; ENST00000435842.2; ENST00000301887.9
External Link	RMBase: m6A_site_146983
mod ID: M6ASITE006624		Click to Show/Hide the Full List
mod site	chr11:64989614-64989615:-		[5]
Sequence	CTGGGCCCTGGCCCACAGGGACAACATGGCTGCCGGGAGCA
Motif Score	3.643047619
Cell/Tissue List	HepG2; HeLa; A549; H1A; CD4T; GSC-11; HEK293T; TIME; iSLK; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000301887.9; ENST00000527454.1; ENST00000435842.2; ENST00000527716.1; ENST00000534177.1
External Link	RMBase: m6A_site_146984
mod ID: M6ASITE006625		Click to Show/Hide the Full List
mod site	chr11:64989651-64989652:-		[5]
Sequence	AGGGCTCCTGGGCTGCTGGGACCAGGCTGAGGGGCTCCTGG
Motif Score	3.622404762
Cell/Tissue List	HepG2; HeLa; A549; CD4T; GSC-11; HEK293T; TIME; iSLK; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527716.1; ENST00000301887.9; ENST00000435842.2; ENST00000527454.1; ENST00000534177.1
External Link	RMBase: m6A_site_146985
mod ID: M6ASITE006626		Click to Show/Hide the Full List
mod site	chr11:64989727-64989728:-		[6]
Sequence	AGCTGGCGTGGTGGAGCCGGACCCTGCACGTGCATGAGCGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; CD4T; GSC-11; TIME; iSLK; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527716.1; ENST00000534177.1; ENST00000435842.2; ENST00000527454.1; ENST00000301887.9
External Link	RMBase: m6A_site_146986
mod ID: M6ASITE006627		Click to Show/Hide the Full List
mod site	chr11:64989789-64989790:-		[5]
Sequence	GCACGAGTCTCTGGAAAAAGACAACCTCGCCCTGCGGAAGG
Motif Score	2.897386905
Cell/Tissue List	HepG2; HeLa; A549; CD4T; GSC-11; HEK293T; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527454.1; ENST00000534177.1; ENST00000301887.9; ENST00000527716.1; ENST00000435842.2
External Link	RMBase: m6A_site_146987
mod ID: M6ASITE006628		Click to Show/Hide the Full List
mod site	chr11:64989891-64989892:-		[3]
Sequence	TCTTTCTCCTGAAGTTGAGGACCCTGGAAGGGGCTAAGGCT
Motif Score	3.622404762
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000527454.1; ENST00000534177.1; ENST00000435842.2; ENST00000527716.1; ENST00000301887.9
External Link	RMBase: m6A_site_146988
mod ID: M6ASITE006629		Click to Show/Hide the Full List
mod site	chr11:64990495-64990496:-		[5]
Sequence	TCATGCTGTCAACCTGTAAAACAATCCCCTGAATCCTCCCA
Motif Score	2.20572619
Cell/Tissue List	HepG2; HeLa; A549; CD4T; GSC-11; HEK293T; iSLK; TIME; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527454.1; ENST00000301887.9; ENST00000534177.1
External Link	RMBase: m6A_site_146989
mod ID: M6ASITE006630		Click to Show/Hide the Full List
mod site	chr11:64994469-64994470:-		[6]
Sequence	AAGCCGGCAGAAGCACACAGACAAGGCAGACGCCCTGCACC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; A549; CD4T; GSC-11; HEK293T; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000301887.9; ENST00000534177.1
External Link	RMBase: m6A_site_146990
mod ID: M6ASITE006631		Click to Show/Hide the Full List
mod site	chr11:64994508-64994509:-		[6]
Sequence	GCAGCTGAAGAAGCAGAAGAACCGGGCAGCCGCCCAGCGAA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; A549; CD4T; GSC-11; HEK293T; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000534177.1; ENST00000301887.9
External Link	RMBase: m6A_site_146991
mod ID: M6ASITE006632		Click to Show/Hide the Full List
mod site	chr11:64996877-64996878:-		[6]
Sequence	GCAATGGGCTGCTGACCCAGACAGTGAGTACAGGGGATTGG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; A549; CD4T; GSC-11; HEK293T; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000534177.1; ENST00000301887.9
External Link	RMBase: m6A_site_146992
mod ID: M6ASITE006633		Click to Show/Hide the Full List
mod site	chr11:64996938-64996939:-		[5]
Sequence	GAAGTCACAGCTGCTGAGGGACCACTCTGCTCCCCCGCCTA
Motif Score	3.622404762
Cell/Tissue List	HepG2; HeLa; A549; CD4T; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000534177.1; ENST00000301887.9
External Link	RMBase: m6A_site_146993

Ref 1	m(6)A modification-mediated BATF2 acts as a tumor suppressor in gastric cancer through inhibition of ERK signaling. Mol Cancer. 2020 Jul 10;19(1):114. doi: 10.1186/s12943-020-01223-4.
Ref 2	N-demethylation of levo-alpha-acetylmethadol by human placental aromatase. Biochem Pharmacol. 2004 Mar 1;67(5):885-92. doi: 10.1016/j.bcp.2003.10.007.
Ref 3	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 4	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 5	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map