m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00739)

Target Name	hsa-miR-5581-3p
Gene Name	hsa-miR-5581-3p
miRBase ID	MIMAT0022276

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

hsa-miR-5581-3p can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	FTO proved as an N6-methyladenosine (m6A) demethylase in decreasing m6A modification was confirmed to regulate the migration and proliferation in Bca, overexpressing hsa-miR-5581-3p partially rescued the effects of the overexpressing SMAD3 and FTO in BCa cells.
Responsed Disease	Bladder cancer		ICD-11: 2C94	Disease Info
Cell Process	Cell migration
Cell Process	cell proliferation
In-vitro Model	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	HEK293T	Normal	Homo sapiens	CVCL_0063
In-vivo Model	Four-week-old male BALB/c nude mice were used for animal experiments. UM-UC3 cells (2×10⁶ cells per mouse) stably overexpressing miR-5581-3p and NC were injected into the mice to establish the subcutaneous implantation model. Tumor size was measured by a caliper every week, and tumor volume was calculated by the formula: V = (width2×length×0.52). As for the tumor metastasis model, UM-UC3 cells (1×10⁶ cells per mouse) were injected into each mouse via the tail vein. The subcutaneous implantation model used 8 nude mice, whereas the tumor metastasis model used 10 nude mice. Assessment of tumor size and observation of metastasis tumors were done via intraperitoneal inoculation with 15mg/mL, XenoLight D-luciferin Potassium Salt (100 uL; PerkinElmer) with the IVIS Spectrum animal imaging Platform (PerkinElmer) in every mouse. Eventually, mice were sacrificed for tumors and metastases.

Bladder cancer [ICD-11: 2C94]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	FTO proved as an N6-methyladenosine (m6A) demethylase in decreasing m6A modification was confirmed to regulate the migration and proliferation in Bca, overexpressing hsa-miR-5581-3p partially rescued the effects of the overexpressing SMAD3 and FTO in BCa cells.
Responsed Disease	Bladder cancer [ICD-11: 2C94]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Cell Process	Cell migration
Cell Process	cell proliferation
In-vitro Model	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	HEK293T	Normal	Homo sapiens	CVCL_0063
In-vivo Model	Four-week-old male BALB/c nude mice were used for animal experiments. UM-UC3 cells (2×10⁶ cells per mouse) stably overexpressing miR-5581-3p and NC were injected into the mice to establish the subcutaneous implantation model. Tumor size was measured by a caliper every week, and tumor volume was calculated by the formula: V = (width2×length×0.52). As for the tumor metastasis model, UM-UC3 cells (1×10⁶ cells per mouse) were injected into each mouse via the tail vein. The subcutaneous implantation model used 8 nude mice, whereas the tumor metastasis model used 10 nude mice. Assessment of tumor size and observation of metastasis tumors were done via intraperitoneal inoculation with 15mg/mL, XenoLight D-luciferin Potassium Salt (100 uL; PerkinElmer) with the IVIS Spectrum animal imaging Platform (PerkinElmer) in every mouse. Eventually, mice were sacrificed for tumors and metastases.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00739)

hsa-miR-5581-3p

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE006723		Click to Show/Hide the Full List
mod site	chr1:37500942-37500943:-		[2]
Sequence	TACCTGTTTCCATGCCTCCTAGAAGTTCCGAAGCCAGGGTA
Transcript ID List	MIMAT0022276; ENST00000448519.2; ENST00000580821.1; ENST00000373075.6; ENST00000373074.5; ENST00000487792.5; ENST00000373073.8; ENST00000296214.9; ENST00000487788.5; ENST00000475828.5
External Link	RMBase: RNA-editing_site_4158

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE001612		Click to Show/Hide the Full List
mod site	chr1:37500935-37500936:-		[3]
Sequence	TTCCATGCCTCCTAGAAGTTCCGAAGCCAGGGTAAGAGTTC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000580821.1; ENST00000373075.6; ENST00000448519.2; ENST00000373074.5; ENST00000487788.5; ENST00000296214.9; MIMAT0022276; ENST00000373073.8; ENST00000487792.5; ENST00000475828.5
External Link	RMBase: m5C_site_2199

Ref 1	SMAD3 and FTO are involved in miR-5581-3p-mediated inhibition of cell migration and proliferation in bladder cancer. Cell Death Discov. 2022 Apr 13;8(1):199. doi: 10.1038/s41420-022-01010-8.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map